| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mendeliome v0.4316 | ADAT1 | Zornitza Stark Gene: adat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4316 | ADAT1 | Zornitza Stark Classified gene: ADAT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4316 | ADAT1 | Zornitza Stark Gene: adat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4315 | ADAT1 |
Zornitza Stark gene: ADAT1 was added gene: ADAT1 was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: ADAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAT1 were set to 28180185; 29390050; 29659736 Phenotypes for gene: ADAT1 were set to Hyperekplexia 4, MIM#618011 Review for gene: ADAT1 was set to GREEN Added comment: Hyperekplexia-4 is an autosomal recessive severe neurologic disorder apparent at birth. Three unrelated families reported. Affected infants have extreme hypertonia and appear stiff and rigid. They have little if any development, poor or absent visual contact, and no spontaneous movement, consistent with an encephalopathy. Some patients have early-onset refractory seizures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.66 | ADAT1 | Zornitza Stark Marked gene: ADAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.66 | ADAT1 | Zornitza Stark Gene: adat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.66 | ADAT1 | Zornitza Stark Classified gene: ADAT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.66 | ADAT1 | Zornitza Stark Gene: adat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.65 | ADAT1 |
Zornitza Stark gene: ADAT1 was added gene: ADAT1 was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: ADAT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAT1 were set to 28180185; 29390050; 29659736 Phenotypes for gene: ADAT1 were set to Hyperekplexia 4, MIM#618011 Review for gene: ADAT1 was set to GREEN Added comment: Hyperekplexia-4 is an autosomal recessive severe neurologic disorder apparent at birth. Three unrelated families reported. Affected infants have extreme hypertonia and appear stiff and rigid. They have little if any development, poor or absent visual contact, and no spontaneous movement, consistent with an encephalopathy. Some patients have early-onset refractory seizures. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.9 | OCA2 | Zornitza Stark Marked gene: OCA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.9 | OCA2 | Zornitza Stark Gene: oca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.9 | OCA2 | Zornitza Stark Phenotypes for gene: OCA2 were changed from to Albinism, brown oculocutaneous, MIM# 203200; Albinism, oculocutaneous, type II, MIM# 203200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.8 | OCA2 | Zornitza Stark Publications for gene: OCA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.7 | OCA2 | Zornitza Stark Mode of inheritance for gene: OCA2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ocular and Oculocutaneous Albinism v0.6 | OCA2 | Zornitza Stark reviewed gene: OCA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32741191, 20301410; Phenotypes: Albinism, brown oculocutaneous, MIM# 203200, Albinism, oculocutaneous, type II, MIM# 203200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4314 | OCA2 | Zornitza Stark Phenotypes for gene: OCA2 were changed from [Skin/hair/eye pigmentation 1, blond/brown hair] 227220; [Skin/hair/eye pigmentation 1, blue/nonblue eyes] 227220; Albinism, brown oculocutaneous 203200; Albinism, oculocutaneous, type II 203200; autosomal dominant Albinism, oculocutaneous to Albinism, brown oculocutaneous 203200; Albinism, oculocutaneous, type II 203200; autosomal dominant Albinism, oculocutaneous | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4313 | OCA2 | Zornitza Stark Publications for gene: OCA2 were set to 32741191; 24518832 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4312 | OCA2 | Zornitza Stark Tag SV/CNV tag was added to gene: OCA2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4312 | OCA2 | Zornitza Stark Marked gene: OCA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4312 | OCA2 | Zornitza Stark Gene: oca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4312 | OCA2 | Zornitza Stark Phenotypes for gene: OCA2 were changed from to [Skin/hair/eye pigmentation 1, blond/brown hair] 227220; [Skin/hair/eye pigmentation 1, blue/nonblue eyes] 227220; Albinism, brown oculocutaneous 203200; Albinism, oculocutaneous, type II 203200; autosomal dominant Albinism, oculocutaneous | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4311 | OCA2 | Zornitza Stark Publications for gene: OCA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4310 | OCA2 | Zornitza Stark Mode of inheritance for gene: OCA2 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4309 | OCA2 |
Elena Savva changed review comment from: Single variant found causing AD OCA - p.G780S in two families (Lee, 2020) -> GOF suggested Complete penetrance for oculocutaneous albininism but variable expressivity (PMID: 24518832). No variable expressivity or incomplete penetrance reported in GeneReviews. Loss of function; to: Single variant found causing AD OCA - p.G780S in two families (Lee, 2020) -> GOF suggested Complete penetrance for oculocutaneous albininism but variable expressivity (PMID: 24518832). No variable expressivity or incomplete penetrance reported in GeneReviews. Loss of function 2.7kb deletion is very common in sub-Saharan African populations (GeneReviews) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4309 | OCA2 | Elena Savva reviewed gene: OCA2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 32741191, 24518832; Phenotypes: [Skin/hair/eye pigmentation 1, blond/brown hair] 227220, [Skin/hair/eye pigmentation 1, blue/nonblue eyes] 227220, Albinism, brown oculocutaneous 203200, Albinism, oculocutaneous, type II 203200, autosomal dominant Albinism, oculocutaneous; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.7 | PIGN | Zornitza Stark Marked gene: PIGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.7 | PIGN | Zornitza Stark Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.7 | PIGN | Zornitza Stark Phenotypes for gene: PIGN were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 1 to Multiple congenital anomalies-hypotonia-seizures syndrome 1, 614080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.6 | PIGN | Zornitza Stark Classified gene: PIGN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.6 | PIGN | Zornitza Stark Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.5 | PIGN | Zornitza Stark reviewed gene: PIGN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 1, 614080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital diaphragmatic hernia v0.5 | PIGN |
Andrew Fennell gene: PIGN was added gene: PIGN was added to Congenital diaphragmatic hernia. Sources: Literature Mode of inheritance for gene: PIGN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIGN were set to PMID: 27038415; 24852103 Phenotypes for gene: PIGN were set to Multiple congenital anomalies-hypotonia-seizures syndrome 1 Penetrance for gene: PIGN were set to Complete Review for gene: PIGN was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4309 | ZSWIM6 |
Zornitza Stark changed review comment from: MIM #617865 (NEDMAGA): A recurrent de novo heterozygous truncating mutation in the ZSWIM6 gene (R913X)identified in 7 unrelated patients. Analysis of patient cells indicated that the mutant transcript escaped nonsense-mediated mRNA decay, and most likely produced a truncated protein, although antibody studies were unable to detect a truncated protein. Possible dominant-negative effect. NB a more proximal nonsense variant was also reported inherited in a family with an unaffected mother: loss of function variants may not cause a phenotype. MIM#603671 (acromelic frontonasal dysplasia): recurrent missense identified in 6 unrelated families, p.Arg1163Trp; to: MIM #617865 (NEDMAGA): A recurrent de novo heterozygous truncating mutation in the ZSWIM6 gene (R913X) identified in 7 unrelated patients. Analysis of patient cells indicated that the mutant transcript escaped nonsense-mediated mRNA decay, and most likely produced a truncated protein, although antibody studies were unable to detect a truncated protein. Possible dominant-negative effect. NB a more proximal nonsense variant was also reported inherited in a family with an unaffected mother: loss of function variants may not cause a phenotype. MIM#603671 (acromelic frontonasal dysplasia): recurrent missense identified in 6 unrelated families, p.Arg1163Trp |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4309 | ZSWIM6 |
Zornitza Stark changed review comment from: MIM #617865 A recurrent de novo heterozygous truncating mutation in the ZSWIM6 gene (R913X)identified in 7 unrelated patients. Analysis of patient cells indicated that the mutant transcript escaped nonsense-mediated mRNA decay, and most likely produced a truncated protein, although antibody studies were unable to detect a truncated protein. Possible dominant-negative effect. NB a more proximal nonsense variant was also reported inherited in a family with an unaffected mother: loss of function variants may not cause a phenotype. MIM#603671: recurrent missense identified in 6 unrelated families, p.Arg1163Trp; to: MIM #617865 (NEDMAGA): A recurrent de novo heterozygous truncating mutation in the ZSWIM6 gene (R913X)identified in 7 unrelated patients. Analysis of patient cells indicated that the mutant transcript escaped nonsense-mediated mRNA decay, and most likely produced a truncated protein, although antibody studies were unable to detect a truncated protein. Possible dominant-negative effect. NB a more proximal nonsense variant was also reported inherited in a family with an unaffected mother: loss of function variants may not cause a phenotype. MIM#603671 (acromelic frontonasal dysplasia): recurrent missense identified in 6 unrelated families, p.Arg1163Trp |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4309 | SREBF1 | Zornitza Stark Phenotypes for gene: SREBF1 were changed from IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome to IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome 2, MIM619016 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4308 | SREBF1 | Zornitza Stark reviewed gene: SREBF1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome 2, MIM619016; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.98 | SREBF1 | Zornitza Stark Phenotypes for gene: SREBF1 were changed from IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome to IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome 2, MIM619016 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.97 | SREBF1 | Zornitza Stark edited their review of gene: SREBF1: Changed phenotypes: IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome 2, MIM619016 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.30 | VPS13D | Zornitza Stark Marked gene: VPS13D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.30 | VPS13D | Zornitza Stark Gene: vps13d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.30 | VPS13D | Zornitza Stark Phenotypes for gene: VPS13D were changed from to Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.29 | VPS13D | Zornitza Stark Publications for gene: VPS13D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.28 | VPS13D | Zornitza Stark Mode of inheritance for gene: VPS13D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.27 | VPS13D | Zornitza Stark reviewed gene: VPS13D: Rating: GREEN; Mode of pathogenicity: None; Publications: 29604224, 29518281; Phenotypes: Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4308 | VPS13D | Zornitza Stark Marked gene: VPS13D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4308 | VPS13D | Zornitza Stark Gene: vps13d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4308 | VPS13D | Zornitza Stark Phenotypes for gene: VPS13D were changed from to Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4307 | VPS13D | Zornitza Stark Publications for gene: VPS13D were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4306 | VPS13D | Zornitza Stark Mode of inheritance for gene: VPS13D was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.138 | VPS13D | Zornitza Stark Marked gene: VPS13D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.138 | VPS13D | Zornitza Stark Gene: vps13d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.138 | VPS13D | Zornitza Stark Classified gene: VPS13D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.138 | VPS13D | Zornitza Stark Gene: vps13d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.137 | VPS13D |
Zornitza Stark gene: VPS13D was added gene: VPS13D was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: VPS13D was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: VPS13D were set to 29604224; 29518281 Phenotypes for gene: VPS13D were set to Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317 Review for gene: VPS13D was set to GREEN Added comment: 7 unrelated families reported and a mouse model. Most affected individuals have ataxic gait with spasticity and hyperreflexia of the lower limbs resulting in difficulty walking. The age at onset is highly variable: some have onset in early childhood with delayed walking, whereas others have onset of gait difficulties in adulthood. Additional features may include dysarthria, oculomotor abnormalities, distal sensory impairment, dystonia, chorea, hypotonia, pyramidal signs, and cerebellar atrophy on brain imaging. The disorder is slowly progressive. Some individuals with onset in childhood may have global developmental delay with mild intellectual disability. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.136 | VAMP2 | Zornitza Stark Marked gene: VAMP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.136 | VAMP2 | Zornitza Stark Gene: vamp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.136 | VAMP2 | Zornitza Stark Classified gene: VAMP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.136 | VAMP2 | Zornitza Stark Gene: vamp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.135 | VAMP2 |
Zornitza Stark gene: VAMP2 was added gene: VAMP2 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: VAMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VAMP2 were set to 30929742 Phenotypes for gene: VAMP2 were set to Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760; Dystonia; Cortical visual impairment; Seizures; Stereotypic behaviour; Generalized hypotonia; Intellectual disability Review for gene: VAMP2 was set to GREEN Added comment: 5 unrelated patients with heterozygous de novo mutations in VAMP2, presenting with a neurodevelopmental disorder characterized by axial hypotonia, intellectual disability, and autistic features. Affected individuals carrying de novo non-synonymous variants involving the C-terminal region presented a more severe phenotype with additional neurological features, including central visual impairment, hyperkinetic movement disorder, and epilepsy or electroencephalography abnormalities. Reconstituted fusion involving a lipid-mixing assay indicated impairment in vesicle fusion as one of the possible associated disease mechanisms. The abnormal movements included dystonia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2983 | VAMP2 | Zornitza Stark Phenotypes for gene: VAMP2 were changed from Intellectual disability; autism; no OMIM number yet to Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760; Cortical visual impairment; Seizures; Stereotypic behaviour; Generalized hypotonia; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | VAMP2 | Zornitza Stark reviewed gene: VAMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760, Cortical visual impairment, Seizures, Stereotypic behaviour, Generalized hypotonia, Intellectual disability; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.852 | VAMP2 | Zornitza Stark Phenotypes for gene: VAMP2 were changed from Cortical visual impairment; Seizures; Stereotypic behaviour; Generalized hypotonia; Intellectual disability to Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760; Cortical visual impairment; Seizures; Stereotypic behaviour; Generalized hypotonia; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.851 | VAMP2 | Zornitza Stark edited their review of gene: VAMP2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760, Cortical visual impairment, Seizures, Stereotypic behaviour, Generalized hypotonia, Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4305 | VAMP2 | Zornitza Stark Phenotypes for gene: VAMP2 were changed from Intellectual disability; Autism to Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760; Intellectual disability; Autism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4304 | VAMP2 | Zornitza Stark edited their review of gene: VAMP2: Changed phenotypes: Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760, Intellectual disability, Autism | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.134 | VAMP1 | Zornitza Stark Marked gene: VAMP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.134 | VAMP1 | Zornitza Stark Gene: vamp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.134 | VAMP1 | Zornitza Stark Classified gene: VAMP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.134 | VAMP1 | Zornitza Stark Gene: vamp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.133 | VAMP1 |
Zornitza Stark gene: VAMP1 was added gene: VAMP1 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: VAMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: VAMP1 were set to 22958904 Phenotypes for gene: VAMP1 were set to Spastic ataxia 1, autosomal dominant, MIM# 108600 Review for gene: VAMP1 was set to GREEN Added comment: Autosomal dominant neurodegenerative disorder characterised by lower-limb spasticity and generalized ataxia with dysarthria, impaired ocular movements, and gait disturbance. Onset is between the ages of 10 and 20 years. Other clinical features are supranuclear gaze palsy, hyperreflexia, hypertonicity, dystonia, pes cavus, mild ptosis, and decreased vibration sense in the lower limbs. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.132 | SURF1 | Zornitza Stark Marked gene: SURF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.132 | SURF1 | Zornitza Stark Gene: surf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.132 | SURF1 | Zornitza Stark Classified gene: SURF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.132 | SURF1 | Zornitza Stark Gene: surf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.131 | SURF1 |
Zornitza Stark gene: SURF1 was added gene: SURF1 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: SURF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SURF1 were set to 19780766 Phenotypes for gene: SURF1 were set to Leigh syndrome, due to COX IV deficiency, MIM# 256000 Review for gene: SURF1 was set to GREEN Added comment: SURF1 gene mutations are the most common cause of Leigh syndrome (LS), a progressive neurodegenerative disorder of infancy, characterised by symmetric necrotizing lesions and hypervascularity in the brainstem and basal ganglia. Dystonia is part of the phenotype, particularly in those with milder phenotypes/missense variants. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.157 | SQSTM1 | Zornitza Stark Marked gene: SQSTM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.157 | SQSTM1 | Zornitza Stark Gene: sqstm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.157 | SQSTM1 | Zornitza Stark Phenotypes for gene: SQSTM1 were changed from to Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.156 | SQSTM1 | Zornitza Stark Publications for gene: SQSTM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.155 | SQSTM1 | Zornitza Stark Mode of inheritance for gene: SQSTM1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.154 | SQSTM1 | Zornitza Stark reviewed gene: SQSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27545679; Phenotypes: Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.130 | SQSTM1 | Zornitza Stark Phenotypes for gene: SQSTM1 were changed from Myopathy, distal, with rimmed vacuoles 617158 to Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.129 | SQSTM1 | Zornitza Stark reviewed gene: SQSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.38 | FARSA | Zornitza Stark Marked gene: FARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.38 | FARSA | Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.38 | FARSA |
Zornitza Stark gene: FARSA was added gene: FARSA was added to Brain Calcification. Sources: Expert list Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FARSA were set to 31355908 Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013 Review for gene: FARSA was set to RED Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4304 | FARSA | Zornitza Stark Marked gene: FARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4304 | FARSA | Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4304 | FARSA |
Zornitza Stark gene: FARSA was added gene: FARSA was added to Mendeliome. Sources: Expert list Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FARSA were set to 31355908 Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013 Review for gene: FARSA was set to RED Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.13 | FARSA | Zornitza Stark Marked gene: FARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.13 | FARSA | Zornitza Stark Gene: farsa has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.13 | FARSA | Zornitza Stark Phenotypes for gene: FARSA were changed from Rajab interstitial lung disease with brain calcifications 2 619013 to Rajab interstitial lung disease with brain calcifications 2, MIM# 619013 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.12 | FARSA |
Zornitza Stark gene: FARSA was added gene: FARSA was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Literature Mode of inheritance for gene: FARSA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FARSA were set to 31355908 Phenotypes for gene: FARSA were set to Rajab interstitial lung disease with brain calcifications 2 619013 Review for gene: FARSA was set to RED Added comment: Autosomal recessive disorder characterized by growth delay, interstitial lung disease, liver disease, and abnormal brain MRI findings, including brain calcifications and periventricular cysts. Single affected individual reported, but FARSA interacts with FARSB, which causes a similar disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.129 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.129 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.129 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463, 24411498; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4303 | SLC1A3 | Zornitza Stark Marked gene: SLC1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4303 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4303 | SLC1A3 | Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4302 | SLC1A3 | Zornitza Stark Publications for gene: SLC1A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4301 | SLC1A3 | Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4300 | SLC1A3 | Zornitza Stark reviewed gene: SLC1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.64 | SLC1A3 | Zornitza Stark Marked gene: SLC1A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.64 | SLC1A3 | Zornitza Stark Gene: slc1a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.64 | SLC1A3 | Zornitza Stark Phenotypes for gene: SLC1A3 were changed from to Episodic ataxia, type 6, MIM# 612656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.63 | SLC1A3 | Zornitza Stark Publications for gene: SLC1A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.62 | SLC1A3 | Zornitza Stark Mode of inheritance for gene: SLC1A3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.61 | SLC1A3 | Zornitza Stark reviewed gene: SLC1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 19139306, 16116111, 29208948, 27829685; Phenotypes: Episodic ataxia, type 6, MIM# 612656; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4300 | ANGPT2 | Zornitza Stark Marked gene: ANGPT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4300 | ANGPT2 | Zornitza Stark Gene: angpt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4300 | ANGPT2 | Zornitza Stark Classified gene: ANGPT2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4300 | ANGPT2 | Zornitza Stark Gene: angpt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4299 | ANGPT2 |
Zornitza Stark gene: ANGPT2 was added gene: ANGPT2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ANGPT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ANGPT2 were set to https://stm.sciencemag.org/content/12/560/eaax8013 Phenotypes for gene: ANGPT2 were set to Primary lymphoedema Review for gene: ANGPT2 was set to GREEN Added comment: Five unrelated individuals reported with primary lymphedema and variants in this gene, together with functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4298 | UBR4 | Zornitza Stark changed review comment from: Episodic ataxia reported in two families, but another molecular diagnosis present in the second, so suggested as a modifier. Only one individual reported with childhood-onset progressive neurological disorder as part of a large paper proposing multiple candidate genes.; to: Episodic ataxia reported in four families, but another molecular diagnosis present in the some, so suggested as a modifier. Variants are missense, with no supportive segregation or functional data, some are present at a low level in population databases. Only one individual reported with childhood-onset progressive neurological disorder as part of a large paper proposing multiple candidate genes. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.61 | UBR4 | Zornitza Stark Marked gene: UBR4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.61 | UBR4 | Zornitza Stark Gene: ubr4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.61 | UBR4 | Zornitza Stark Publications for gene: UBR4 were set to PMID 23982692 PMID 29062094 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.60 | UBR4 | Zornitza Stark Mode of inheritance for gene: UBR4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.59 | UBR4 | Zornitza Stark Classified gene: UBR4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.59 | UBR4 | Zornitza Stark Gene: ubr4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.58 | UBR4 | Zornitza Stark changed review comment from: Four unrelated individuals reported with missense variants in this gene and episodic ataxia. However, no segregation or functional data to support gene-disease association, and some of the variants are present at a low frequency in population databases.; to: Four unrelated individuals reported with missense variants in this gene and episodic ataxia. However, no segregation or functional data to support gene-disease association, and some of the variants are present at a low frequency in population databases. Variants in other putative ataxia genes present in some of the individuals. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.58 | UBR4 | Zornitza Stark reviewed gene: UBR4: Rating: RED; Mode of pathogenicity: None; Publications: 23982692, 29062094; Phenotypes: Episodic ataxia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.58 | TBC1D24 | Zornitza Stark Marked gene: TBC1D24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.58 | TBC1D24 | Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.58 | TBC1D24 | Zornitza Stark Phenotypes for gene: TBC1D24 were changed from Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss to Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105; Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.57 | TBC1D24 | Zornitza Stark Mode of inheritance for gene: TBC1D24 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.56 | TBC1D24 | Zornitza Stark reviewed gene: TBC1D24: Rating: GREEN; Mode of pathogenicity: None; Publications: 31257402; Phenotypes: Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.56 | TBC1D24 | Zornitza Stark Classified gene: TBC1D24 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.56 | TBC1D24 | Zornitza Stark Gene: tbc1d24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.55 | HIBCH | Zornitza Stark Marked gene: HIBCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.55 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.55 | HIBCH | Zornitza Stark Phenotypes for gene: HIBCH were changed from Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy. to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620; Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.54 | HIBCH | Zornitza Stark Classified gene: HIBCH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.54 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.53 | HIBCH | Zornitza Stark reviewed gene: HIBCH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.57 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.57 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.57 | SLC20A2 | Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.56 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.55 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.54 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.154 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.154 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.154 | SLC20A2 | Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.153 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.152 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.152 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.151 | SLC20A2 | Zornitza Stark Classified gene: SLC20A2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.151 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.150 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: RED; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4298 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4298 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4298 | SLC20A2 | Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4297 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4296 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4295 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.37 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.37 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.37 | SLC20A2 | Zornitza Stark Phenotypes for gene: SLC20A2 were changed from to Basal ganglia calcification, idiopathic, 1, MIM# 213600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.36 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.35 | SLC20A2 | Zornitza Stark Mode of inheritance for gene: SLC20A2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Brain Calcification v0.34 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 22327515, 23334463; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.53 | SLC20A2 | Zornitza Stark Marked gene: SLC20A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.53 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.53 | SLC20A2 | Zornitza Stark Phenotypes for gene: SLC20A2 were changed from Paroxysmal kinesigenic dyskinesia; Basal ganglia calcification to Basal ganglia calcification, idiopathic, 1, MIM# 213600; Paroxysmal kinesigenic dyskinesia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.52 | SLC20A2 | Zornitza Stark Publications for gene: SLC20A2 were set to PMID 24411498 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.51 | SLC20A2 | Zornitza Stark Classified gene: SLC20A2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.51 | SLC20A2 | Zornitza Stark Gene: slc20a2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.50 | SLC20A2 | Zornitza Stark reviewed gene: SLC20A2: Rating: RED; Mode of pathogenicity: None; Publications: 22327515, 23334463, 24411498; Phenotypes: Basal ganglia calcification, idiopathic, 1, MIM# 213600; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.116 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.116 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.116 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.115 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.174 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.174 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.174 | SLC16A2 | Zornitza Stark Phenotypes for gene: SLC16A2 were changed from General Leukodystrophy & Mitochondrial Leukoencephalopathy; Allan-Herndon-Dudley syndrome; Monocarboxylate transporter 8 deficiency (MCT8); Hypomyelinating Leukodystrophy & Pelizaeus-Merzbacher Disease to Allan-Herndon-Dudley syndrome, MIM# 300523; Hypomyelination | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.173 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.172 | SLC16A2 | Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.171 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC16A2 |
Zornitza Stark changed review comment from: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying reported. Sources: Expert Review; to: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. In a recent review of 24 affected individuals (PMID 31410843), 16 presented with profound developmental delay, three had severe intellectual disability with poor language and walking with an aid, four had moderate intellectual disability with language and walking abilities, and one had mild intellectual disability with hypotonia. Overall, eight had learned to walk, all had hypotonia, 17 had spasticity, 18 had dystonia, 12 had choreoathetosis, 19 had hypomyelination, and 10 had brain atrophy. Kyphoscoliosis (n=12), seizures (n=7), and pneumopathies (n=5) were the most severe complications. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying is reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | SLC16A2 | Zornitza Stark changed review comment from: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability.; to: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. In a recent review of 24 affected individuals (PMID 31410843), 16 presented with profound developmental delay, three had severe intellectual disability with poor language and walking with an aid, four had moderate intellectual disability with language and walking abilities, and one had mild intellectual disability with hypotonia. Overall, eight had learned to walk, all had hypotonia, 17 had spasticity, 18 had dystonia, 12 had choreoathetosis, 19 had hypomyelination, and 10 had brain atrophy. Kyphoscoliosis (n=12), seizures (n=7), and pneumopathies (n=5) were the most severe complications. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.851 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.851 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.851 | SLC16A2 | Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.850 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.849 | SLC16A2 | Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4295 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4295 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4295 | SLC16A2 | Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4294 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4293 | SLC16A2 | Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4292 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC16A2 | Zornitza Stark Classified gene: SLC16A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.128 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.127 | SLC16A2 |
Zornitza Stark gene: SLC16A2 was added gene: SLC16A2 was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for gene: SLC16A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: SLC16A2 were set to 15980113; 31410843; 20301789 Phenotypes for gene: SLC16A2 were set to Allan-Herndon-Dudley syndrome, MIM# 300523 Review for gene: SLC16A2 was set to GREEN Added comment: Allan-Herndon-Dudley syndrome (AHDS) is an X-linked condition characterized by severely impaired intellectual development, dysarthria, athetoid movements, muscle hypoplasia, and spastic paraplegia. There is large phenotypic interfamilial and intrafamilial variability. Paroxysmal dystonic dyskinesia triggered by passive movements, excitement, crying reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v0.136 | ADAMTSL4 | Zornitza Stark Marked gene: ADAMTSL4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v0.136 | ADAMTSL4 | Zornitza Stark Gene: adamtsl4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.35 | Zornitza Stark removed gene:TRIP13 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4292 | TRIP13 | Zornitza Stark Tag founder tag was added to gene: TRIP13. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4292 | TRIP13 | Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Oocyte maturation defect 9, MIM# 619011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4291 | TRIP13 | Zornitza Stark Publications for gene: TRIP13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4290 | TRIP13 | Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | TRIP13 | Zornitza Stark reviewed gene: TRIP13: Rating: GREEN; Mode of pathogenicity: None; Publications: 28553959, 32473092; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598, Oocyte maturation defect 9, MIM# 619011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | TRIP13 | Zornitza Stark Tag founder tag was added to gene: TRIP13. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.83 | TRIP13 | Zornitza Stark Tag founder tag was added to gene: TRIP13. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.83 | TRIP13 | Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.83 | TRIP13 | Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.82 | TRIP13 | Zornitza Stark changed review comment from: Predisposition to Wilms tumour, six unrelated individuals reported.; to: Predisposition to Wilms tumour, six unrelated individuals reported. Note 5/6 families had the same variant, suggestive of founder effect. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cancer Predisposition_Paediatric v0.82 | TRIP13 | Zornitza Stark edited their review of gene: TRIP13: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v0.136 | ADAMTSL4 |
Bryony Thompson gene: ADAMTSL4 was added gene: ADAMTSL4 was added to Craniosynostosis. Sources: Literature Mode of inheritance for gene: ADAMTSL4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ADAMTSL4 were set to 22871183; 20702823 Phenotypes for gene: ADAMTSL4 were set to Ectopia lentis et pupillae MIM#225200 Review for gene: ADAMTSL4 was set to RED Added comment: Two cases with craniosynostosis and the same 20 bp deletion have been repeated, but cases with the same variant in the same family have been reported with ectopia lentis only. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | HSP90B2P | Bryony Thompson changed review comment from: Cannot find any link to any disease at all. This is a pseudogene. It may have been included because its previous gene symbol is TRAP1; to: Cannot find any link to any disease at all. There is no OMIM entry for this pseudogene. It may have been included because its previous gene symbol is TRAP1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | HSP90B2P | Bryony Thompson Marked gene: HSP90B2P as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | HSP90B2P | Bryony Thompson Gene: hsp90b2p has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | HSP90B2P | Bryony Thompson Classified gene: HSP90B2P as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4289 | HSP90B2P | Bryony Thompson Gene: hsp90b2p has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4288 | HSP90B2P | Bryony Thompson reviewed gene: HSP90B2P: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: Unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.146 | NEDD4L | Zornitza Stark Classified gene: NEDD4L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.146 | NEDD4L | Zornitza Stark Gene: nedd4l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.145 | NEDD4L | Zornitza Stark Marked gene: NEDD4L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.145 | NEDD4L | Zornitza Stark Gene: nedd4l has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.145 | NEDD4L | Zornitza Stark Phenotypes for gene: NEDD4L were changed from Periventricular nodular heterotopia; polymicrogyria; syndactyly to Periventricular nodular heterotopia 7, MIM# 617201; polymicrogyria; syndactyly | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.144 | COL4A2 | Zornitza Stark Marked gene: COL4A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.144 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.144 | COL4A2 | Zornitza Stark Phenotypes for gene: COL4A2 were changed from 614483 to Brain small vessel disease 2, MIM#614483 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.143 | COL4A2 | Zornitza Stark Classified gene: COL4A2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.143 | COL4A2 | Zornitza Stark Gene: col4a2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2982 | SLC16A2 | Zornitza Stark Phenotypes for gene: SLC16A2 were changed from to Allan-Herndon-Dudley syndrome, MIM# 300523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2981 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2980 | SLC16A2 | Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2979 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.50 | SLC16A2 | Zornitza Stark Marked gene: SLC16A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.50 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.50 | SLC16A2 | Zornitza Stark Phenotypes for gene: SLC16A2 were changed from paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia to Allan-Herndon-Dudley syndrome, MIM# 300523; paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.49 | SLC16A2 | Zornitza Stark Publications for gene: SLC16A2 were set to PMID 20301789 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.48 | SLC16A2 | Zornitza Stark Mode of inheritance for gene: SLC16A2 was changed from Other to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.47 | SLC16A2 | Zornitza Stark Classified gene: SLC16A2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.47 | SLC16A2 | Zornitza Stark Gene: slc16a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.46 | SLC16A2 | Zornitza Stark reviewed gene: SLC16A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15980113, 31410843, 20301789; Phenotypes: Allan-Herndon-Dudley syndrome, MIM# 300523; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.46 | PDGFB | Zornitza Stark Marked gene: PDGFB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.46 | PDGFB | Zornitza Stark Gene: pdgfb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.46 | PDGFB | Zornitza Stark Phenotypes for gene: PDGFB were changed from Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification to Basal ganglia calcification, idiopathic, 5, MIM# 615483; Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.45 | PDGFB | Zornitza Stark Publications for gene: PDGFB were set to PMID 28556368; PMID 32443735 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.44 | PDGFB | Zornitza Stark Mode of inheritance for gene: PDGFB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.43 | PDGFB | Zornitza Stark Classified gene: PDGFB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.43 | PDGFB | Zornitza Stark Gene: pdgfb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | PDGFB | Zornitza Stark reviewed gene: PDGFB: Rating: GREEN; Mode of pathogenicity: None; Publications: 23913003; Phenotypes: Basal ganglia calcification, idiopathic, 5, MIM# 615483; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | COL4A2 |
Chloe Stutterd gene: COL4A2 was added gene: COL4A2 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: COL4A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: COL4A2 were set to 30315939 Phenotypes for gene: COL4A2 were set to 614483 Review for gene: COL4A2 was set to AMBER Added comment: Two unrelated individuals reported with PMG. Third unrelated family identified in MCRI study not yet published Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | NEDD4L |
Chloe Stutterd gene: NEDD4L was added gene: NEDD4L was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NEDD4L were set to 27694961; 28515470; 30393983 Phenotypes for gene: NEDD4L were set to Periventricular nodular heterotopia; polymicrogyria; syndactyly Review for gene: NEDD4L was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.126 | OPA3 | Zornitza Stark Marked gene: OPA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.126 | OPA3 | Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.126 | OPA3 | Zornitza Stark Phenotypes for gene: OPA3 were changed from developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia to 3-methylglutaconic aciduria, type III, MIM# 258501; developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.125 | OPA3 | Zornitza Stark Publications for gene: OPA3 were set to PMID: 20301646 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.124 | OPA3 | Zornitza Stark Classified gene: OPA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.124 | OPA3 | Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | OPA3 | Zornitza Stark reviewed gene: OPA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 7510656, 2494568, 11668429; Phenotypes: 3-methylglutaconic aciduria, type III, MIM# 258501; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.387 | DMXL2 | Zornitza Stark Phenotypes for gene: DMXL2 were changed from Autosomal dominant hearing loss; autosomal recessive EE with deafness to Autosomal dominant hearing loss; Epileptic encephalopathy, early infantile, 81, MIM#618663, includes deafness | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4288 | NOBOX | Zornitza Stark Marked gene: NOBOX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4288 | NOBOX | Zornitza Stark Gene: nobox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4288 | NOBOX | Zornitza Stark Phenotypes for gene: NOBOX were changed from to Premature ovarian failure 5,MIM#611548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4287 | NOBOX | Zornitza Stark Publications for gene: NOBOX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4286 | NOBOX | Zornitza Stark Mode of inheritance for gene: NOBOX was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4285 | NOBOX | Zornitza Stark reviewed gene: NOBOX: Rating: GREEN; Mode of pathogenicity: None; Publications: 27836978, 21837770, 25514101, 17701902, 27798098, 29067606; Phenotypes: Premature ovarian failure 5,MIM#611548; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 | NOBOX | Zornitza Stark Marked gene: NOBOX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 | NOBOX | Zornitza Stark Gene: nobox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.34 | NOBOX | Zornitza Stark Publications for gene: NOBOX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.33 | NOBOX | Zornitza Stark Mode of inheritance for gene: NOBOX was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | UBR4 |
Eunice Chan gene: UBR4 was added gene: UBR4 was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: UBR4 was set to Unknown Publications for gene: UBR4 were set to PMID 23982692 PMID 29062094 Phenotypes for gene: UBR4 were set to early onset episodic ataxia; nystagmus; myokymia; tremor |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | TBC1D24 |
Eunice Chan gene: TBC1D24 was added gene: TBC1D24 was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: TBC1D24 was set to Unknown Publications for gene: TBC1D24 were set to PMID 31257402; PMID 31226716; PMID 25719194 Phenotypes for gene: TBC1D24 were set to Episodic dystonia (Exercise induced or without clear trigger); epilepsy; myoclonus; hearing loss Added comment: Main phenotype with epilepsy and seizures. Other phenotypes include paroxysmal exercise induced dyskinesia, episodic dystonia, DOORS, non-syndromic hearing loss, myoclonus Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | HIBCH |
Eunice Chan gene: HIBCH was added gene: HIBCH was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HIBCH were set to PMID 31679561 Phenotypes for gene: HIBCH were set to Paroxysmal dyskinesia (exercise induced or without clear trigger; isolated or with additional features; mitochondrial disorder (Leigh syndrome); neurodevelopmental disability; epilepsy. Added comment: OMIM 610690 If mild phenotype, can present with PED, hyperCKaemia, hyperammoniaemia and pallidal hyperintensities on MRI Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | SLC20A2 |
Eunice Chan gene: SLC20A2 was added gene: SLC20A2 was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: SLC20A2 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: SLC20A2 were set to PMID 24411498 Phenotypes for gene: SLC20A2 were set to Paroxysmal kinesigenic dyskinesia; Basal ganglia calcification Added comment: Case report of 1 family Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | SLC16A2 |
Eunice Chan gene: SLC16A2 was added gene: SLC16A2 was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: SLC16A2 was set to Other Publications for gene: SLC16A2 were set to PMID 20301789 Phenotypes for gene: SLC16A2 were set to paroxysmal dyskinesia (passive movement trigger); neurodevelopmental disability, hypotonia Added comment: X-linked inheritance Allan-Herndon-Dudley Syndrome paroxysmal dystonic dyskinesia triggered by poassive movements, excitement, crying High fT3 also characteristic Please also include on dystonia-Complex panel Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | PDGFB | Eunice Chan reviewed gene: PDGFB: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | PDGFB |
Eunice Chan gene: PDGFB was added gene: PDGFB was added to Paroxysmal Dyskinesia. Sources: Expert list Mode of inheritance for gene: PDGFB was set to Unknown Publications for gene: PDGFB were set to PMID 28556368; PMID 32443735 Phenotypes for gene: PDGFB were set to Paroxysmal nonkinesigenic dyskinesia; paroxysmal kinesigenic dyskinesia; Brain calcification |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | OPA3 |
Eunice Chan gene: OPA3 was added gene: OPA3 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: OPA3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OPA3 were set to PMID: 20301646 Phenotypes for gene: OPA3 were set to developmental delay, hypotonia; dystonia and chorea; ataxia, optic atrophy; spastic paraplegia Added comment: Costeff syndrome, most patients are Iraqi-Jewish ancestry Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | DMXL2 | Chern Lim reviewed gene: DMXL2: Rating: ; Mode of pathogenicity: None; Publications: 30732576, 27657680; Phenotypes: Epileptic encephalopathy, early infantile, 81, MIM#618663, Autosomal recessive; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | SETX | Zornitza Stark Marked gene: SETX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | SETX | Zornitza Stark Gene: setx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | SETX | Zornitza Stark Classified gene: SETX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.123 | SETX | Zornitza Stark Gene: setx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.122 | SETX |
Zornitza Stark gene: SETX was added gene: SETX was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: SETX was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SETX were set to 19696032 Phenotypes for gene: SETX were set to Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM# 606002 Review for gene: SETX was set to GREEN Added comment: Dystonia was present in around 13% in a cohort of 90 affected individuals. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.121 | PSEN1 | Zornitza Stark Marked gene: PSEN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.121 | PSEN1 | Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.121 | PSEN1 | Zornitza Stark Phenotypes for gene: PSEN1 were changed from Frontotemporal dementia; Dystonia to Frontotemporal dementia, MIM# 600274; Dystonia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.120 | PSEN1 | Zornitza Stark Classified gene: PSEN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.120 | PSEN1 | Zornitza Stark Gene: psen1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.119 | PSEN1 | Zornitza Stark changed review comment from: Variants in this gene are typically associated with Alzheimer's disease and other dementias. One case report of a primary presentation with Parkinsonism-dystonia, later complicated by dementia.; to: Variants in this gene are typically associated with Alzheimer's disease and other dementias but there are reports of complex movement disorders preceding or as part of dementia presentations. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.119 | PSEN1 | Zornitza Stark edited their review of gene: PSEN1: Changed rating: GREEN; Changed publications: 12810495, 15159497, 29316780, 28664294 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.119 | PSEN1 | Zornitza Stark Classified gene: PSEN1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.119 | PSEN1 | Zornitza Stark Gene: psen1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.118 | PSEN1 | Zornitza Stark reviewed gene: PSEN1: Rating: RED; Mode of pathogenicity: None; Publications: 28664294; Phenotypes: Dementia, frontotemporal, MIM# 600274; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.118 | POLR3A | Zornitza Stark Marked gene: POLR3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.118 | POLR3A | Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.118 | POLR3A | Zornitza Stark Classified gene: POLR3A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.118 | POLR3A | Zornitza Stark Gene: polr3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.117 | POLR3A |
Zornitza Stark gene: POLR3A was added gene: POLR3A was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: POLR3A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLR3A were set to 32600288; 32373668; 31940116; 31932101; 29618326 Phenotypes for gene: POLR3A were set to Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694; Striatal abnormalities; Dystonia Review for gene: POLR3A was set to GREEN Added comment: Multiple individuals reported where dystonia is part of the phenotype. Some of these have had hypomyelinating leukodystrophy, whereas others have had very prominent striatal abnormalities on MRI, in the absence of white matter changes. It is unclear whether this represents a continuum or a separate disorder. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.116 | PNKP | Zornitza Stark Marked gene: PNKP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.116 | PNKP | Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.116 | PNKP | Zornitza Stark Classified gene: PNKP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.116 | PNKP | Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.115 | PNKP |
Zornitza Stark gene: PNKP was added gene: PNKP was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: PNKP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PNKP were set to 28552035; 25728773 Phenotypes for gene: PNKP were set to Ataxia-oculomotor apraxia 4, MIM# 616267 Review for gene: PNKP was set to GREEN Added comment: Dystonia is part of this complex neurological phenotype, which also includes ataxia, oculomotor apraxia and peripheral neuropathy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.114 | PDGFRB | Zornitza Stark Marked gene: PDGFRB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.114 | PDGFRB | Zornitza Stark Gene: pdgfrb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.114 | PDGFRB | Zornitza Stark Phenotypes for gene: PDGFRB were changed from Dystonia; Basal ganglia calcification, idiopathic, 4 615007 to Basal ganglia calcification, idiopathic, 4, MIM# 615007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.113 | PDGFRB | Zornitza Stark Publications for gene: PDGFRB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.112 | PDGFRB | Zornitza Stark Classified gene: PDGFRB as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.112 | PDGFRB | Zornitza Stark Gene: pdgfrb has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.111 | PDGFRB | Zornitza Stark reviewed gene: PDGFRB: Rating: RED; Mode of pathogenicity: None; Publications: 24518837; Phenotypes: Basal ganglia calcification, idiopathic, MIM#4 615007; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4285 | Zornitza Stark removed gene:DNAJC7 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.54 | DNAJC7 | Zornitza Stark reviewed gene: DNAJC7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: amyotrophic lateral sclerosis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.35 | DNAJC7 | Zornitza Stark Marked gene: DNAJC7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.35 | DNAJC7 | Zornitza Stark Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.35 | DNAJC7 | Zornitza Stark Classified gene: DNAJC7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.35 | DNAJC7 | Zornitza Stark Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.34 | DNAJC7 |
Zornitza Stark gene: DNAJC7 was added gene: DNAJC7 was added to Incidentalome. Sources: Literature Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DNAJC7 were set to 31768050 Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis Review for gene: DNAJC7 was set to AMBER Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. No segregation or functional data. A small number of individuals with LOF variants are present in gnomad albeit less than expected. Given these are cohort studies, and an adult-onset condition, potentially of variable penetrance, we have taken a cautious approach and rated Amber for now. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4284 | TET2 | Zornitza Stark Phenotypes for gene: TET2 were changed from Dementia; Lymphoma/myeloid malignancy to Dementia; Lymphoma/myeloid malignancy; Immunodeficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4283 | TET2 | Zornitza Stark Mode of inheritance for gene: TET2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4282 | TET2 | Zornitza Stark Classified gene: TET2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4282 | TET2 | Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | NOBOX | Ee Ming Wong edited their review of gene: NOBOX: Changed publications: PMIDs: 27836978, 21837770, 25514101, 17701902, 27798098, 29067606; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | NOBOX |
Ee Ming Wong changed review comment from: - Missense and PTC variants have been identified in > 3 unrelated women diagnosed with POI from different studies - The vast majority of variants are heterozygous, with only one homozygous variant reported in 1 individual with primary amenorrhea and serum FSH level significantly exceeding the threshold value (PMID: 27836978) - Loss of Function has been clearly demonstrated, while dominant negative effect has also been suggested although there is currently limited evidence (PMID: 17701902) - Individuals carrying the same variant can have heterogeneous clinical presentations; to: - Missense and PTC variants have been identified in > 3 unrelated women diagnosed with POI from different studies - The vast majority of variants are heterozygous, with limited reports of homozygous variants (PMID: 27836978; 29067606) - Loss of Function has been clearly demonstrated, while dominant negative effect has also been suggested although there is currently limited evidence (PMID: 17701902) - Individuals carrying the same variant can have heterogeneous clinical presentations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2979 | HECW2 | Zornitza Stark Marked gene: HECW2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2979 | HECW2 | Zornitza Stark Gene: hecw2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2979 | HECW2 | Zornitza Stark Phenotypes for gene: HECW2 were changed from to Neurodevelopmental disorder with hypotonia, seizures, and absent language (MIM#617268) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2978 | HECW2 | Zornitza Stark Publications for gene: HECW2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2977 | HECW2 | Zornitza Stark Mode of inheritance for gene: HECW2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | NOBOX | Ee Ming Wong reviewed gene: NOBOX: Rating: GREEN; Mode of pathogenicity: None; Publications: PMIDs: 27836978, 21837770, 25514101, 17701902, 27798098; Phenotypes: Premature ovarian failure 5, 611548, AD (more commonly referred to as Premature ovarian insufficiency (POI) in the literature); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.54 | NEK1 | Bryony Thompson Marked gene: NEK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.54 | NEK1 | Bryony Thompson Gene: nek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.54 | NEK1 | Bryony Thompson Classified gene: NEK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.54 | NEK1 | Bryony Thompson Gene: nek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.53 | NEK1 |
Bryony Thompson gene: NEK1 was added gene: NEK1 was added to Motor Neuron Disease. Sources: Literature Mode of inheritance for gene: NEK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: NEK1 were set to 31768050; 26945885; 27455347; 29929116 Phenotypes for gene: NEK1 were set to Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 Review for gene: NEK1 was set to GREEN Added comment: Exome-wide significant burden of heterozygous loss-of-function identified in ALS case-control studies that is replicated in both familial and simplex cohorts. Segregation of a PTV reported in 2 affected first-degree relatives in a single family. A loss-of-function mutation induces DNA damage accumulation in ALS patient-derived motoneurons. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2976 | HECW2 | Teresa Zhao reviewed gene: HECW2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27389779; Phenotypes: Neurodevelopmental disorder with hypotonia, seizures, and absent language (MIM#617268); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4281 | TLR7 | Zornitza Stark Marked gene: TLR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4281 | TLR7 | Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4281 | TLR7 | Zornitza Stark Phenotypes for gene: TLR7 were changed from to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4280 | TLR7 | Zornitza Stark Publications for gene: TLR7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4279 | TLR7 | Zornitza Stark Mode of inheritance for gene: TLR7 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.68 | TLR7 | Zornitza Stark Mode of inheritance for gene: TLR7 was changed from BIALLELIC, autosomal or pseudoautosomal to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.67 | TLR7 | Zornitza Stark edited their review of gene: TLR7: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.215 | NR2F1 | Zornitza Stark Marked gene: NR2F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.215 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.215 | NR2F1 | Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.214 | NR2F1 | Zornitza Stark Publications for gene: NR2F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.213 | NR2F1 | Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.212 | NR2F1 | Zornitza Stark Classified gene: NR2F1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.212 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.211 | NR2F1 | Zornitza Stark reviewed gene: NR2F1: Rating: RED; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.211 | EXOSC5 | Zornitza Stark Marked gene: EXOSC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.211 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.211 | EXOSC5 | Zornitza Stark Phenotypes for gene: EXOSC5 were changed from to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.210 | EXOSC5 | Zornitza Stark Publications for gene: EXOSC5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.209 | EXOSC5 | Zornitza Stark Classified gene: EXOSC5 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.209 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.208 | EXOSC5 | Zornitza Stark reviewed gene: EXOSC5: Rating: RED; Mode of pathogenicity: None; Publications: 32504085, 29302074; Phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.225 | EXOSC5 | Zornitza Stark Marked gene: EXOSC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.225 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.225 | EXOSC5 | Zornitza Stark Classified gene: EXOSC5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.225 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.224 | EXOSC5 |
Zornitza Stark gene: EXOSC5 was added gene: EXOSC5 was added to Ataxia - paediatric. Sources: Literature Mode of inheritance for gene: EXOSC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EXOSC5 were set to 32504085; 29302074 Phenotypes for gene: EXOSC5 were set to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia Review for gene: EXOSC5 was set to GREEN Added comment: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient. Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively. A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5. - PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.150 | EXOSC5 | Zornitza Stark Phenotypes for gene: EXOSC5 were changed from Developmental delays, short stature, cerebellar hypoplasia and motor weakness to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.149 | EXOSC5 | Zornitza Stark Classified gene: EXOSC5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.149 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.148 | EXOSC5 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.148 | EXOSC5 |
Zornitza Stark edited their review of gene: EXOSC5: Added comment: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient. Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively. A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5. - PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.; Changed rating: GREEN; Changed publications: 32504085, 29302074; Changed phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4278 | EXOSC5 | Zornitza Stark Marked gene: EXOSC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4278 | EXOSC5 | Zornitza Stark Gene: exosc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4278 | EXOSC5 | Zornitza Stark Phenotypes for gene: EXOSC5 were changed from to Short stature; Motor developmental delays; Cerebellar hypoplasia; Ataxia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4277 | EXOSC5 | Zornitza Stark Publications for gene: EXOSC5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4276 | EXOSC5 | Zornitza Stark Mode of inheritance for gene: EXOSC5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4275 | EXOSC5 |
Arina Puzriakova changed review comment from: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXCOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient. Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively. A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5. - PMID: 29302074 (2019) - Three sibs with a homozygous EXCOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken.; to: - PMID: 32504085 (2020) - Five patients from four families with biallelic variants in EXOSC5. Clinical features included short stature (3/5), developmental delays that affect motor skills (3/5), hypotonia (4/5), ataxia (3/4), cerebellar hypoplasia/atrophy (4/5). Cognitive function was generally preserved, but included mild speech delays in one patient. Cerebellar ataxia was described in two sibs and one singleton - all of whom were compound heterozygous for the p.Thr114Ile variant, inherited in trans with a frameshift variant (p.His30Thrfs*35) or deletion involving exons 5–6 of EXOSC5, respectively. A LoF zebrafish model resulted in a variety of morphological defects including shortened and curved tails/bodies, reduced eye/head size and oedema. Functional studies of the variants in budding yeast and cultured cells showed some defects in RNA exosome function and interactions, that could not be explained by decrease in the steady-state level of EXOSC5. - PMID: 29302074 (2019) - Three sibs with a homozygous EXOSC5 variant (p.Thr114Ile), associated with mild motor delays, cerebellar ataxia, nystagmus, dysarthria, and moderate ID. The family is also described in PMID: 30950035. No functional studies of the variant were undertaken. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4275 | EXOSC5 | Arina Puzriakova reviewed gene: EXOSC5: Rating: ; Mode of pathogenicity: None; Publications: 32504085, 29302074; Phenotypes: Short stature, Motor developmental delays, Cerebellar hypoplasia, Ataxia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.11 | TMEM173 | Zornitza Stark Marked gene: TMEM173 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.11 | TMEM173 | Zornitza Stark Gene: tmem173 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.11 | TMEM173 | Zornitza Stark Classified gene: TMEM173 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.11 | TMEM173 | Zornitza Stark Gene: tmem173 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.10 | TMEM173 |
Zornitza Stark gene: TMEM173 was added gene: TMEM173 was added to Pulmonary Fibrosis_Interstitial Lung Disease. Sources: Expert Review Mode of inheritance for gene: TMEM173 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM173 were set to 27613991; 32398023 Phenotypes for gene: TMEM173 were set to STING-associated vasculopathy, infantile-onset, MIM# 615934 Review for gene: TMEM173 was set to GREEN Added comment: Four individuals reported with severe interstitial lung disease in the setting of STING-associated vasculopathy. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4275 | SLC20A1 | Zornitza Stark Marked gene: SLC20A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4275 | SLC20A1 | Zornitza Stark Gene: slc20a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4275 | SLC20A1 | Zornitza Stark Phenotypes for gene: SLC20A1 were changed from to Bladder-Exstrophy-Epispadias Complex (BEEC) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4274 | SLC20A1 | Zornitza Stark Publications for gene: SLC20A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4273 | SLC20A1 | Zornitza Stark Mode of inheritance for gene: SLC20A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4272 | SLC20A1 | Zornitza Stark reviewed gene: SLC20A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32850778, 27013921; Phenotypes: Bladder-Exstrophy-Epispadias Complex (BEEC); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.484 | PNPLA8 | Zornitza Stark Marked gene: PNPLA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.484 | PNPLA8 | Zornitza Stark Gene: pnpla8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.484 | PNPLA8 | Zornitza Stark Phenotypes for gene: PNPLA8 were changed from to Mitochondrial myopathy with lactic acidosis (MIM#251950), AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.483 | PNPLA8 | Zornitza Stark Publications for gene: PNPLA8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.482 | PNPLA8 | Zornitza Stark Mode of inheritance for gene: PNPLA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.481 | PNPLA8 | Zornitza Stark reviewed gene: PNPLA8: Rating: GREEN; Mode of pathogenicity: None; Publications: 29681094, 25512002; Phenotypes: Mitochondrial myopathy with lactic acidosis (MIM#251950), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4272 | PNPLA8 | Zornitza Stark Marked gene: PNPLA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4272 | PNPLA8 | Zornitza Stark Gene: pnpla8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4272 | PNPLA8 | Zornitza Stark Phenotypes for gene: PNPLA8 were changed from to Mitochondrial myopathy with lactic acidosis (MIM#251950), AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4271 | PNPLA8 | Zornitza Stark Publications for gene: PNPLA8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4270 | PNPLA8 | Zornitza Stark Mode of inheritance for gene: PNPLA8 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4269 | NR2F1 | Zornitza Stark Marked gene: NR2F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4269 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4269 | NR2F1 | Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4268 | NR2F1 | Zornitza Stark Publications for gene: NR2F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4267 | NR2F1 | Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.117 | NR2F1 | Zornitza Stark Marked gene: NR2F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.117 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.117 | NR2F1 | Zornitza Stark Publications for gene: NR2F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.116 | NR2F1 | Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.115 | NR2F1 | Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.114 | NR2F1 | Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.114 | NR2F1 | Zornitza Stark Marked gene: NR2F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.114 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.114 | NR2F1 | Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4266 | NR2F1 | Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2976 | NR2F1 | Zornitza Stark Marked gene: NR2F1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2976 | NR2F1 | Zornitza Stark Gene: nr2f1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.113 | NR2F1 | Zornitza Stark Publications for gene: NR2F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.112 | NR2F1 | Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.111 | NR2F1 | Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2976 | NR2F1 | Zornitza Stark Phenotypes for gene: NR2F1 were changed from to Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2975 | NR2F1 | Zornitza Stark Publications for gene: NR2F1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2974 | NR2F1 | Zornitza Stark Mode of inheritance for gene: NR2F1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2973 | NR2F1 | Zornitza Stark reviewed gene: NR2F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32275123; Phenotypes: Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.23 | RAD50 | Zornitza Stark Marked gene: RAD50 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.23 | RAD50 | Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4266 | RAD50 | Zornitza Stark Marked gene: RAD50 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4266 | RAD50 | Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.23 | RAD50 | Zornitza Stark Phenotypes for gene: RAD50 were changed from to Nijmegen breakage syndrome-like disorder, MIM# 613078 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4266 | RAD50 | Zornitza Stark Phenotypes for gene: RAD50 were changed from to Nijmegen breakage syndrome-like disorder, MIM# 613078 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4265 | RAD50 | Zornitza Stark Publications for gene: RAD50 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4264 | RAD50 | Zornitza Stark Mode of inheritance for gene: RAD50 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.22 | RAD50 | Zornitza Stark Publications for gene: RAD50 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4263 | RAD50 | Zornitza Stark reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.21 | RAD50 | Zornitza Stark Mode of inheritance for gene: RAD50 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome Breakage Disorders v0.20 | RAD50 | Zornitza Stark reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4263 | KMT2D | Zornitza Stark Publications for gene: KMT2D were set to 31949313 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4262 | KMT2D | Zornitza Stark edited their review of gene: KMT2D: Added comment: Four further individuals with KMT2D-associated neurodevelopmental syndrome reported. Features include: athelia (absent nipples), choanal atresia, hypoparathyroidism, delayed or absent pubertal development, and extreme short stature. Two of the four individuals had severe interstitial lung disease.; Changed publications: 31949313, 32083401 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2973 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2973 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2973 | HSPA9 | Zornitza Stark Phenotypes for gene: HSPA9 were changed from OMIM 616854; skeletal anomalies; congenital cardiac and renal anom to Even-plus syndrome, OMIM 616854; skeletal anomalies; congenital cardiac and renal anom | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2972 | HSPA9 | Sue White Classified gene: HSPA9 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2972 | HSPA9 | Sue White Gene: hspa9 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2971 | HSPA9 | Sue White commented on gene: HSPA9: 2 patients with dev delay in 5 published patients with Even-plus syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2971 | HSPA9 |
Sue White gene: HSPA9 was added gene: HSPA9 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSPA9 were set to 32869452; 26598328 Phenotypes for gene: HSPA9 were set to OMIM 616854; skeletal anomalies; congenital cardiac and renal anom Penetrance for gene: HSPA9 were set to Complete Review for gene: HSPA9 was set to AMBER Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 | HSPA9 | Zornitza Stark Classified gene: HSPA9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.68 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital anomalies of the kidney and urinary tract (CAKUT) v0.67 | HSPA9 |
Zornitza Stark gene: HSPA9 was added gene: HSPA9 was added to Congenital anomalies of the kidney and urinary tract (CAKUT) Syndromic. Sources: Literature Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSPA9 were set to 26598328; 32869452 Phenotypes for gene: HSPA9 were set to Even-plus syndrome, MIM# 616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose Review for gene: HSPA9 was set to GREEN Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia. 2/5 with developmental delay and abnormalities of the corpus callosum 4/5 with congenital heart disease Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.66 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.66 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.66 | HSPA9 | Zornitza Stark Phenotypes for gene: HSPA9 were changed from https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose to Even-plus syndrome, MIM# 616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Achromatopsia v0.21 | Sue White removed gene:HSPA9 from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.65 | HSPA9 | Zornitza Stark Classified gene: HSPA9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.65 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4262 | CFAP58 | Zornitza Stark Phenotypes for gene: CFAP58 were changed from Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035) to Multiple morphological abnormalities of the sperm flagella (MMAF) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4261 | CFAP58 | Zornitza Stark Marked gene: CFAP58 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4261 | CFAP58 | Zornitza Stark Gene: cfap58 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4261 | CFAP58 | Zornitza Stark Classified gene: CFAP58 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4261 | CFAP58 | Zornitza Stark Gene: cfap58 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4260 | WASHC4 | Zornitza Stark Marked gene: WASHC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4260 | WASHC4 | Zornitza Stark Gene: washc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4260 | WASHC4 | Zornitza Stark Classified gene: WASHC4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4260 | WASHC4 | Zornitza Stark Gene: washc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4259 | WASHC4 |
Zornitza Stark gene: WASHC4 was added gene: WASHC4 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: WASHC4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WASHC4 were set to 31953988; 21498477 Phenotypes for gene: WASHC4 were set to Mental retardation, autosomal recessive 43, MIM #615817 Review for gene: WASHC4 was set to GREEN Added comment: Three unrelated families reported. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4258 | DNAJC7 | Seb Lunke Marked gene: DNAJC7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4258 | DNAJC7 | Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4258 | DNAJC7 | Seb Lunke Classified gene: DNAJC7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4258 | DNAJC7 | Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2970 | WASHC4 | Zornitza Stark reviewed gene: WASHC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4257 | DNAJC7 |
Seb Lunke gene: DNAJC7 was added gene: DNAJC7 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DNAJC7 were set to 31768050 Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis Review for gene: DNAJC7 was set to AMBER Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. However gene described as risk factor, unclear why. DOI: https://doi.org/10.1212/NXG.0000000000000503 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.52 | DNAJC7 | Seb Lunke Marked gene: DNAJC7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.52 | DNAJC7 | Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.52 | DNAJC7 | Seb Lunke Classified gene: DNAJC7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.52 | DNAJC7 | Seb Lunke Gene: dnajc7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2970 | WASHC4 | Alison Yeung Classified gene: WASHC4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2970 | WASHC4 | Alison Yeung Gene: washc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.51 | DNAJC7 |
Seb Lunke gene: DNAJC7 was added gene: DNAJC7 was added to Motor Neuron Disease. Sources: Literature Mode of inheritance for gene: DNAJC7 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DNAJC7 were set to 31768050 Phenotypes for gene: DNAJC7 were set to amyotrophic lateral sclerosis Review for gene: DNAJC7 was set to AMBER Added comment: Two cohort studies in ALS patients identified 11 and 1 patient, respectively, with variants in DNAJC7. Seven of these are putative PTVs. However gene described as risk factor, unclear why. DOI: https://doi.org/10.1212/NXG.0000000000000503 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.49 | MYT1L | Zornitza Stark Marked gene: MYT1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.49 | MYT1L | Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.49 | MYT1L | Zornitza Stark Phenotypes for gene: MYT1L were changed from intellectual disability; macrocephaly; epilepsy; autism to intellectual disability; macrocephaly; epilepsy; autism; Mental retardation, autosomal dominant 39, MIM# 616521 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | SVIL | Melanie Marty Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2969 | WASHC4 | Alison Yeung Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | SVIL | Melanie Marty edited their review of gene: SVIL: Added comment: Four patients from two unrelated consanguineous families with a childhood/adolescence onset of a myopathy associated with homozygous loss-of-function mutations in SVIL. Wide neck, anteverted shoulders and prominent trapezius muscles together with variable contractures were characteristic features. Functional studies on muscle biopsies showed complete loss protein in muscle fibres by western blot.; Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | CFAP58 | Crystle Lee edited their review of gene: CFAP58: Added comment: Biallelic variants reported in 5 unrelated males with nultiple morphological abnormalities of the sperm flagella (MMAF). Knockout mice were infertile.; Changed rating: GREEN; Changed publications: 32791035; Changed phenotypes: Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035); Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.48 | MYT1L | Natasha Brown Classified gene: MYT1L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.48 | MYT1L | Natasha Brown Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.62 | HSPA9 |
Sue White gene: HSPA9 was added gene: HSPA9 was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSPA9 were set to 26598328; 32869452 Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose Review for gene: HSPA9 was set to GREEN Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia. 2/5 with developmental delay and abnormalities of the corpus callosum 4/5 with congenital heart disease Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.62 | HSPA9 |
Sue White gene: HSPA9 was added gene: HSPA9 was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSPA9 were set to 26598328; 32869452 Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose Review for gene: HSPA9 was set to GREEN Added comment: Biallelic variants in 4 individuals from 5 families. Significant skeletal features and marked nasal hypoplasia with mid-face hypoplasia. 2/5 with developmental delay and abnormalities of the corpus callosum 4/5 with congenital heart disease Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.47 | MYT1L |
Natasha Brown gene: MYT1L was added gene: MYT1L was added to Macrocephaly_Megalencephaly. Sources: Literature Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYT1L were set to (PMID: 32065501) Phenotypes for gene: MYT1L were set to intellectual disability; macrocephaly; epilepsy; autism Review for gene: MYT1L was set to GREEN Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems. 66% in a recent cohort had seizures. 13% had macrocephaly Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.111 | MYT1L | Zornitza Stark Marked gene: MYT1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.111 | MYT1L | Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.111 | MYT1L | Zornitza Stark Phenotypes for gene: MYT1L were changed from to Mental retardation, autosomal dominant 39, MIM# 616521 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | CFAP58 | Crystle Lee commented on gene: CFAP58 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | CFAP58 | Crystle Lee Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.110 | MYT1L | Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2969 | WASHC4 | Alison Yeung reviewed gene: WASHC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 31953988; Phenotypes: Intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | HSPA9 | Zornitza Stark Marked gene: HSPA9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | HSPA9 | Zornitza Stark Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4256 | HSPA9 | Zornitza Stark Phenotypes for gene: HSPA9 were changed from to Anemia, sideroblastic, 4, MIM# 182170; Even-plus syndrome, MIM#616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.110 | MYT1L | Natasha Brown Classified gene: MYT1L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.110 | MYT1L | Natasha Brown Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4255 | HSPA9 | Zornitza Stark Publications for gene: HSPA9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.109 | MYT1L | Natasha Brown Classified gene: MYT1L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.109 | MYT1L | Natasha Brown Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4254 | HSPA9 | Zornitza Stark Mode of inheritance for gene: HSPA9 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4253 | HSPA9 | Seb Lunke Mode of inheritance for gene: HSPA9 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.109 | MYT1L | Natasha Brown Classified gene: MYT1L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.109 | MYT1L | Natasha Brown Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4252 | SVIL | Zornitza Stark Marked gene: SVIL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4252 | SVIL | Zornitza Stark Added comment: Comment when marking as ready: Two unrelated families only. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4252 | SVIL | Zornitza Stark Gene: svil has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Achromatopsia v0.20 | HSPA9 | Sue White Classified gene: HSPA9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Achromatopsia v0.20 | HSPA9 | Sue White Gene: hspa9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Achromatopsia v0.19 | HSPA9 |
Sue White gene: HSPA9 was added gene: HSPA9 was added to Achromatopsia. Sources: Literature Mode of inheritance for gene: HSPA9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HSPA9 were set to 32869452; 26598328 Phenotypes for gene: HSPA9 were set to https://www.omim.org/entry/616854; skeletal anomalies; congenital cardiac and renal anomalies: marked small nose Penetrance for gene: HSPA9 were set to Complete Review for gene: HSPA9 was set to GREEN Added comment: Biallelic variants cause a syndromic skeletal dysplasia with small nose, microtia and cardiac and renal malformations. 2/5 have developmental delay and corpus callosum anomalies Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.108 | MYT1L |
Natasha Brown gene: MYT1L was added gene: MYT1L was added to Autism. Sources: Literature Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYT1L were set to PMID: 32065501 Review for gene: MYT1L was set to GREEN Added comment: 9 new cases reported bringing total to 51, some of which are larger CNVs including additional genes (2p25.3 deletion syndrome). Of those with microdeletion or SNV of MYT1L only, 66.7% (12/18) had autism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4252 | SVIL | Zornitza Stark Classified gene: SVIL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4252 | SVIL | Zornitza Stark Gene: svil has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4251 | CFAP57 | Zornitza Stark Mode of inheritance for gene: CFAP57 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | CFAP57 | Zornitza Stark reviewed gene: CFAP57: Rating: AMBER; Mode of pathogenicity: None; Publications: 21574244, 32764743; Phenotypes: Van der Woude Syndrome, Primary ciliary dyskinesia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | HSPA9 | Sue White reviewed gene: HSPA9: Rating: GREEN; Mode of pathogenicity: None; Publications: 26598328, 32869452; Phenotypes: https://www.omim.org/entry/616854, skeletal anomalies, congenital cardiac and renal anomalies: marked small nose; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliary Dyskinesia v0.125 | CFAP57 | Zornitza Stark Phenotypes for gene: CFAP57 were changed from to Van der Woude Syndrome; Primary ciliary dyskinesia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliary Dyskinesia v0.124 | CFAP57 | Zornitza Stark Publications for gene: CFAP57 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | MYT1L | Zornitza Stark Marked gene: MYT1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | MYT1L | Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | MYT1L | Zornitza Stark Classified gene: MYT1L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.848 | MYT1L | Zornitza Stark Gene: myt1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.847 | MYT1L |
Zornitza Stark gene: MYT1L was added gene: MYT1L was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: MYT1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYT1L were set to 32065501 Phenotypes for gene: MYT1L were set to Mental retardation, autosomal dominant 39, MIM# 616521 Review for gene: MYT1L was set to GREEN Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems. 66% in a recent cohort had seizures. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | SVIL |
Melanie Marty gene: SVIL was added gene: SVIL was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SVIL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SVIL were set to 32779703 Phenotypes for gene: SVIL were set to myopathy Penetrance for gene: SVIL were set to unknown Review for gene: SVIL was set to GREEN Added comment: Four patients from two unrelated consanguineous families with a childhood/adolescence onset of a myopathy associated with homozygous loss-of-function mutations in SVIL. Wide neck, anteverted shoulders and prominent trapezius muscles together with variable contractures were characteristic features. Functional studies on muscle biopsies showed complete loss protein in muscle fibres by western blot. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2969 | ATP1A3 | Seb Lunke Classified gene: ATP1A3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2969 | ATP1A3 | Seb Lunke Gene: atp1a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2968 | ATP1A3 | Seb Lunke reviewed gene: ATP1A3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | HSPA9 | Zornitza Stark edited their review of gene: HSPA9: Changed publications: 26491070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | HSPA9 | Zornitza Stark reviewed gene: HSPA9: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Anemia, sideroblastic, 4, MIM# 182170; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.44 | COL27A1 | Alison Yeung Classified gene: COL27A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.44 | COL27A1 | Alison Yeung Gene: col27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.43 | COL27A1 | Alison Yeung Classified gene: COL27A1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.43 | COL27A1 | Alison Yeung Gene: col27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.42 | COL27A1 | Alison Yeung Marked gene: COL27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.42 | COL27A1 | Alison Yeung Gene: col27a1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.42 | COL27A1 |
Alison Yeung gene: COL27A1 was added gene: COL27A1 was added to Skeletal dysplasia. Sources: Literature Mode of inheritance for gene: COL27A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COL27A1 were set to 24986830; 28276056; 28322503 Phenotypes for gene: COL27A1 were set to OMIM #615155 Steel Syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | CFAP58 |
Crystle Lee gene: CFAP58 was added gene: CFAP58 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: CFAP58 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CFAP58 were set to 32791035 Phenotypes for gene: CFAP58 were set to Multiple morphological abnormalities of the sperm flagella (MMAF) (PMID: 32791035) Review for gene: CFAP58 was set to AMBER Added comment: 5 unrelated males reported with biallelic loss of function variants. Knockout mice were infertile (Abstract only) Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliary Dyskinesia v0.123 | CFAP57 |
Elena Savva edited their review of gene: CFAP57: Added comment: Gene not in PubMed but recently published in bioRxiv in single patient with hom nonsense variants and Primary ciliary dyskinesia. Some functional data provided. PMID: 21574244 - patient with a heterozygous missense and Van der Woude Syndrome. Classed in OMIM as a VUS. PMID: 32764743 - one homozygous patient p.(Arg588*) w/ PCD - variant results in the skipping of exon 11 (58 amino acids), which may be due to disruption of an exonic splicing enhancer. Functional studies on Chlamydomonas animal model is defective. Potentially the same patient as bioRxiv; Changed publications: PMID: 21574244, 32764743 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2968 | MYT1L | Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | MYT1L | Zornitza Stark Tag SV/CNV tag was added to gene: MYT1L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4250 | MYT1L | Zornitza Stark Publications for gene: MYT1L were set to 28859103 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4249 | MYT1L | Zornitza Stark edited their review of gene: MYT1L: Added comment: Over 50 individuals reported with deletions and SNVs affecting MYT1L, and variable phenotype comprising intellectual disability, obesity, and behavioral problems.; Changed publications: 28859103, 32065501 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2968 | MYT1L | Zornitza Stark Publications for gene: MYT1L were set to 28859103 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2967 | MYT1L | Zornitza Stark reviewed gene: MYT1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 32065501; Phenotypes: Mental retardation, autosomal dominant 39, MIM# 616521; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4249 | ARID1A | Zornitza Stark Marked gene: ARID1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4249 | ARID1A | Zornitza Stark Gene: arid1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4249 | ARID1A | Zornitza Stark Phenotypes for gene: ARID1A were changed from to Coffin-Siris syndrome 2 (MIM#614607) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4248 | ARID1A | Zornitza Stark Publications for gene: ARID1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4247 | ARID1A | Zornitza Stark Mode of inheritance for gene: ARID1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4246 | PDE10A | Zornitza Stark Marked gene: PDE10A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4246 | PDE10A | Zornitza Stark Gene: pde10a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4246 | PDE10A | Zornitza Stark Phenotypes for gene: PDE10A were changed from to Dyskinesia, limb and orofacial, infantile-onset, MIM#616921; Striatal degeneration, autosomal dominant, MIM# 616922 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4245 | PDE10A | Zornitza Stark Publications for gene: PDE10A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4244 | PDE10A | Zornitza Stark Mode of inheritance for gene: PDE10A was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4243 | PDE10A | Zornitza Stark reviewed gene: PDE10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 27058446, 27058447; Phenotypes: Dyskinesia, limb and orofacial, infantile-onset, MIM#616921, Striatal degeneration, autosomal dominant, MIM# 616922; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.163 | MYSM1 | Zornitza Stark Publications for gene: MYSM1 were set to 24288411; 28115216; 26220525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.162 | MYSM1 |
Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Combined Immunodeficiency v0.162 | MYSM1 | Zornitza Stark edited their review of gene: MYSM1: Changed publications: 24288411, 28115216, 26220525, 32640305 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bone Marrow Failure v0.82 | MYSM1 | Zornitza Stark Publications for gene: MYSM1 were set to 24288411; 28115216; 26220525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4243 | MYSM1 | Zornitza Stark Publications for gene: MYSM1 were set to 4288411; 28115216; 26220525 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4242 | MYSM1 |
Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bone Marrow Failure v0.81 | MYSM1 |
Zornitza Stark changed review comment from: Aarly-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list; to: Early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4242 | MYSM1 | Zornitza Stark edited their review of gene: MYSM1: Changed publications: 4288411, 28115216, 26220525, 32640305 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bone Marrow Failure v0.81 | MYSM1 |
Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list; to: Aarly-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4242 | PNPLA8 | Kristin Rigbye reviewed gene: PNPLA8: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29681094, 25512002; Phenotypes: Mitochondrial myopathy with lactic acidosis (MIM#251950), AR; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2967 | ARID1A | Crystle Lee reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23929686, 22426308, 25168959; Phenotypes: Coffin-Siris syndrome 2 (MIM#614607); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4242 | ARID1A | Crystle Lee reviewed gene: ARID1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23929686, 22426308, 25168959; Phenotypes: Coffin-Siris syndrome 2 (MIM#614607); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bone Marrow Failure v0.81 | MYSM1 |
Zornitza Stark changed review comment from: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay Sources: Expert list; to: early-onset anaemia, leukopaenia, and decreased B cells, may have thrombocytopaenia or variable additional non-haematologic features, such as facial dysmorphism, skeletal anomalies, and mild developmental delay. At least 4 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bone Marrow Failure v0.81 | MYSM1 | Zornitza Stark edited their review of gene: MYSM1: Changed publications: 24288411, 28115216, 26220525, 32640305 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4242 | BTG4 | Zornitza Stark Phenotypes for gene: BTG4 were changed from Zygotic cleavage failure (ZCF) to Zygotic cleavage failure (ZCF); Oocyte maturation defect, MIM#619009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4241 | BTG4 | Zornitza Stark reviewed gene: BTG4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte maturation defect, MIM#619009; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.111 | PCCB | Zornitza Stark Marked gene: PCCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.111 | PCCB | Zornitza Stark Gene: pccb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.111 | PCCB | Zornitza Stark Classified gene: PCCB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.111 | PCCB | Zornitza Stark Gene: pccb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.110 | PCCB |
Zornitza Stark gene: PCCB was added gene: PCCB was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: PCCB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCCB were set to 30879957 Phenotypes for gene: PCCB were set to Propionicacidemia, MIM# 606054 Review for gene: PCCB was set to GREEN Added comment: The neonatal form is frequently accompanied by metabolic acidosis with anion gap, ketonuria, hypoglycemia, hyperammonemia, and cytopenia. A late-onset form in older children and adults is pertinent to this panel as it has a milder phenotype. It is less common, and may present with developmental regression, chronic vomiting, protein intolerance, failure to thrive, hypotonia, and occasionally basal ganglia infarction, which may result in dystonia and choreoathetosis, and cardiomyopathy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.109 | PCCA | Zornitza Stark Marked gene: PCCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.109 | PCCA | Zornitza Stark Gene: pcca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.109 | PCCA | Zornitza Stark Classified gene: PCCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.109 | PCCA | Zornitza Stark Gene: pcca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.108 | PCCA |
Zornitza Stark gene: PCCA was added gene: PCCA was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: PCCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCCA were set to 30879957 Phenotypes for gene: PCCA were set to Propionicacidemia, MIM# 606054 Review for gene: PCCA was set to GREEN Added comment: The neonatal form is frequently accompanied by metabolic acidosis with anion gap, ketonuria, hypoglycemia, hyperammonemia, and cytopenia. A late-onset form in older children and adults is pertinent to this panel as it has a milder phenotype. It is less common, and may present with developmental regression, chronic vomiting, protein intolerance, failure to thrive, hypotonia, and occasionally basal ganglia infarction, which may result in dystonia and choreoathetosis, and cardiomyopathy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.115 | KIF1C | Zornitza Stark Marked gene: KIF1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.115 | KIF1C | Zornitza Stark Gene: kif1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.115 | KIF1C | Zornitza Stark Publications for gene: KIF1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v0.114 | KIF1C | Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.223 | KIF1C | Zornitza Stark Publications for gene: KIF1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v0.222 | KIF1C | Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4241 | KIF1C | Zornitza Stark Marked gene: KIF1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4241 | KIF1C | Zornitza Stark Gene: kif1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4241 | KIF1C | Zornitza Stark Phenotypes for gene: KIF1C were changed from to Spastic ataxia 2, autosomal recessive, MIM# 611302 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4240 | KIF1C | Zornitza Stark Publications for gene: KIF1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4239 | KIF1C | Zornitza Stark Mode of inheritance for gene: KIF1C was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4238 | KIF1C | Zornitza Stark reviewed gene: KIF1C: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24319291, 31413903, 29544888; Phenotypes: Spastic ataxia 2, autosomal recessive, MIM# 611302; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.107 | KIF1C | Zornitza Stark Marked gene: KIF1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.107 | KIF1C | Zornitza Stark Gene: kif1c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.107 | KIF1C | Zornitza Stark Classified gene: KIF1C as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.107 | KIF1C | Zornitza Stark Gene: kif1c has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.106 | KIF1C |
Zornitza Stark gene: KIF1C was added gene: KIF1C was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: KIF1C was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF1C were set to 31413903 Phenotypes for gene: KIF1C were set to Spastic ataxia 2, autosomal recessive, MIM# 611302 Review for gene: KIF1C was set to AMBER Added comment: Neurologic disorder characterized by onset in the first 2 decades of cerebellar ataxia, dysarthria, and variable spasticity of the lower limbs. At least one report of a more complex movement disorder including dystonia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | KCNA2 | Zornitza Stark Marked gene: KCNA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | KCNA2 | Zornitza Stark Gene: kcna2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.42 | KCNA2 | Zornitza Stark Phenotypes for gene: KCNA2 were changed from to Episodic ataxia; Epileptic encephalopathy, early infantile, 32, MIM# 616366 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.41 | KCNA2 | Zornitza Stark Publications for gene: KCNA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.40 | KCNA2 | Zornitza Stark Mode of inheritance for gene: KCNA2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | KCNA2 | Zornitza Stark edited their review of gene: KCNA2: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | KCNA2 | Zornitza Stark reviewed gene: KCNA2: Rating: ; Mode of pathogenicity: None; Publications: 27733563, 27543892, 25477152; Phenotypes: Episodic ataxia, Epileptic encephalopathy, early infantile, 32 616366; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.846 | IRF2BPL | Zornitza Stark Marked gene: IRF2BPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.846 | IRF2BPL | Zornitza Stark Gene: irf2bpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.846 | IRF2BPL | Zornitza Stark Phenotypes for gene: IRF2BPL were changed from to Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.845 | IRF2BPL | Zornitza Stark Publications for gene: IRF2BPL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.844 | IRF2BPL | Zornitza Stark Mode of inheritance for gene: IRF2BPL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.843 | IRF2BPL | Zornitza Stark reviewed gene: IRF2BPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 30057031, 30166628; Phenotypes: Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.105 | ACTB | Zornitza Stark Marked gene: ACTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.105 | ACTB | Zornitza Stark Gene: actb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.105 | ACTB | Zornitza Stark Mode of pathogenicity for gene: ACTB was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.104 | DNAJC12 | Zornitza Stark Marked gene: DNAJC12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.104 | DNAJC12 | Zornitza Stark Gene: dnajc12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.104 | GNAO1 | Zornitza Stark Marked gene: GNAO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.104 | GNAO1 | Zornitza Stark Gene: gnao1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.104 | GNAO1 | Zornitza Stark Publications for gene: GNAO1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.103 | GNAO1 | Zornitza Stark Mode of pathogenicity for gene: GNAO1 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | CACNA1A | Zornitza Stark Marked gene: CACNA1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | CACNA1A | Zornitza Stark Gene: cacna1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | PDHX | Zornitza Stark Marked gene: PDHX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | PDHX | Zornitza Stark Gene: pdhx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | RNASEH2B | Zornitza Stark Marked gene: RNASEH2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | RNASEH2B | Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | RNASEH2C | Zornitza Stark Marked gene: RNASEH2C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | RNASEH2C | Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SNORD118 | Zornitza Stark Marked gene: SNORD118 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SNORD118 | Zornitza Stark Gene: snord118 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SUOX | Zornitza Stark Marked gene: SUOX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SUOX | Zornitza Stark Gene: suox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SYT1 | Zornitza Stark Marked gene: SYT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SYT1 | Zornitza Stark Gene: syt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SAMHD1 | Zornitza Stark Marked gene: SAMHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | SAMHD1 | Zornitza Stark Gene: samhd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | AFG3L2 | Zornitza Stark Marked gene: AFG3L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | AFG3L2 | Zornitza Stark Gene: afg3l2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | CHMP2B | Zornitza Stark Marked gene: CHMP2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | CHMP2B | Zornitza Stark Gene: chmp2b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | EARS2 | Zornitza Stark Marked gene: EARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | EARS2 | Zornitza Stark Gene: ears2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | GAMT | Zornitza Stark Marked gene: GAMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | GAMT | Zornitza Stark Gene: gamt has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | KCNQ2 | Zornitza Stark Marked gene: KCNQ2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | KCNQ2 | Zornitza Stark Gene: kcnq2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | MAPT | Zornitza Stark Marked gene: MAPT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | MAPT | Zornitza Stark Gene: mapt has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | MAPT | Zornitza Stark Classified gene: MAPT as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.102 | MAPT | Zornitza Stark Gene: mapt has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MAT1A | Zornitza Stark Marked gene: MAT1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MAT1A | Zornitza Stark Gene: mat1a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MMADHC | Zornitza Stark Marked gene: MMADHC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MMADHC | Zornitza Stark Gene: mmadhc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MPV17 | Zornitza Stark Marked gene: MPV17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | MPV17 | Zornitza Stark Gene: mpv17 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | PLP1 | Zornitza Stark Marked gene: PLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | PLP1 | Zornitza Stark Gene: plp1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | RNASEH2A | Zornitza Stark Marked gene: RNASEH2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | RNASEH2A | Zornitza Stark Gene: rnaseh2a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | VPS37A | Zornitza Stark Marked gene: VPS37A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | VPS37A | Zornitza Stark Gene: vps37a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | TOR1AIP1 | Zornitza Stark Marked gene: TOR1AIP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | TOR1AIP1 | Zornitza Stark Gene: tor1aip1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | UNC80 | Zornitza Stark Marked gene: UNC80 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | UNC80 | Zornitza Stark Gene: unc80 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | HPRT1 | Zornitza Stark Marked gene: HPRT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | HPRT1 | Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.101 | HPRT1 | Zornitza Stark Publications for gene: HPRT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.100 | HPRT1 | Zornitza Stark reviewed gene: HPRT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301328; Phenotypes: Lesch-Nyhan syndrome, MIM# 300322; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.100 | HIBCH | Zornitza Stark Marked gene: HIBCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.100 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.100 | HIBCH | Zornitza Stark Classified gene: HIBCH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.100 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.99 | HIBCH |
Zornitza Stark gene: HIBCH was added gene: HIBCH was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HIBCH were set to 26026795; 25251209; 24299452; 32677093 Phenotypes for gene: HIBCH were set to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620 Review for gene: HIBCH was set to GREEN Added comment: Autosomal recessive inborn error of metabolism characterized by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Dystonia is a feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.150 | HIBCH | Zornitza Stark Marked gene: HIBCH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.150 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.150 | HIBCH | Zornitza Stark Classified gene: HIBCH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.150 | HIBCH | Zornitza Stark Gene: hibch has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.149 | HIBCH |
Zornitza Stark gene: HIBCH was added gene: HIBCH was added to Regression. Sources: Expert list Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: HIBCH were set to 26026795; 25251209; 24299452; 32677093 Phenotypes for gene: HIBCH were set to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620 Review for gene: HIBCH was set to GREEN Added comment: Autosomal recessive inborn error of metabolism characterized by severely delayed psychomotor development, neurodegeneration, increased lactic acid, and brain lesions in the basal ganglia. Multiple unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.98 | ECHS1 | Zornitza Stark Marked gene: ECHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.98 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.98 | ECHS1 | Zornitza Stark Classified gene: ECHS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.98 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.97 | ECHS1 |
Zornitza Stark gene: ECHS1 was added gene: ECHS1 was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for gene: ECHS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ECHS1 were set to 32677093; 32858208 Phenotypes for gene: ECHS1 were set to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277 Review for gene: ECHS1 was set to GREEN Added comment: Paroxysmal and non-paroxysmal dystonia described as a manifestation of this metabolic disorder. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.21 | GTPBP2 |
Zornitza Stark gene: GTPBP2 was added gene: GTPBP2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272 Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988 Review for gene: GTPBP2 was set to GREEN Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.481 | GTPBP2 | Zornitza Stark Marked gene: GTPBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.481 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.481 | GTPBP2 | Zornitza Stark Classified gene: GTPBP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.481 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.96 | GTPBP2 | Zornitza Stark Marked gene: GTPBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.96 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.96 | GTPBP2 | Zornitza Stark Classified gene: GTPBP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.96 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.480 | GTPBP2 |
Zornitza Stark gene: GTPBP2 was added gene: GTPBP2 was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272 Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988 Review for gene: GTPBP2 was set to GREEN Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.95 | GTPBP2 |
Zornitza Stark gene: GTPBP2 was added gene: GTPBP2 was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for gene: GTPBP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GTPBP2 were set to 26675814; 29449720; 30790272 Phenotypes for gene: GTPBP2 were set to Jaberi-Elahi syndrome, MIM#617988 Review for gene: GTPBP2 was set to GREEN Added comment: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4238 | GTPBP2 | Zornitza Stark Marked gene: GTPBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4238 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4238 | GTPBP2 | Zornitza Stark Phenotypes for gene: GTPBP2 were changed from to Jaberi-Elahi syndrome, MIM#617988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4237 | GTPBP2 | Zornitza Stark Publications for gene: GTPBP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4236 | GTPBP2 | Zornitza Stark Mode of inheritance for gene: GTPBP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4235 | GTPBP2 | Zornitza Stark reviewed gene: GTPBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26675814, 29449720, 30790272; Phenotypes: Jaberi-Elahi syndrome, MIM#617988; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.843 | GTPBP2 |
Zornitza Stark changed review comment from: Six unrelated families with this neurodevelopmental syndrome, seizures are a feature. Sources: Expert list; to: Nine individuals from six unrelated families with bi-allelic variants in this gene causing a neuro-ectodermal syndrome. Key features include prenatal onset microcephaly, tone abnormalities, and movement disorders, epilepsy, dysmorphic features, retinal dysfunction, ectodermal dysplasia, and brain iron accumulation. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2967 | GTPBP2 | Zornitza Stark Marked gene: GTPBP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2967 | GTPBP2 | Zornitza Stark Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2967 | GTPBP2 | Zornitza Stark Phenotypes for gene: GTPBP2 were changed from to Jaberi-Elahi syndrome, MIM#617988 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2966 | GTPBP2 | Zornitza Stark Publications for gene: GTPBP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2965 | GTPBP2 | Zornitza Stark Mode of inheritance for gene: GTPBP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2964 | GTPBP2 | Zornitza Stark reviewed gene: GTPBP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26675814, 29449720, 30790272; Phenotypes: Jaberi-Elahi syndrome, MIM#617988; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.843 | GTPBP2 |
Zornitza Stark changed review comment from: Four unrelated families with this neurodevelopmental syndrome, seizures are a feature. Sources: Expert list; to: Six unrelated families with this neurodevelopmental syndrome, seizures are a feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.843 | GTPBP2 | Zornitza Stark edited their review of gene: GTPBP2: Changed publications: 26675814, 29449720, 30790272 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4235 | GNB1 | Zornitza Stark Marked gene: GNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4235 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2964 | GNB1 | Zornitza Stark Marked gene: GNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2964 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2964 | GNB1 | Zornitza Stark Phenotypes for gene: GNB1 were changed from to Mental retardation, autosomal dominant 42, MIM# 616973 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2963 | GNB1 | Zornitza Stark Publications for gene: GNB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4235 | GNB1 | Zornitza Stark Phenotypes for gene: GNB1 were changed from to Mental retardation, autosomal dominant 42, MIM# 616973 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4234 | GNB1 | Zornitza Stark Publications for gene: GNB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2962 | GNB1 | Zornitza Stark Mode of inheritance for gene: GNB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4233 | GNB1 | Zornitza Stark Mode of inheritance for gene: GNB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2961 | GNB1 | Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4232 | GNB1 | Zornitza Stark reviewed gene: GNB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.94 | GNB1 | Zornitza Stark Marked gene: GNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.94 | GNB1 | Zornitza Stark Gene: gnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.94 | GNB1 | Zornitza Stark Phenotypes for gene: GNB1 were changed from Mental retardation, autosomal dominant 42; Myoclonus dystonia to Mental retardation, autosomal dominant 42, MIM# 616973; Myoclonus dystonia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.93 | GNB1 | Zornitza Stark Publications for gene: GNB1 were set to 30194818 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GNB1 | Zornitza Stark edited their review of gene: GNB1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GNB1 | Zornitza Stark reviewed gene: GNB1: Rating: RED; Mode of pathogenicity: None; Publications: 27108799, 30194818, 27668284, 31034681; Phenotypes: Mental retardation, autosomal dominant 42, MIM# 616973; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GJC2 | Zornitza Stark Marked gene: GJC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GJC2 | Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GJC2 | Zornitza Stark Classified gene: GJC2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.92 | GJC2 | Zornitza Stark Gene: gjc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.91 | GJC2 |
Zornitza Stark gene: GJC2 was added gene: GJC2 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GJC2 were set to 15192806; 18094336 Phenotypes for gene: GJC2 were set to Leukodystrophy, hypomyelinating, 2, MIM# 608804 Review for gene: GJC2 was set to GREEN Added comment: Complex CNS involvement manifesting as nystagmus, impaired motor development, ataxia, choreoathetotic movements, dystonia, dysarthria, and progressive spasticity, in addition to intellectual disability. Multiple families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.90 | GBA | Zornitza Stark Marked gene: GBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.90 | GBA | Zornitza Stark Gene: gba has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.90 | GBA | Zornitza Stark Classified gene: GBA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.90 | GBA | Zornitza Stark Gene: gba has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.89 | GBA |
Zornitza Stark gene: GBA was added gene: GBA was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: GBA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GBA were set to 27789132 Phenotypes for gene: GBA were set to Gaucher disease, type III, MIM# 231000 Review for gene: GBA was set to GREEN Added comment: Dystonia-like hyperkinetic movement disorder reported in GD3. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.88 | FOXG1 | Zornitza Stark Marked gene: FOXG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.88 | FOXG1 | Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.88 | FOXG1 | Zornitza Stark Publications for gene: FOXG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.87 | FOXG1 | Zornitza Stark reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27029630; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2961 | FITM2 | Zornitza Stark Marked gene: FITM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2961 | FITM2 | Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2961 | FITM2 | Zornitza Stark Classified gene: FITM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2961 | FITM2 | Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2960 | FITM2 |
Zornitza Stark gene: FITM2 was added gene: FITM2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FITM2 were set to 28067622; 30214770; 30288795 Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635 Review for gene: FITM2 was set to GREEN Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from three unrelated families reported, supportive Drosophila model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.20 | FITM2 |
Zornitza Stark gene: FITM2 was added gene: FITM2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list Mode of inheritance for gene: FITM2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FITM2 were set to 28067622; 30214770; 30288795 Phenotypes for gene: FITM2 were set to Siddiqi syndrome MIM#618635 Review for gene: FITM2 was set to GREEN Added comment: Autosomal recessive condition characterised by global developmental delay, early-onset progressive sensorineural hearing impairment, regression of motor skills, dystonia, poor overall growth, and low body mass index (BMI). More variable features may include ichthyosis-like skin abnormalities or sensory neuropathy. 7 individuals from 3 unrelated families reported, supportive Drosophila model. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.87 | CYP27A1 | Zornitza Stark Marked gene: CYP27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.87 | CYP27A1 | Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.87 | CYP27A1 | Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cholestanol storage disease; Dystonia to Cerebrotendinous xanthomatosis, MIM# 213700; Cholestanol storage disease; Dystonia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.86 | CYP27A1 | Zornitza Stark Publications for gene: CYP27A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.85 | CYP27A1 | Zornitza Stark edited their review of gene: CYP27A1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.85 | CYP27A1 | Zornitza Stark reviewed gene: CYP27A1: Rating: ; Mode of pathogenicity: None; Publications: 19373932, 21531161, 25424010; Phenotypes: Cerebrotendinous xanthomatosis, MIM# 213700; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.85 | CP | Zornitza Stark Marked gene: CP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.85 | CP | Zornitza Stark Gene: cp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.85 | CP | Zornitza Stark Phenotypes for gene: CP were changed from Hemosiderosis, systemic, due to aceruloplasminemia 604290; Dystonia; Cerebellar ataxia 604290; Aceruloplasminemia; [Hypoceruloplasminemia, hereditary] 604290 to Aceruloplasminaemia, MIM#604290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.84 | CP | Zornitza Stark commented on gene: CP: Iron deposition in brain, specifically in basal ganglia, resulting in extrapyramidal movement disorders as part of the neurodegenerative phenotype. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.84 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.84 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.84 | CLN3 | Zornitza Stark Classified gene: CLN3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.84 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.83 | CLN3 |
Zornitza Stark gene: CLN3 was added gene: CLN3 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: CLN3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CLN3 were set to 19353721 Phenotypes for gene: CLN3 were set to Ceroid lipofuscinosis, neuronal, 3 204200 Review for gene: CLN3 was set to GREEN Added comment: Movement disorders, including dystonia, are a feature of Batten disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | CLCN1 | Zornitza Stark reviewed gene: CLCN1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Myotonia congenita, dominant, MIM# 160800, Myotonia congenita, recessive, MIM# 255700; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.82 | CACNA1G |
Zornitza Stark changed review comment from: Variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia. Sources: Expert list; to: Four unrelated individuals reported with variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.82 | CACNA1G | Zornitza Stark Marked gene: CACNA1G as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.82 | CACNA1G | Zornitza Stark Gene: cacna1g has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.82 | CACNA1G | Zornitza Stark Classified gene: CACNA1G as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.82 | CACNA1G | Zornitza Stark Gene: cacna1g has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.81 | CACNA1G |
Zornitza Stark gene: CACNA1G was added gene: CACNA1G was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: CACNA1G was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CACNA1G were set to 29878067 Phenotypes for gene: CACNA1G were set to Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM# 618087 Review for gene: CACNA1G was set to GREEN Added comment: Variable spasticity, hypertonia, or dystonia of the limbs in addition to intellectual disability and ataxia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.80 | C9orf72 | Zornitza Stark Marked gene: C9orf72 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.80 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.80 | C9orf72 | Zornitza Stark Classified gene: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.80 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.79 | C9orf72 |
Zornitza Stark gene: C9orf72 was added gene: C9orf72 was added to Dystonia - complex. Sources: Expert list STR tags were added to gene: C9orf72. Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: C9orf72 were set to 26166205; 24363131; 26187722 Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1, MIM# 105550 Review for gene: C9orf72 was set to GREEN Added comment: Dystonia is a well described feature of this condition. Note condition is caused by heterozygous hexanucleotide repeat expansion (GGGGCC) in a noncoding region of the C9ORF72 gene. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | AUH | Zornitza Stark Marked gene: AUH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | AUH | Zornitza Stark Gene: auh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | AUH | Zornitza Stark reviewed gene: AUH: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: 3-methylglutaconic aciduria, type I, MIM# 250950; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.78 | ARX | Zornitza Stark Publications for gene: ARX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.77 | ARX | Zornitza Stark edited their review of gene: ARX: Changed publications: 11889467, 15200506 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.77 | ARX | Zornitza Stark Mode of pathogenicity for gene: ARX was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.76 | ARX | Zornitza Stark Phenotypes for gene: ARX were changed from Early infantile epileptic encephalopathy; Dystonia to Partington syndrome, MIM# 309510; Dystonia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.75 | ARX | Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Partington syndrome, MIM# 309510; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.481 | NDUFB10 | Zornitza Stark Phenotypes for gene: NDUFB10 were changed from fatal infantile lactic acidosis; cardiomyopathy to fatal infantile lactic acidosis; cardiomyopathy; Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.480 | NDUFB10 | Zornitza Stark reviewed gene: NDUFB10: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4232 | NDUFB10 | Zornitza Stark Phenotypes for gene: NDUFB10 were changed from fatal infantile lactic acidosis; cardiomyopathy to fatal infantile lactic acidosis; cardiomyopathy; Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4231 | NDUFB10 | Zornitza Stark edited their review of gene: NDUFB10: Changed phenotypes: fatal infantile lactic acidosis, cardiomyopathy, Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.480 | SSBP1 | Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.479 | SSBP1 | Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.114 | SSBP1 | Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Optic Atrophy v0.113 | SSBP1 | Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4231 | SSBP1 | Zornitza Stark Phenotypes for gene: SSBP1 were changed from Optic atrophy with or without extraocular phenotypes to Optic atrophy with or without extraocular phenotypes; Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4230 | SSBP1 | Zornitza Stark reviewed gene: SSBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4230 | MCM10 | Zornitza Stark Marked gene: MCM10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4230 | MCM10 | Zornitza Stark Gene: mcm10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4230 | MCM10 |
Zornitza Stark gene: MCM10 was added gene: MCM10 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: MCM10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MCM10 were set to 32865517 Phenotypes for gene: MCM10 were set to Susceptibility to CMV Review for gene: MCM10 was set to RED Added comment: Compound heterozygous variants in minichromosomal maintenance complex member 10 (MCM10) reported as a cause of NK-cell deficiency in a child with fatal susceptibility to CMV. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.67 | MCM10 | Zornitza Stark Marked gene: MCM10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.67 | MCM10 | Zornitza Stark Gene: mcm10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.67 | MCM10 | Zornitza Stark Mode of inheritance for gene: MCM10 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.66 | MCM10 |
Zornitza Stark gene: MCM10 was added gene: MCM10 was added to Susceptibility to Viral Infections. Sources: Literature Mode of inheritance for gene: MCM10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MCM10 were set to 32865517 Phenotypes for gene: MCM10 were set to Susceptibility to CMV Review for gene: MCM10 was set to RED Added comment: Compound heterozygous variants in minichromosomal maintenance complex member 10 (MCM10) reported as a cause of NK-cell deficiency in a child with fatal susceptibility to CMV. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.64 | TET2 | Zornitza Stark Marked gene: TET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.64 | TET2 | Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.64 | TET2 | Zornitza Stark Classified gene: TET2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.64 | TET2 | Zornitza Stark Gene: tet2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.63 | TET2 |
Zornitza Stark gene: TET2 was added gene: TET2 was added to Disorders of immune dysregulation. Sources: Literature Mode of inheritance for gene: TET2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TET2 were set to 32518946 Phenotypes for gene: TET2 were set to Immune dysregulation; Lymphoma Review for gene: TET2 was set to GREEN Added comment: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | TET2 | Zornitza Stark changed review comment from: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.; to: Mono-allelic variants: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | TET2 | Zornitza Stark changed review comment from: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution.; to: Mono-allelic variants: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | TET2 | Zornitza Stark changed review comment from: PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.; to: Bi-allelic variants PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | TET2 | Zornitza Stark changed review comment from: No evidence for Mendelian gene-disease association. Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established.; to: Somatic TET2 variants are commonly found in cancers. One Finnish family reported where germline variant present 7 individuals, of whom 3 had lymphoma. Another French family reported with three sibs: frameshift variant and myeloid malignancies. Contribution of germline variants to malignancy risk to be established. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | TET2 | Zornitza Stark edited their review of gene: TET2: Added comment: PMID 32518946: 3 children with an immune dysregulation syndrome of susceptibility to infection, lymphadenopathy, hepatosplenomegaly, developmental delay, autoimmunity, and lymphoma of B-cell (n = 2) or T-cell (n = 1) origin, and bi-allelic variants in TET2.; Changed rating: GREEN; Changed publications: 30890702, 31827242, 32330418, 32518946; Changed phenotypes: Dementia, Lymphoma/myeloid malignancy, Immunodeficiency; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.479 | CASK | Zornitza Stark Marked gene: CASK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.479 | CASK | Zornitza Stark Gene: cask has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.479 | CASK | Zornitza Stark Phenotypes for gene: CASK were changed from to Mental retardation and microcephaly with pontine and cerebellar hypoplasia, MIM# 300749 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.478 | CASK | Zornitza Stark Publications for gene: CASK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.477 | CASK | Zornitza Stark Mode of inheritance for gene: CASK was changed from Unknown to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.476 | CASK | Zornitza Stark reviewed gene: CASK: Rating: GREEN; Mode of pathogenicity: None; Publications: 21954287, 19165920, 21735175; Phenotypes: Mental retardation and microcephaly with pontine and cerebellar hypoplasia, MIM# 300749; Mode of inheritance: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.476 | ATR | Zornitza Stark Marked gene: ATR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.476 | ATR | Zornitza Stark Gene: atr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.476 | ATR | Zornitza Stark Phenotypes for gene: ATR were changed from to Seckel syndrome 1, MIM# 210600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.475 | ATR | Zornitza Stark Publications for gene: ATR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.474 | ATR | Zornitza Stark Mode of inheritance for gene: ATR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.473 | ATR | Zornitza Stark reviewed gene: ATR: Rating: GREEN; Mode of pathogenicity: None; Publications: 12640452, 19620979, 30199583, 23111928; Phenotypes: Seckel syndrome 1, MIM# 210600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.19 | YIF1B |
Zornitza Stark gene: YIF1B was added gene: YIF1B was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: YIF1B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YIF1B were set to 32006098; 26077767 Phenotypes for gene: YIF1B were set to Central hypotonia; Failure to thrive; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Spasticity; Abnormality of movement Review for gene: YIF1B was set to GREEN Added comment: 6 individuals (from 5 families) with biallelic YIF1B truncating variants reported. Presenting features: hypotonia, failure to thrive, microcephaly (5/6), severe global DD and ID as well as features suggestive of a motor disorder (dystonia/spasticity/dyskinesia). Seizures were reported in 2 unrelated individuals (2/6). MRI abnormalities were observed in some with thin CC being a feature in 3. Affected individuals were found to be homozygous for truncating variants (4/5 families being consanguineous). The following 3 variants were identified (NM_001039672.2) : c.186dupT or p.Ala64fs / c.360_361insACAT or p.Gly121fs / c.598G>T or p.Glu200*. Yif1B KO mice demonstrate a disorganized Golgi architecture in pyramidal hippocampal neurons (Alterio et al 2015 - PMID: 26077767). Functional/network analysis of genes co-regulated with YIF1B based on available RNAseq data, suggest enrichement in in genes important for nervous system development and function. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.473 | UGP2 | Zornitza Stark edited their review of gene: UGP2: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.473 | UBE3A | Zornitza Stark reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Angelman syndrome MIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.473 | UBE3A | Zornitza Stark Mode of inheritance for gene: UBE3A was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.18 | DYNC1I2 |
Zornitza Stark gene: DYNC1I2 was added gene: DYNC1I2 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: DYNC1I2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DYNC1I2 were set to 31079899 Phenotypes for gene: DYNC1I2 were set to Neurodevelopmental disorder with microcephaly and structural brain anomalies , MIM#618492 Review for gene: DYNC1I2 was set to GREEN Added comment: Five individuals from three unrelated families reported. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.472 | DPM1 | Zornitza Stark reviewed gene: DPM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Congenital disorder of glycosylation, type Ie 608799; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.472 | DNMT3A | Zornitza Stark edited their review of gene: DNMT3A: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.14 | FOXG1 | Zornitza Stark Marked gene: FOXG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.14 | FOXG1 | Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.14 | FOXG1 | Zornitza Stark Phenotypes for gene: FOXG1 were changed from to Rett syndrome, congenital variant, MIM# 613454 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.13 | FOXG1 | Zornitza Stark Publications for gene: FOXG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.12 | FOXG1 | Zornitza Stark Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Angelman Rett like syndromes v0.11 | FOXG1 | Zornitza Stark reviewed gene: FOXG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21441262, 19564653, 19578037; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.472 | FOXG1 | Zornitza Stark Marked gene: FOXG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.472 | FOXG1 | Zornitza Stark Gene: foxg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.472 | FOXG1 | Zornitza Stark Phenotypes for gene: FOXG1 were changed from to Rett syndrome, congenital variant, MIM# 613454 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.471 | FOXG1 | Zornitza Stark Publications for gene: FOXG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.470 | FOXG1 | Zornitza Stark Mode of inheritance for gene: FOXG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.469 | FOXG1 | Zornitza Stark edited their review of gene: FOXG1: Changed rating: GREEN; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.469 | FOXG1 | Zornitza Stark reviewed gene: FOXG1: Rating: ; Mode of pathogenicity: None; Publications: 21441262, 19564653, 19578037; Phenotypes: Rett syndrome, congenital variant, MIM# 613454; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | FDXR | Zornitza Stark Marked gene: FDXR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | FDXR | Zornitza Stark Gene: fdxr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4229 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM#617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4228 | FDXR | Zornitza Stark Publications for gene: FDXR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4227 | FDXR | Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4226 | FDXR | Zornitza Stark edited their review of gene: FDXR: Added comment: Four families reported with bi-allelic variants in FDXR causing an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe progressive neurological phenotype. Mouse model exhibits neurodegeneration.; Changed rating: GREEN; Changed publications: 30250212, 28965846 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.148 | FDXR | Zornitza Stark Marked gene: FDXR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.148 | FDXR | Zornitza Stark Gene: fdxr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.148 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.147 | FDXR | Zornitza Stark Publications for gene: FDXR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.146 | FDXR | Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.145 | FDXR | Zornitza Stark Classified gene: FDXR as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.145 | FDXR | Zornitza Stark Gene: fdxr has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.144 | FDXR | Zornitza Stark reviewed gene: FDXR: Rating: AMBER; Mode of pathogenicity: None; Publications: 30250212; Phenotypes: Auditory neuropathy and optic atrophy, MIM# 617717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2959 | FDXR | Zornitza Stark Publications for gene: FDXR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | FDXR | Zornitza Stark changed review comment from: ID is not part of the phenotype.; to: Bi-allelic variants in FDXR cause an autosomal recessive neurologic disorder characterised by onset of visual and hearing impairment in the first or second decades. Two individuals described with a more severe phenotype, including one with intellectual disability. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | FDXR | Zornitza Stark edited their review of gene: FDXR: Changed publications: 30250212 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.469 | FDXR | Zornitza Stark Marked gene: FDXR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.469 | FDXR | Zornitza Stark Gene: fdxr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.469 | FDXR | Zornitza Stark Phenotypes for gene: FDXR were changed from to Auditory neuropathy and optic atrophy, MIM# 617717 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.468 | FDXR | Zornitza Stark Publications for gene: FDXR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.467 | FDXR | Zornitza Stark Mode of inheritance for gene: FDXR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.466 | FDXR | Zornitza Stark Classified gene: FDXR as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.466 | FDXR | Zornitza Stark Gene: fdxr has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.465 | FDXR | Zornitza Stark reviewed gene: FDXR: Rating: RED; Mode of pathogenicity: None; Publications: 30250212; Phenotypes: Auditory neuropathy and optic atrophy, MIM# 617717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4226 | EXOC7 | Zornitza Stark Marked gene: EXOC7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4226 | EXOC7 | Zornitza Stark Gene: exoc7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4226 | EXOC7 | Zornitza Stark Classified gene: EXOC7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4226 | EXOC7 | Zornitza Stark Gene: exoc7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | EIF2S3 | Zornitza Stark Marked gene: EIF2S3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | EIF2S3 | Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2958 | EIF2S3 | Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2957 | EIF2S3 | Zornitza Stark Publications for gene: EIF2S3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2956 | EIF2S3 | Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2955 | EIF2S3 | Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.465 | EIF2S3 | Zornitza Stark Marked gene: EIF2S3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.465 | EIF2S3 | Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4225 | EIF2S3 | Zornitza Stark Marked gene: EIF2S3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4225 | EIF2S3 | Zornitza Stark Gene: eif2s3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4225 | EIF2S3 | Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4224 | EIF2S3 | Zornitza Stark Publications for gene: EIF2S3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4223 | EIF2S3 | Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4222 | EIF2S3 | Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.465 | EIF2S3 | Zornitza Stark Phenotypes for gene: EIF2S3 were changed from to MEHMO syndrome, MIM# 300148 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.464 | EIF2S3 | Zornitza Stark Publications for gene: EIF2S3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.463 | EIF2S3 | Zornitza Stark Mode of inheritance for gene: EIF2S3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.462 | EIF2S3 | Zornitza Stark reviewed gene: EIF2S3: Rating: GREEN; Mode of pathogenicity: None; Publications: 23063529, 27333055, 28055140, 32799315; Phenotypes: MEHMO syndrome, MIM# 300148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.479 | IDH3A | Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa to Retinitis pigmentosa 90, MIM#619007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.478 | IDH3A | Zornitza Stark edited their review of gene: IDH3A: Changed phenotypes: Retinitis pigmentosa 90, MIM#619007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4222 | IDH3A | Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa to Retinitis pigmentosa 90, MIM#619007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4221 | IDH3A | Zornitza Stark edited their review of gene: IDH3A: Changed phenotypes: Retinitis pigmentosa 90, MIM#619007 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.60 | IDH3A | Zornitza Stark Marked gene: IDH3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.60 | IDH3A | Zornitza Stark Gene: idh3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Retinitis pigmentosa v0.60 | IDH3A | Zornitza Stark Phenotypes for gene: IDH3A were changed from Retinitis pigmentosa; Leber congenital amaurosis to Retinitis pigmentosa, MIM#619007; Leber congenital amaurosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2955 | SETD1B | Zornitza Stark Phenotypes for gene: SETD1B were changed from SETD1B-related neurodevelopmental disorder to Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.843 | SETD1B | Zornitza Stark Phenotypes for gene: SETD1B were changed from Epilepsy with myoclonic absences; intellectual disability; SETD1B-related neurodevelopmental disorder to Epilepsy with myoclonic absences; intellectual disability; Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4221 | SETD1B | Zornitza Stark Phenotypes for gene: SETD1B were changed from Epilepsy with myoclonic absences; intellectual disability; SETD1B-related neurodevelopmental disorder to Epilepsy with myoclonic absences; intellectual disability; Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 | CD46 | Zornitza Stark Marked gene: CD46 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 | CD46 | Zornitza Stark Gene: cd46 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.32 | CD46 | Zornitza Stark Phenotypes for gene: CD46 were changed from to {Susceptibility to atypical hemolytic uremic syndrome 2} (MIM#612922), AD, AR; Atypical hemolytic uremic syndrome 2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.31 | CD46 | Zornitza Stark Publications for gene: CD46 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.30 | CD46 | Zornitza Stark Mode of inheritance for gene: CD46 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.842 | TRIP13 | Zornitza Stark Marked gene: TRIP13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.842 | TRIP13 | Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.842 | TRIP13 | Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.841 | TRIP13 | Zornitza Stark Publications for gene: TRIP13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.840 | TRIP13 | Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.839 | TRIP13 | Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.839 | TRIP13 | Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.838 | TRIP13 | Zornitza Stark reviewed gene: TRIP13: Rating: AMBER; Mode of pathogenicity: None; Publications: 28553959; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.462 | TRIP13 | Zornitza Stark Marked gene: TRIP13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.462 | TRIP13 | Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.462 | TRIP13 | Zornitza Stark Phenotypes for gene: TRIP13 were changed from to Mosaic variegated aneuploidy syndrome 3, MIM# 617598 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.461 | TRIP13 | Zornitza Stark Publications for gene: TRIP13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.460 | TRIP13 | Zornitza Stark Tag founder tag was added to gene: TRIP13. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRIP13 | Zornitza Stark Tag founder tag was added to gene: TRIP13. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.460 | TRIP13 | Zornitza Stark Mode of inheritance for gene: TRIP13 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRIP13 | Zornitza Stark changed review comment from: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable.; to: Early-onset Wilms tumor and either aneuploidy or premature chromatid separation in cells. Some individuals described as having additional developmental features, such as microcephaly, growth retardation, or developmental delay but these are highly variable. Also note 5/6 reported families had the same homozygous variant, p.Arg354X, suggestive of founder effect. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.459 | TRIP13 | Zornitza Stark Classified gene: TRIP13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.459 | TRIP13 | Zornitza Stark Gene: trip13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.458 | TRIP13 | Zornitza Stark reviewed gene: TRIP13: Rating: AMBER; Mode of pathogenicity: None; Publications: 28553959; Phenotypes: Mosaic variegated aneuploidy syndrome 3, MIM# 617598; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.838 | TRAPPC6B | Zornitza Stark Marked gene: TRAPPC6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.838 | TRAPPC6B | Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.838 | TRAPPC6B | Zornitza Stark Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.837 | TRAPPC6B | Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.144 | TRAPPC6B | Zornitza Stark Marked gene: TRAPPC6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.144 | TRAPPC6B | Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.144 | TRAPPC6B | Zornitza Stark Classified gene: TRAPPC6B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.144 | TRAPPC6B | Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.836 | TRAPPC6B | Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.836 | TRAPPC6B | Zornitza Stark Publications for gene: TRAPPC6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.835 | TRAPPC6B | Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.143 | TRAPPC6B |
Zornitza Stark gene: TRAPPC6B was added gene: TRAPPC6B was added to Regression. Sources: Expert Review Mode of inheritance for gene: TRAPPC6B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267 Phenotypes for gene: TRAPPC6B were set to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 Review for gene: TRAPPC6B was set to GREEN Added comment: Five unrelated families reported with autosomal recessive neurodegenerative disorder characterised by global developmental delay, severe intellectual disability with poor or absent speech and autistic stereotypic behaviors, microcephaly, early-onset generalized seizures, and hypotonia. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.834 | TRAPPC6B | Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRAPPC6B | Zornitza Stark Marked gene: TRAPPC6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRAPPC6B | Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2954 | TRAPPC6B | Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2953 | TRAPPC6B | Zornitza Stark Publications for gene: TRAPPC6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2952 | TRAPPC6B | Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2951 | TRAPPC6B | Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4220 | TRAPPC6B | Zornitza Stark Marked gene: TRAPPC6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4220 | TRAPPC6B | Zornitza Stark Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4220 | TRAPPC6B | Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4219 | TRAPPC6B | Zornitza Stark Publications for gene: TRAPPC6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.17 | TRAPPC6B |
Zornitza Stark gene: TRAPPC6B was added gene: TRAPPC6B was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: TRAPPC6B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC6B were set to 28626029; 28397838; 31687267 Phenotypes for gene: TRAPPC6B were set to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 Review for gene: TRAPPC6B was set to GREEN Added comment: Five unrelated families reported with autosomal recessive neurodegenerative disorder characterised by global developmental delay, severe intellectual disability with poor or absent speech and autistic stereotypic behaviors, microcephaly, early-onset generalized seizures, and hypotonia. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4218 | TRAPPC6B | Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.458 | TRAPPC6B | Zornitza Stark Phenotypes for gene: TRAPPC6B were changed from to Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4217 | TRAPPC6B | Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.457 | TRAPPC6B | Zornitza Stark Publications for gene: TRAPPC6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.456 | TRAPPC6B | Zornitza Stark Mode of inheritance for gene: TRAPPC6B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.455 | TRAPPC6B | Zornitza Stark reviewed gene: TRAPPC6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28626029, 28397838, 31687267; Phenotypes: Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.455 | TRAPPC12 | Zornitza Stark Marked gene: TRAPPC12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.455 | TRAPPC12 | Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.142 | TRAPPC12 | Zornitza Stark Marked gene: TRAPPC12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.142 | TRAPPC12 | Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.142 | TRAPPC12 | Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.141 | TRAPPC12 | Zornitza Stark Publications for gene: TRAPPC12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.140 | TRAPPC12 | Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.139 | TRAPPC12 | Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.16 | TRAPPC12 |
Zornitza Stark gene: TRAPPC12 was added gene: TRAPPC12 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: TRAPPC12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC12 were set to 32369837; 28777934 Phenotypes for gene: TRAPPC12 were set to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669 Review for gene: TRAPPC12 was set to GREEN Added comment: Four families reported with a severe progressive encephalopathy characterized by microcephaly, global developmental delay, and hearing loss. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4217 | TRAPPC12 | Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4216 | TRAPPC12 | Zornitza Stark Publications for gene: TRAPPC12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4215 | TRAPPC12 | Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4214 | TRAPPC12 | Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.455 | TRAPPC12 | Zornitza Stark Phenotypes for gene: TRAPPC12 were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.454 | TRAPPC12 | Zornitza Stark Publications for gene: TRAPPC12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.453 | TRAPPC12 | Zornitza Stark Mode of inheritance for gene: TRAPPC12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.452 | TRAPPC12 | Zornitza Stark reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.15 | TPRKB |
Zornitza Stark gene: TPRKB was added gene: TPRKB was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: TPRKB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TPRKB were set to 28805828; 30053862 Phenotypes for gene: TPRKB were set to Galloway-Mowat syndrome 5, MIM# 617731 Review for gene: TPRKB was set to GREEN Added comment: Three unrelated families reported with renal-neurologic disease characterized by early-onset nephrotic syndrome associated with microcephaly. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4214 | TPRKB | Zornitza Stark Marked gene: TPRKB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4214 | TPRKB | Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4214 | TPRKB | Zornitza Stark Phenotypes for gene: TPRKB were changed from to Galloway-Mowat syndrome 5, MIM# 617731 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4213 | TPRKB | Zornitza Stark Publications for gene: TPRKB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4212 | TPRKB | Zornitza Stark Mode of inheritance for gene: TPRKB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4211 | TPRKB | Zornitza Stark reviewed gene: TPRKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 5, MIM# 617731; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.452 | TPRKB | Zornitza Stark Marked gene: TPRKB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.452 | TPRKB | Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.452 | TPRKB | Zornitza Stark Phenotypes for gene: TPRKB were changed from to Galloway-Mowat syndrome 5, MIM# 617731 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.451 | TPRKB | Zornitza Stark Publications for gene: TPRKB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.450 | TPRKB | Zornitza Stark Mode of inheritance for gene: TPRKB was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.449 | TPRKB | Zornitza Stark reviewed gene: TPRKB: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 5, MIM# 617731; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.133 | TP53RK | Zornitza Stark Marked gene: TP53RK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.133 | TP53RK | Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.14 | TP53RK |
Zornitza Stark gene: TP53RK was added gene: TP53RK was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert Review Mode of inheritance for gene: TP53RK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TP53RK were set to 28805828; 30053862 Phenotypes for gene: TP53RK were set to Galloway-Mowat syndrome 4, MIM# 617730 Review for gene: TP53RK was set to GREEN Added comment: At least 4 unrelated families reported with renal-neurologic disease characterised by early-onset nephrotic syndrome associated with microcephaly, gyral abnormalities, and delayed psychomotor development. Most individuals have dysmorphic facial features, often including hypertelorism, ear abnormalities, and micrognathia. Other features, such as arachnodactyly and visual impairment, are more variable. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.133 | TP53RK | Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.132 | TP53RK | Zornitza Stark Publications for gene: TP53RK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.131 | TP53RK | Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | TP53RK | Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4211 | TP53RK | Zornitza Stark Marked gene: TP53RK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4211 | TP53RK | Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4211 | TP53RK | Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4210 | TP53RK | Zornitza Stark Publications for gene: TP53RK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4209 | TP53RK | Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4208 | TP53RK | Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.449 | TP53RK | Zornitza Stark Marked gene: TP53RK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.449 | TP53RK | Zornitza Stark Gene: tp53rk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.449 | TP53RK | Zornitza Stark Phenotypes for gene: TP53RK were changed from to Galloway-Mowat syndrome 4, MIM# 617730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.448 | TP53RK | Zornitza Stark Publications for gene: TP53RK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.447 | TP53RK | Zornitza Stark Mode of inheritance for gene: TP53RK was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.446 | TP53RK | Zornitza Stark reviewed gene: TP53RK: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 30053862; Phenotypes: Galloway-Mowat syndrome 4, MIM# 617730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Atypical Haemolytic Uraemic Syndrome_MPGN v0.29 | CD46 | Kristin Rigbye reviewed gene: CD46: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26054645, 26826462; Phenotypes: {Susceptibility to atypical hemolytic uremic syndrome 2} (MIM#612922), AD, AR, Atypical hemolytic uremic syndrome 2; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.446 | TCF4 | Zornitza Stark Marked gene: TCF4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.446 | TCF4 | Zornitza Stark Gene: tcf4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.446 | TCF4 | Zornitza Stark Phenotypes for gene: TCF4 were changed from to Pitt-Hopkins syndrome, MIM# 610954 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.445 | TCF4 | Zornitza Stark Publications for gene: TCF4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.444 | TCF4 | Zornitza Stark Mode of inheritance for gene: TCF4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.443 | TCF4 | Zornitza Stark reviewed gene: TCF4: Rating: GREEN; Mode of pathogenicity: None; Publications: 18728071, 22934316; Phenotypes: Pitt-Hopkins syndrome, MIM# 610954; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.13 | TBC1D20 |
Zornitza Stark gene: TBC1D20 was added gene: TBC1D20 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list Mode of inheritance for gene: TBC1D20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBC1D20 were set to 24239381; 32740904; 32162791 Phenotypes for gene: TBC1D20 were set to Warburg micro syndrome 4, MIM# 615663; Martsolf syndrome Review for gene: TBC1D20 was set to GREEN Added comment: 7 unrelated families reported with autosomal recessive syndrome characterised by microcephaly, microphthalmia, microcornea, congenital cataracts, optic atrophy, cortical dysplasia, in particular corpus callosum hypoplasia, severe mental retardation, spastic diplegia, and hypogonadism. One of the families is described as Martsolf syndrome, the rest as Warburg micro. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4208 | TBC1D20 | Zornitza Stark Marked gene: TBC1D20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4208 | TBC1D20 | Zornitza Stark Gene: tbc1d20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4208 | TBC1D20 | Zornitza Stark Phenotypes for gene: TBC1D20 were changed from to Warburg micro syndrome 4, MIM# 615663; Martsolf syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4207 | TBC1D20 | Zornitza Stark Publications for gene: TBC1D20 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4206 | TBC1D20 | Zornitza Stark Mode of inheritance for gene: TBC1D20 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4205 | TBC1D20 | Zornitza Stark reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381, 32740904, 32162791; Phenotypes: Warburg micro syndrome 4, MIM# 615663, Martsolf syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.443 | TBC1D20 | Zornitza Stark Marked gene: TBC1D20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.443 | TBC1D20 | Zornitza Stark Gene: tbc1d20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.443 | TBC1D20 | Zornitza Stark Phenotypes for gene: TBC1D20 were changed from to Warburg micro syndrome 4, MIM# 615663 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.442 | TBC1D20 | Zornitza Stark Publications for gene: TBC1D20 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.441 | TBC1D20 | Zornitza Stark Mode of inheritance for gene: TBC1D20 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.440 | TBC1D20 | Zornitza Stark reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381; Phenotypes: Warburg micro syndrome 4, MIM# 615663; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.12 | TMEM94 |
Zornitza Stark gene: TMEM94 was added gene: TMEM94 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM94 were set to 30526868 Phenotypes for gene: TMEM94 were set to Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316 Review for gene: TMEM94 was set to GREEN Added comment: 10 individuals from 6 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4205 | DHX34 | Zornitza Stark Marked gene: DHX34 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4205 | DHX34 | Zornitza Stark Gene: dhx34 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4205 | DHX34 |
Zornitza Stark gene: DHX34 was added gene: DHX34 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DHX34 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DHX34 were set to 31256877 Phenotypes for gene: DHX34 were set to Intellectual disability; congenital anomalies Review for gene: DHX34 was set to RED Added comment: Three families reported. Two with bi-allelic variants and ID/multiple congenital anomalies but another molecular diagnosis present in both (variants in established genes). Single de novo missense in another individual with ID and dysmorphism. No supporting functional data. Overall RED rating for both MOI. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4204 | DDX54 | Zornitza Stark Marked gene: DDX54 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4204 | DDX54 | Zornitza Stark Gene: ddx54 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4204 | DDX54 |
Zornitza Stark gene: DDX54 was added gene: DDX54 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DDX54 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DDX54 were set to 31256877 Phenotypes for gene: DDX54 were set to Intellectual disability; congenital anomalies Review for gene: DDX54 was set to RED Added comment: Three individuals reported with different MOIs and different phenotypes. One with de novo variant and ID, another with bi-allelic variants and ID, and a third with bi-allelic variants and CAKUT. All variants are missense, no functional data. Overall, Red rating given inconsistent phenotypes and modes of inheritance, each one is essentially treated separately for now until further cases identified. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4203 | DHX16 | Zornitza Stark Marked gene: DHX16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4203 | DHX16 | Zornitza Stark Gene: dhx16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4203 | DHX16 | Zornitza Stark Classified gene: DHX16 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4203 | DHX16 | Zornitza Stark Gene: dhx16 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4202 | DHX16 |
Zornitza Stark gene: DHX16 was added gene: DHX16 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: DHX16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DHX16 were set to 31256877 Phenotypes for gene: DHX16 were set to Neuromuscular disease and ocular or auditory anomalies with or without seizures, MIM# 618733 Review for gene: DHX16 was set to GREEN Added comment: Four unrelated individuals reported with de novo missense variants in this gene. Three of the individuals died in infancy, so phenotypic spectrum difficult to discern. Two had seizures. Individual with long-term survival had a progressive course, evidence of myopathy, loss of hearing and vision, and normal IQ. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4201 | DHX37 | Zornitza Stark Phenotypes for gene: DHX37 were changed from 46,XY gonadal dysgenesis; testicular regression syndrome (TRS) to 46,XY gonadal dysgenesis; testicular regression syndrome (TRS); Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4200 | DHX37 | Zornitza Stark Publications for gene: DHX37 were set to 31337883; 31745530 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4199 | DHX37 | Zornitza Stark Mode of inheritance for gene: DHX37 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4198 | DHX37 |
Zornitza Stark changed review comment from: Seventeen individuals with 46,XY gonadal dysgenesis reported in two studies. Sources: Literature; to: Mono-allelic disease: Seventeen individuals with 46,XY gonadal dysgenesis reported in two studies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4198 | DHX37 | Zornitza Stark edited their review of gene: DHX37: Added comment: Bi-allelic disease: 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype, which also includes congenital anomalies particularly affecting the vertebrae and heart, but also some with microcephaly, brain anomalies.; Changed publications: 31337883, 31745530, 26539891, 31256877; Changed phenotypes: 46,XY gonadal dysgenesis, testicular regression syndrome (TRS), Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2951 | DHX37 |
Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic variants causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2951 | DHX37 |
Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease at this stage.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease Much less clear association between mono-allelic variants and ID, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease causing a neurodevelopmental phenotype at this stage. Note there is a separate association between mono allelic variants and DSD. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2951 | DHX37 | Zornitza Stark Mode of inheritance for gene: DHX37 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2950 | DHX37 |
Zornitza Stark changed review comment from: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo.; to: Overall, 5 unrelated families with bi-allelic variants, all with ID as part of the phenotype. Green for bi-allelic disease Much less clear association between mono-allelic variants and disease, two missense variants reported. Note one was mosaic, and for the other, paternal sample was not available, so not confirmed to be de novo. No mechanism for mono-allelic vs bi-allelic disease proposed. Overall, Red for mono-allelic disease at this stage. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2950 | DHX37 | Zornitza Stark Marked gene: DHX37 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2950 | DHX37 | Zornitza Stark Gene: dhx37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2950 | DHX37 | Zornitza Stark Classified gene: DHX37 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2950 | DHX37 | Zornitza Stark Gene: dhx37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | DHX37 | Zornitza Stark reviewed gene: DHX37: Rating: GREEN; Mode of pathogenicity: None; Publications: 26539891, 31256877; Phenotypes: Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | DHX37 |
Naomi Baker gene: DHX37 was added gene: DHX37 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: DHX37 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: DHX37 were set to PMID: 26539891; 31256877 Phenotypes for gene: DHX37 were set to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731 Review for gene: DHX37 was set to GREEN Added comment: Two unrelated patients from consanguineous families reported with biallelic missense variants. Clinical presentation included severe microcephaly, DD/ID, and cortical atrophy (PMID: 26539891). Five individuals who share a phenotype of DD and/or ID and CNS dysfunction. Three out of five individuals also have scoliosis, and two have cardiac phenotypes (PMID: 31256877). Three of the patients had bialleleic missense variants, while two patients had a de novo monoallelic missense variant. Note that OMIM lists inheritance as biallelic, however two monoallelic cases reportes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.18 | TMEM94 | Alison Yeung Classified gene: TMEM94 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.18 | TMEM94 | Alison Yeung Gene: tmem94 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.17 | TMEM94 | Alison Yeung Marked gene: TMEM94 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.17 | TMEM94 | Alison Yeung Gene: tmem94 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hypertrichosis syndromes v0.17 | TMEM94 |
Alison Yeung gene: TMEM94 was added gene: TMEM94 was added to Hypertrichosis syndromes. Sources: Literature Mode of inheritance for gene: TMEM94 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMEM94 were set to 30526868 Phenotypes for gene: TMEM94 were set to OMIM# 618316 INTELLECTUAL DEVELOPMENTAL DISORDER WITH CARDIAC DEFECTS AND DYSMORPHIC FACIES; IDDCDF Review for gene: TMEM94 was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4198 | CFL2 | Zornitza Stark Marked gene: CFL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4198 | CFL2 | Zornitza Stark Gene: cfl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4198 | CFL2 | Zornitza Stark Phenotypes for gene: CFL2 were changed from to Nemaline myopathy 7, autosomal recessive, MIM# 610687 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4197 | CFL2 | Zornitza Stark Publications for gene: CFL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4196 | CFL2 | Zornitza Stark Mode of inheritance for gene: CFL2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4195 | CFL2 | Zornitza Stark reviewed gene: CFL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17160903, 22560515, 32697999, 29457652, 24610938; Phenotypes: Nemaline myopathy 7, autosomal recessive, MIM# 610687; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.231 | TDRD7 | Zornitza Stark Publications for gene: TDRD7 were set to 28837160; 21436445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.230 | TDRD7 | Zornitza Stark edited their review of gene: TDRD7: Added comment: PMID: 32420594 (2020) - Knockout mouse model recapitulates human cataracts phenotype and provides supporting functional data.; Changed publications: 28837160, 21436445, 32420594; Changed phenotypes: Cataract 36, 613887, glaucoma, nonobstructive azoospermia, arrested spermatogenesis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4195 | TDRD7 | Zornitza Stark Marked gene: TDRD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4195 | TDRD7 | Zornitza Stark Gene: tdrd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4195 | TDRD7 | Zornitza Stark Phenotypes for gene: TDRD7 were changed from Cataract 36 613887; glaucoma; nonobstructive azoospermia; arrested spermatogenesis to Cataract 36, 613887; glaucoma; nonobstructive azoospermia; arrested spermatogenesis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4194 | TDRD7 | Zornitza Stark Publications for gene: TDRD7 were set to 28837160; 21436445 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4193 | TDRD7 | Zornitza Stark reviewed gene: TDRD7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cataract 36, MIM# 613887; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | PAK3 | Zornitza Stark Marked gene: PAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2949 | PAK3 | Zornitza Stark Phenotypes for gene: PAK3 were changed from to Mental retardation, X-linked 30/47, MIM# 300558; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2948 | PAK3 | Zornitza Stark Publications for gene: PAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2947 | PAK3 | Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4193 | PAK3 | Zornitza Stark Marked gene: PAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4193 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2946 | PAK3 | Zornitza Stark reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 32050918, 32005903, 31943058, 31843706, 31678216; Phenotypes: Mental retardation, X-linked 30/47, MIM# 300558, Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4193 | PAK3 | Zornitza Stark Phenotypes for gene: PAK3 were changed from to Mental retardation, X-linked 30/47, MIM# 300558; Intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4192 | PAK3 | Zornitza Stark Publications for gene: PAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4191 | PAK3 | Zornitza Stark Mode of inheritance for gene: PAK3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | PAK3 | Zornitza Stark reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 32050918, 32005903, 31943058, 31843706, 31678216; Phenotypes: Mental retardation, X-linked 30/47, MIM# 300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | CFL2 | Arina Puzriakova reviewed gene: CFL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32160286; Phenotypes: Nemaline myopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | TDRD7 | Arina Puzriakova reviewed gene: TDRD7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32420594; Phenotypes: Congenital cataracts; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2946 | CLTC | Zornitza Stark Marked gene: CLTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2946 | CLTC | Zornitza Stark Gene: cltc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2946 | CLTC | Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2945 | CLTC | Zornitza Stark Publications for gene: CLTC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2944 | CLTC | Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2943 | CLTC | Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.834 | CLTC | Zornitza Stark Marked gene: CLTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.834 | CLTC | Zornitza Stark Gene: cltc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.834 | CLTC | Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.833 | CLTC | Zornitza Stark Publications for gene: CLTC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.832 | CLTC | Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | CLTC | Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | CLTC | Zornitza Stark Marked gene: CLTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | CLTC | Zornitza Stark Gene: cltc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4190 | CLTC | Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56, MIM# 617854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4189 | CLTC | Zornitza Stark Publications for gene: CLTC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4188 | CLTC | Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | CLTC | Zornitza Stark reviewed gene: CLTC: Rating: GREEN; Mode of pathogenicity: None; Publications: 29100083, 26822784; Phenotypes: Mental retardation, autosomal dominant 56, MIM# 617854; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.440 | CLTC | Zornitza Stark Marked gene: CLTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.440 | CLTC | Zornitza Stark Gene: cltc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.440 | CLTC | Zornitza Stark Phenotypes for gene: CLTC were changed from to Mental retardation, autosomal dominant 56 (MIM#617854) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.439 | CLTC | Zornitza Stark Publications for gene: CLTC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.438 | CLTC | Zornitza Stark Mode of inheritance for gene: CLTC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.437 | CLTC | Zornitza Stark Classified gene: CLTC as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.437 | CLTC | Zornitza Stark Gene: cltc has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.436 | RAB3GAP2 | Zornitza Stark Marked gene: RAB3GAP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.436 | RAB3GAP2 | Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | PAK3 | Arina Puzriakova reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31943058; Phenotypes: Intellectual disability; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.436 | STAG1 | Zornitza Stark Marked gene: STAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.436 | STAG1 | Zornitza Stark Gene: stag1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.436 | STAG1 | Zornitza Stark Phenotypes for gene: STAG1 were changed from to Mental retardation, autosomal dominant 47, MIM# 617635 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.435 | STAG1 | Zornitza Stark Publications for gene: STAG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.434 | STAG1 | Zornitza Stark Mode of inheritance for gene: STAG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.433 | STAG1 | Zornitza Stark Classified gene: STAG1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.433 | STAG1 | Zornitza Stark Gene: stag1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.432 | STAG1 | Zornitza Stark reviewed gene: STAG1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28119487; Phenotypes: Mental retardation, autosomal dominant 47, MIM# 617635; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.432 | SMC3 | Zornitza Stark Marked gene: SMC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.432 | SMC3 | Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.432 | SMC3 | Zornitza Stark Classified gene: SMC3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.432 | SMC3 | Zornitza Stark Gene: smc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.431 | SMC3 |
Zornitza Stark gene: SMC3 was added gene: SMC3 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: SMC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMC3 were set to Cornelia de Lange syndrome 3, MIM# 610759 Review for gene: SMC3 was set to GREEN Added comment: Well established gene-disease association, microcephaly is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.430 | SMC1A | Zornitza Stark Marked gene: SMC1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.430 | SMC1A | Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.430 | SMC1A | Zornitza Stark Classified gene: SMC1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.430 | SMC1A | Zornitza Stark Gene: smc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.429 | SMC1A |
Zornitza Stark gene: SMC1A was added gene: SMC1A was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: SMC1A was set to Other Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome 2, MIM# 300590 Review for gene: SMC1A was set to GREEN Added comment: XLD. Well established gene-disease association. Microcephaly is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.428 | SLX4 | Zornitza Stark Marked gene: SLX4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.428 | SLX4 | Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.428 | SLX4 | Zornitza Stark Classified gene: SLX4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.428 | SLX4 | Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.427 | SLX4 |
Zornitza Stark gene: SLX4 was added gene: SLX4 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: SLX4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLX4 were set to Fanconi anemia, complementation group P, MIM#613951 Review for gene: SLX4 was set to GREEN Added comment: Established gene-disease association, microcephaly is part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.426 | SLC2A1 | Zornitza Stark Marked gene: SLC2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.426 | SLC2A1 | Zornitza Stark Gene: slc2a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.426 | SLC2A1 | Zornitza Stark Phenotypes for gene: SLC2A1 were changed from to GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.425 | SLC2A1 | Zornitza Stark Mode of inheritance for gene: SLC2A1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.424 | SLC2A1 | Zornitza Stark reviewed gene: SLC2A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.424 | SLC1A4 | Zornitza Stark Marked gene: SLC1A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.424 | SLC1A4 | Zornitza Stark Gene: slc1a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.424 | SLC1A4 | Zornitza Stark Phenotypes for gene: SLC1A4 were changed from to Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | SLC1A4 | Zornitza Stark reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.423 | SLC1A4 | Zornitza Stark Publications for gene: SLC1A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.422 | SLC1A4 | Zornitza Stark Tag founder tag was added to gene: SLC1A4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.422 | SLC1A4 | Zornitza Stark Mode of inheritance for gene: SLC1A4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | SLC1A4 | Zornitza Stark reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | RUSC2 | Zornitza Stark reviewed gene: RUSC2: Rating: AMBER; Mode of pathogenicity: None; Publications: 27612186; Phenotypes: Mental retardation, autosomal recessive 61, MIM# 617773; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | RPL10 | Zornitza Stark Marked gene: RPL10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | RPL10 | Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4187 | RPL10 | Zornitza Stark Phenotypes for gene: RPL10 were changed from to Mental retardation, X-linked, syndromic, 35, MIM# 300998 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4186 | RPL10 | Zornitza Stark Publications for gene: RPL10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4185 | RPL10 | Zornitza Stark Mode of inheritance for gene: RPL10 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4184 | RPL10 | Zornitza Stark reviewed gene: RPL10: Rating: GREEN; Mode of pathogenicity: None; Publications: 25316788, 25846674, 26290468; Phenotypes: Mental retardation, X-linked, syndromic, 35, MIM# 300998; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | RPL10 | Zornitza Stark Marked gene: RPL10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | RPL10 | Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | RPL10 | Zornitza Stark Classified gene: RPL10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.421 | RPL10 | Zornitza Stark Gene: rpl10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.420 | RPL10 |
Zornitza Stark gene: RPL10 was added gene: RPL10 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: RPL10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: RPL10 were set to 25316788; 25846674; 26290468 Phenotypes for gene: RPL10 were set to Mental retardation, X-linked, syndromic, 35, MIM# 300998 Review for gene: RPL10 was set to GREEN Added comment: At least three families reported. Progressive microcephaly, up to -9.6 SD described. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.419 | RNU4ATAC | Zornitza Stark Marked gene: RNU4ATAC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.419 | RNU4ATAC | Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.419 | RNU4ATAC | Zornitza Stark Classified gene: RNU4ATAC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.419 | RNU4ATAC | Zornitza Stark Gene: rnu4atac has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.418 | RNU4ATAC |
Zornitza Stark gene: RNU4ATAC was added gene: RNU4ATAC was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: RNU4ATAC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNU4ATAC were set to 21474760; 20301772 Phenotypes for gene: RNU4ATAC were set to Microcephalic osteodysplastic primordial dwarfism, type I, MIM# 210710 Review for gene: RNU4ATAC was set to GREEN Added comment: Established gene-disease association Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4184 | IFT122 | Zornitza Stark Marked gene: IFT122 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4184 | IFT122 | Zornitza Stark Gene: ift122 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4184 | IFT122 | Zornitza Stark Phenotypes for gene: IFT122 were changed from to Cranioectodermal dysplasia 1, MIM# MIM#218330 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4183 | IFT122 | Zornitza Stark Publications for gene: IFT122 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4182 | IFT122 | Zornitza Stark Mode of inheritance for gene: IFT122 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4181 | IFT122 | Zornitza Stark reviewed gene: IFT122: Rating: GREEN; Mode of pathogenicity: None; Publications: 26792575, 28370949, 29037998; Phenotypes: Cranioectodermal dysplasia 1, MIM# MIM#218330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.42 | JAK1 | Zornitza Stark Phenotypes for gene: JAK1 were changed from Susceptibility to mycobacteria and viruses to Susceptibility to mycobacteria and viruses; Viral infections; Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Defects of intrinsic and innate immunity v0.41 | JAK1 | Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Susceptibility to mycobacteria and viruses, Viral infections, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.62 | JAK1 | Zornitza Stark Phenotypes for gene: JAK1 were changed from Eosinophilia; Eosinophilic enteritis; Thyroid disease; Poor growth; Viral infections to Eosinophilia; Eosinophilic enteritis; Thyroid disease; Poor growth; Viral infections; Viral infections; Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Disorders of immune dysregulation v0.61 | JAK1 | Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Eosinophilia, Eosinophilic enteritis, Thyroid disease, Poor growth, Viral infections, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4181 | JAK1 | Zornitza Stark edited their review of gene: JAK1: Changed phenotypes: Eosinophilia, Eosinophilic enteritis, Thyroid disease, Poor growth, Viral infections, Susceptibility to mycobacteria and viruses, Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4181 | RC3H1 | Zornitza Stark Phenotypes for gene: RC3H1 were changed from Relapsing HLH to Relapsing HLH; Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4180 | RC3H1 | Zornitza Stark edited their review of gene: RC3H1: Changed phenotypes: Relapsing HLH, Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.94 | RC3H1 | Zornitza Stark Phenotypes for gene: RC3H1 were changed from Relapsing HLH to Relapsing HLH; Hemophagocytic lymphohistiocytosis, familial, 6, MIM# 618998 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.93 | RC3H1 | Zornitza Stark edited their review of gene: RC3H1: Changed phenotypes: Relapsing HLH, Hemophagocytic lymphohistiocytosis, familial, 6 618998 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4180 | KIAA0319 | Zornitza Stark Marked gene: KIAA0319 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4180 | KIAA0319 | Zornitza Stark Gene: kiaa0319 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4180 | KIAA0319 | Zornitza Stark Phenotypes for gene: KIAA0319 were changed from to {Dyslexia, susceptibility to, 2}, MIM#600202 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4179 | KIAA0319 | Zornitza Stark Classified gene: KIAA0319 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4179 | KIAA0319 | Zornitza Stark Gene: kiaa0319 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4178 | RARS2 | Zornitza Stark Marked gene: RARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4178 | RARS2 | Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4178 | RARS2 | Zornitza Stark Phenotypes for gene: RARS2 were changed from Pontocerebellar hypoplasia, type 6, MIM# 611523 to Pontocerebellar hypoplasia, type 6, MIM# 611523; early onset cerebellar ataxia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4177 | RARS2 | Zornitza Stark Publications for gene: RARS2 were set to 17847012; 25809939; 20635367 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4176 | RARS2 | Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4175 | RARS2 | Zornitza Stark Publications for gene: RARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4174 | RARS2 | Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4173 | RARS2 | Zornitza Stark edited their review of gene: RARS2: Changed rating: GREEN; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.417 | RARS2 | Zornitza Stark Marked gene: RARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.417 | RARS2 | Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.417 | RARS2 | Zornitza Stark Phenotypes for gene: RARS2 were changed from to Pontocerebellar hypoplasia, type 6, MIM# 611523 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.416 | RARS2 | Zornitza Stark Publications for gene: RARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.415 | RARS2 | Zornitza Stark Mode of inheritance for gene: RARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.414 | RARS2 | Zornitza Stark reviewed gene: RARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 17847012, 20635367, 25809939; Phenotypes: Pontocerebellar hypoplasia, type 6, MIM# 611523; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4173 | RAD21 | Zornitza Stark Mode of inheritance for gene: RAD21 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4172 | KIAA0319 | Naomi Baker reviewed gene: KIAA0319: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: {Dyslexia, susceptibility to, 2}, MIM#600202; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.414 | RAD21 | Zornitza Stark Marked gene: RAD21 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.414 | RAD21 | Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.414 | RAD21 | Zornitza Stark Classified gene: RAD21 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.414 | RAD21 | Zornitza Stark Gene: rad21 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.413 | RAD21 |
Zornitza Stark gene: RAD21 was added gene: RAD21 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: RAD21 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: RAD21 were set to 22633399; 32193685 Phenotypes for gene: RAD21 were set to Cornelia de Lange syndrome 4, MIM# 614701 Review for gene: RAD21 was set to GREEN Added comment: Microcephaly reported in around 50% of affected individuals in a recent large series. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4172 | RAB3GAP2 | Zornitza Stark Marked gene: RAB3GAP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4172 | RAB3GAP2 | Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4172 | RAB3GAP2 | Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2, MIM# 614225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4171 | RAB3GAP2 | Zornitza Stark Publications for gene: RAB3GAP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4170 | RAB3GAP2 | Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.412 | RAB3GAP2 | Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2, MIM# 614225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4169 | RAB3GAP2 | Zornitza Stark reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 20967465; Phenotypes: Warburg micro syndrome 2, MIM# 614225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.411 | RAB3GAP2 | Zornitza Stark Publications for gene: RAB3GAP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.410 | RAB3GAP2 | Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.409 | RAB3GAP2 | Zornitza Stark reviewed gene: RAB3GAP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23420520, 20967465; Phenotypes: Warburg micro syndrome 2, MIM# 614225; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4169 | RAB3GAP1 | Zornitza Stark Marked gene: RAB3GAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4169 | RAB3GAP1 | Zornitza Stark Gene: rab3gap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4169 | RAB3GAP1 | Zornitza Stark Phenotypes for gene: RAB3GAP1 were changed from to Warburg micro syndrome 1, MIM# 600118 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4168 | RAB3GAP1 | Zornitza Stark Publications for gene: RAB3GAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4167 | RAB3GAP1 | Zornitza Stark Mode of inheritance for gene: RAB3GAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4166 | RAB3GAP1 | Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520; Phenotypes: Warburg micro syndrome 1, MIM# 600118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.409 | RAB3GAP1 | Zornitza Stark Marked gene: RAB3GAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.409 | RAB3GAP1 | Zornitza Stark Gene: rab3gap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.409 | RAB3GAP1 | Zornitza Stark Phenotypes for gene: RAB3GAP1 were changed from to Warburg micro syndrome 1, MIM# 600118 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.408 | RAB3GAP1 | Zornitza Stark Publications for gene: RAB3GAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.407 | RAB3GAP1 | Zornitza Stark Mode of inheritance for gene: RAB3GAP1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.406 | RAB3GAP1 | Zornitza Stark reviewed gene: RAB3GAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15696165, 20512159, 23420520; Phenotypes: Warburg micro syndrome 1, MIM# 600118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.230 | RAB18 | Zornitza Stark Tag founder tag was added to gene: RAB18. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.230 | RAB18 | Zornitza Stark Marked gene: RAB18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.230 | RAB18 | Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.230 | RAB18 | Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.229 | RAB18 | Zornitza Stark Publications for gene: RAB18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.228 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cataract v0.227 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.69 | RAB18 | Zornitza Stark Tag founder tag was added to gene: RAB18. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.69 | RAB18 | Zornitza Stark Marked gene: RAB18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.69 | RAB18 | Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.69 | RAB18 | Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.68 | RAB18 | Zornitza Stark Publications for gene: RAB18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.67 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.66 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4166 | RAB18 | Zornitza Stark Tag founder tag was added to gene: RAB18. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4166 | RAB18 | Zornitza Stark Marked gene: RAB18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4166 | RAB18 | Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4166 | RAB18 | Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4165 | RAB18 | Zornitza Stark Publications for gene: RAB18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4164 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4163 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.406 | RAB18 | Zornitza Stark Marked gene: RAB18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.406 | RAB18 | Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.406 | RAB18 | Zornitza Stark Phenotypes for gene: RAB18 were changed from to Warburg micro syndrome 3, MIM# 614222 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.405 | RAB18 | Zornitza Stark Tag founder tag was added to gene: RAB18. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.405 | RAB18 | Zornitza Stark Publications for gene: RAB18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.404 | RAB18 | Zornitza Stark Mode of inheritance for gene: RAB18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.403 | RAB18 | Zornitza Stark reviewed gene: RAB18: Rating: GREEN; Mode of pathogenicity: None; Publications: 11237903, 23420520; Phenotypes: Warburg micro syndrome 3, MIM# 614222; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.11 | PTPN23 |
Zornitza Stark gene: PTPN23 was added gene: PTPN23 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list Mode of inheritance for gene: PTPN23 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PTPN23 were set to 31395947; 29899372; 29090338; 27848944; 25558065 Phenotypes for gene: PTPN23 were set to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890 Review for gene: PTPN23 was set to GREEN Added comment: Over 10 families reported with an autosomal recessive neurologic disorder characterised by global developmental delay apparent from early infancy, poor overall growth often with microcephaly (6/10), impaired intellectual development with delayed or absent speech, axial hypotonia, and peripheral spasticity. Additional common but variable features include early-onset seizures, optic atrophy with poor visual fixation, and dysmorphic facial features. Brain imaging shows cerebral atrophy, poor or absent myelination with loss of white matter volume, and often hypoplasia of the corpus callosum and/or cerebellum. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mackenzie's Mission_Reproductive Carrier Screening v0.10 | PUS7 |
Zornitza Stark gene: PUS7 was added gene: PUS7 was added to Mackenzie's Mission_Reproductive Carrier Screening. Sources: Expert list Mode of inheritance for gene: PUS7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PUS7 were set to 30526862; 30778726; 31583274 Phenotypes for gene: PUS7 were set to Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature; OMIM #618342 Review for gene: PUS7 was set to GREEN Added comment: 11 individuals from 6 families with ID, speech delay, short stature, microcephaly, and aggressive behavior, with homozygous PUS7 mutations, which segregated with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.403 | PUS7 | Zornitza Stark edited their review of gene: PUS7: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.403 | PUF60 | Zornitza Stark Marked gene: PUF60 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.403 | PUF60 | Zornitza Stark Gene: puf60 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.403 | PUF60 | Zornitza Stark Phenotypes for gene: PUF60 were changed from to Verheij syndrome, MIM# 615583 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.402 | PUF60 | Zornitza Stark Publications for gene: PUF60 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.401 | PUF60 | Zornitza Stark Mode of inheritance for gene: PUF60 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.400 | PUF60 | Zornitza Stark reviewed gene: PUF60: Rating: GREEN; Mode of pathogenicity: None; Publications: 28327570; Phenotypes: Verheij syndrome, MIM# 615583; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | COL9A1 | Teresa Zhao Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | COL9A1 | Teresa Zhao reviewed gene: COL9A1: Rating: AMBER; Mode of pathogenicity: None; Publications: 16909383, 2142186, 11565064; Phenotypes: Stickler syndrome, type IV (MIM#614134) AR, ?Multiple epiphyseal dysplasia 6 (MIM#614135) AD; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4163 | PTPN23 | Zornitza Stark Marked gene: PTPN23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4163 | PTPN23 | Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4163 | PTPN23 | Zornitza Stark Phenotypes for gene: PTPN23 were changed from to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4162 | PTPN23 | Zornitza Stark Publications for gene: PTPN23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4161 | PTPN23 | Zornitza Stark Mode of inheritance for gene: PTPN23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4160 | PTPN23 | Zornitza Stark reviewed gene: PTPN23: Rating: GREEN; Mode of pathogenicity: None; Publications: 31395947, 29899372, 29090338, 27848944, 25558065; Phenotypes: Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.400 | PTPN23 | Zornitza Stark Marked gene: PTPN23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.400 | PTPN23 | Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.400 | PTPN23 | Zornitza Stark Phenotypes for gene: PTPN23 were changed from to Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.399 | PTPN23 | Zornitza Stark Publications for gene: PTPN23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.398 | PTPN23 | Zornitza Stark Mode of inheritance for gene: PTPN23 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.397 | PTPN23 | Zornitza Stark reviewed gene: PTPN23: Rating: GREEN; Mode of pathogenicity: None; Publications: 31395947, 29899372, 29090338, 27848944, 25558065; Phenotypes: Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4160 | PRUNE1 | Zornitza Stark Marked gene: PRUNE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4160 | PRUNE1 | Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4160 | PRUNE1 | Zornitza Stark Phenotypes for gene: PRUNE1 were changed from to Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4159 | PRUNE1 | Zornitza Stark Publications for gene: PRUNE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4158 | PRUNE1 | Zornitza Stark Mode of inheritance for gene: PRUNE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4157 | PRUNE1 | Zornitza Stark reviewed gene: PRUNE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 26539891, 28334956; Phenotypes: Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.397 | PRUNE1 | Zornitza Stark Marked gene: PRUNE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.397 | PRUNE1 | Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.397 | PRUNE1 | Zornitza Stark Classified gene: PRUNE1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.397 | PRUNE1 | Zornitza Stark Gene: prune1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.396 | PRUNE1 |
Zornitza Stark gene: PRUNE1 was added gene: PRUNE1 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: PRUNE1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PRUNE1 were set to 26539891; 28334956 Phenotypes for gene: PRUNE1 were set to Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481 Review for gene: PRUNE1 was set to GREEN Added comment: 8 unrelated families reported with an autosomal recessive neurodevelopmental, and neurodegenerative disorder characterised by global developmental delay apparent from infancy and profound intellectual disability. Affected individuals have microcephaly with accompanying dysmorphic features, truncal hypotonia, peripheral spasticity, and lack of independent ambulation or speech acquisition. Brain imaging shows variable abnormalities, including cortical atrophy, thin corpus callosum, cerebellar hypoplasia, and delayed myelination Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.395 | PPP1R15B | Zornitza Stark Marked gene: PPP1R15B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.395 | PPP1R15B | Zornitza Stark Gene: ppp1r15b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.395 | PPP1R15B | Zornitza Stark Phenotypes for gene: PPP1R15B were changed from to Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.394 | PPP1R15B | Zornitza Stark Publications for gene: PPP1R15B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.393 | PPP1R15B | Zornitza Stark Mode of inheritance for gene: PPP1R15B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.392 | PPP1R15B | Zornitza Stark Classified gene: PPP1R15B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.392 | PPP1R15B | Zornitza Stark Gene: ppp1r15b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.391 | PPP1R15B | Zornitza Stark reviewed gene: PPP1R15B: Rating: AMBER; Mode of pathogenicity: None; Publications: 26159176, 26307080, 27640355; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.391 | POMT1 | Zornitza Stark Marked gene: POMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.391 | POMT1 | Zornitza Stark Gene: pomt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.391 | POMT1 | Zornitza Stark Phenotypes for gene: POMT1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.390 | POMT1 | Zornitza Stark Mode of inheritance for gene: POMT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.389 | POMT1 | Zornitza Stark reviewed gene: POMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4157 | POGZ | Zornitza Stark Marked gene: POGZ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4157 | POGZ | Zornitza Stark Gene: pogz has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4157 | POGZ | Zornitza Stark Phenotypes for gene: POGZ were changed from to White-Sutton syndrome, MIM# 616364 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4156 | POGZ | Zornitza Stark Publications for gene: POGZ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4155 | POGZ | Zornitza Stark Mode of inheritance for gene: POGZ was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4154 | POGZ | Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 26942287, 26739615; Phenotypes: White-Sutton syndrome, MIM# 616364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.389 | POGZ | Zornitza Stark Marked gene: POGZ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.389 | POGZ | Zornitza Stark Gene: pogz has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.389 | POGZ | Zornitza Stark Phenotypes for gene: POGZ were changed from to White-Sutton syndrome, MIM# 616364 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.388 | POGZ | Zornitza Stark Publications for gene: POGZ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.387 | POGZ | Zornitza Stark Mode of inheritance for gene: POGZ was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.386 | POGZ | Zornitza Stark reviewed gene: POGZ: Rating: GREEN; Mode of pathogenicity: None; Publications: 26942287; Phenotypes: White-Sutton syndrome, MIM# 616364; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4154 | POC1A | Zornitza Stark Marked gene: POC1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4154 | POC1A | Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4154 | POC1A | Zornitza Stark Phenotypes for gene: POC1A were changed from to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4153 | POC1A | Zornitza Stark Publications for gene: POC1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4152 | POC1A | Zornitza Stark Mode of inheritance for gene: POC1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4151 | POC1A | Zornitza Stark reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22840364, 22840363, 26374189, 26162852, 26791357; Phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.386 | POC1A | Zornitza Stark Marked gene: POC1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.386 | POC1A | Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.386 | POC1A | Zornitza Stark Phenotypes for gene: POC1A were changed from to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.385 | POC1A | Zornitza Stark Classified gene: POC1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.385 | POC1A | Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.384 | POC1A | Zornitza Stark edited their review of gene: POC1A: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.384 | POC1A | Zornitza Stark edited their review of gene: POC1A: Changed phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.384 | POC1A |
Zornitza Stark gene: POC1A was added gene: POC1A was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: POC1A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POC1A were set to 22840364; 22840363; 26374189; 26162852; 26791357 Added comment: SOFT syndrome is characterized by severely short long bones, peculiar facies associated with paucity of hair, and nail anomalies. Growth retardation is evident on prenatal ultrasound as early as the second trimester of pregnancy, and affected individuals reach a final stature consistent with a height age of 6 years to 8 years. Relative macrocephaly is present during early childhood but head circumference is markedly low by adulthood. Over 5 unrelated families reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2943 | PLK4 | Zornitza Stark Marked gene: PLK4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2943 | PLK4 | Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2943 | PLK4 | Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2942 | PLK4 | Zornitza Stark Publications for gene: PLK4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2941 | PLK4 | Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2940 | PLK4 | Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.75 | PLK4 | Zornitza Stark Marked gene: PLK4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.75 | PLK4 | Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.75 | PLK4 | Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.74 | PLK4 | Zornitza Stark Publications for gene: PLK4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.73 | PLK4 | Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.72 | PLK4 | Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4151 | PLK4 | Zornitza Stark Marked gene: PLK4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4151 | PLK4 | Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4151 | PLK4 | Zornitza Stark Phenotypes for gene: PLK4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4150 | PLK4 | Zornitza Stark Publications for gene: PLK4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4149 | PLK4 | Zornitza Stark Mode of inheritance for gene: PLK4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4148 | PLK4 | Zornitza Stark reviewed gene: PLK4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25344692, 25320347, 27650967; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.383 | PLK4 | Zornitza Stark Marked gene: PLK4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.383 | PLK4 | Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.383 | PLK4 | Zornitza Stark Classified gene: PLK4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.383 | PLK4 | Zornitza Stark Gene: plk4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.382 | PLK4 |
Zornitza Stark gene: PLK4 was added gene: PLK4 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: PLK4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLK4 were set to 25344692; 25320347; 27650967 Phenotypes for gene: PLK4 were set to Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171 Review for gene: PLK4 was set to GREEN Added comment: At least 3 unrelated families reported with autosomal recessive developmental disorder characterised by delayed psychomotor development, visual impairment, and microcephaly. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4148 | PIGH | Zornitza Stark Marked gene: PIGH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4148 | PIGH | Zornitza Stark Gene: pigh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4148 | PIGH | Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4147 | PIGH | Zornitza Stark Publications for gene: PIGH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4146 | PIGH | Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4145 | PIGH | Zornitza Stark reviewed gene: PIGH: Rating: GREEN; Mode of pathogenicity: None; Publications: 29573052, 29603516; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.381 | PIGH | Zornitza Stark Marked gene: PIGH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.381 | PIGH | Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.381 | PIGH | Zornitza Stark Phenotypes for gene: PIGH were changed from to Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.380 | PIGH | Zornitza Stark Publications for gene: PIGH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.379 | PIGH | Zornitza Stark Mode of inheritance for gene: PIGH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.378 | PIGH | Zornitza Stark Classified gene: PIGH as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.378 | PIGH | Zornitza Stark Gene: pigh has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.377 | PIGH | Zornitza Stark reviewed gene: PIGH: Rating: AMBER; Mode of pathogenicity: None; Publications: 29573052; Phenotypes: Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.377 | PDHA1 | Zornitza Stark Marked gene: PDHA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.377 | PDHA1 | Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.377 | PDHA1 | Zornitza Stark Classified gene: PDHA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.377 | PDHA1 | Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.376 | PDHA1 |
Zornitza Stark gene: PDHA1 was added gene: PDHA1 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: PDHA1 were set to 8032855 Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase E1-alpha deficiency, MIM# 312170 Review for gene: PDHA1 was set to GREEN Added comment: Well established gene-disease association. Variable phenotype, but microcephaly is a feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.27 | PCYT2 | Zornitza Stark Marked gene: PCYT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.27 | PCYT2 | Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.27 | PCYT2 | Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.26 | PCYT2 | Zornitza Stark Publications for gene: PCYT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.25 | PCYT2 | Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.24 | PCYT2 | Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4145 | PCYT2 | Zornitza Stark Marked gene: PCYT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4145 | PCYT2 | Zornitza Stark Gene: pcyt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4145 | PCYT2 | Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770; global developmental delay; regression; spastic parapesis or tetraparesis; epilepsy; progressive cerebral and cerebellar atrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4144 | PCYT2 | Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | PCYT2 | Zornitza Stark reviewed gene: PCYT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.375 | PCYT2 | Zornitza Stark Marked gene: PCYT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.375 | PCYT2 | Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.375 | PCYT2 | Zornitza Stark Phenotypes for gene: PCYT2 were changed from to Spastic paraplegia 82, autosomal recessive 618770 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.374 | PCYT2 | Zornitza Stark Publications for gene: PCYT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.373 | PCYT2 | Zornitza Stark Mode of inheritance for gene: PCYT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.372 | PCYT2 | Zornitza Stark Classified gene: PCYT2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.372 | PCYT2 | Zornitza Stark Gene: pcyt2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.371 | PCYT2 | Zornitza Stark reviewed gene: PCYT2: Rating: RED; Mode of pathogenicity: None; Publications: 31637422; Phenotypes: Spastic paraplegia 82, autosomal recessive 618770; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v0.59 | TRAPPC2L | Zornitza Stark Tag founder tag was added to gene: TRAPPC2L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | TRAPPC2L | Zornitza Stark Tag founder tag was added to gene: TRAPPC2L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2940 | TRAPPC2L | Zornitza Stark Marked gene: TRAPPC2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2940 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2940 | TRAPPC2L | Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2940 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2939 | TRAPPC2L | Zornitza Stark Tag founder tag was added to gene: TRAPPC2L. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v0.59 | TRAPPC2L | Zornitza Stark Marked gene: TRAPPC2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v0.59 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Rhabdomyolysis and Metabolic Myopathy v0.59 | TRAPPC2L |
Zornitza Stark gene: TRAPPC2L was added gene: TRAPPC2L was added to Rhabdomyolysis RMH. Sources: Literature Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC2L were set to 30120216; 32843486 Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 Review for gene: TRAPPC2L was set to RED Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as rhabdomyolysis not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2939 | TRAPPC2L |
Zornitza Stark gene: TRAPPC2L was added gene: TRAPPC2L was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC2L were set to 30120216; 32843486 Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 Review for gene: TRAPPC2L was set to AMBER Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | TRAPPC2L | Zornitza Stark Marked gene: TRAPPC2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | TRAPPC2L |
Zornitza Stark changed review comment from: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Red on this panel as seizures not reported in all families. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | TRAPPC2L | Zornitza Stark edited their review of gene: TRAPPC2L: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.831 | TRAPPC2L |
Zornitza Stark gene: TRAPPC2L was added gene: TRAPPC2L was added to Genetic Epilepsy. Sources: Literature founder tags were added to gene: TRAPPC2L. Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC2L were set to 30120216; 32843486 Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 Review for gene: TRAPPC2L was set to AMBER Added comment: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | TRAPPC2L | Zornitza Stark Marked gene: TRAPPC2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | TRAPPC2L | Zornitza Stark Classified gene: TRAPPC2L as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4143 | TRAPPC2L | Zornitza Stark Gene: trappc2l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.75 | TIMM8A | Zornitza Stark Marked gene: TIMM8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.75 | TIMM8A | Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.75 | TIMM8A | Zornitza Stark Phenotypes for gene: TIMM8A were changed from Deafness-Dystonia-Optic Neuronopathy Syndrome to Deafness-Dystonia-Optic Neuronopathy Syndrome; Mohr-Tranebjaerg syndrome, MIM# 304700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.74 | TIMM8A | Zornitza Stark Publications for gene: TIMM8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.73 | TIMM8A | Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.72 | TIMM8A | Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4142 | TIMM8A | Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | TIMM8A | Zornitza Stark Marked gene: TIMM8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | TIMM8A | Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.386 | TIMM8A | Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.385 | TIMM8A | Zornitza Stark Publications for gene: TIMM8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.384 | TIMM8A | Zornitza Stark Mode of inheritance for gene: TIMM8A was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.383 | TIMM8A | Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816, 32820032; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4141 | TIMM8A | Zornitza Stark Marked gene: TIMM8A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4141 | TIMM8A | Zornitza Stark Gene: timm8a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4141 | TIMM8A | Zornitza Stark Phenotypes for gene: TIMM8A were changed from to Mohr-Tranebjaerg syndrome, MIM# 304700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4140 | TIMM8A | Zornitza Stark Publications for gene: TIMM8A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4139 | TIMM8A | Zornitza Stark reviewed gene: TIMM8A: Rating: GREEN; Mode of pathogenicity: None; Publications: 11803487, 11405816; Phenotypes: Mohr-Tranebjaerg syndrome, MIM# 304700; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.56 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.56 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.56 | TOGARAM1 |
Zornitza Stark gene: TOGARAM1 was added gene: TOGARAM1 was added to Hydrocephalus_Ventriculomegaly. Sources: Literature Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Review for gene: TOGARAM1 was set to RED Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v0.206 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v0.206 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v0.206 | TOGARAM1 |
Zornitza Stark gene: TOGARAM1 was added gene: TOGARAM1 was added to Ciliopathies. Sources: Literature Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Review for gene: TOGARAM1 was set to RED Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.66 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.66 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.371 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.371 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Anophthalmia_Microphthalmia_Coloboma v0.66 | TOGARAM1 |
Zornitza Stark gene: TOGARAM1 was added gene: TOGARAM1 was added to Anophthalmia_Microphthalmia_Coloboma. Sources: Literature Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Review for gene: TOGARAM1 was set to RED Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4139 | TOGARAM1 | Zornitza Stark Marked gene: TOGARAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4139 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.371 | TOGARAM1 |
Zornitza Stark gene: TOGARAM1 was added gene: TOGARAM1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Review for gene: TOGARAM1 was set to RED Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4139 | TOGARAM1 | Zornitza Stark Classified gene: TOGARAM1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4139 | TOGARAM1 | Zornitza Stark Gene: togaram1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2938 | DPP6 | Zornitza Stark Marked gene: DPP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2938 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2938 | DPP6 | Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2937 | DPP6 | Zornitza Stark Publications for gene: DPP6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2936 | DPP6 | Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2935 | DPP6 | Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2935 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | DPP6 | Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4138 | DPP6 | Zornitza Stark Marked gene: DPP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4138 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4138 | DPP6 | Zornitza Stark Phenotypes for gene: DPP6 were changed from to Mental retardation, autosomal dominant 33 (MIM#616311) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4137 | DPP6 | Zornitza Stark Publications for gene: DPP6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4136 | DPP6 | Zornitza Stark Mode of inheritance for gene: DPP6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4135 | DPP6 | Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4135 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | DPP6 | Zornitza Stark Tag SV/CNV tag was added to gene: DPP6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | DPP6 | Zornitza Stark reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark changed review comment from: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013.; to: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013. Association studies with dementia, and suggested role in tardive dyskinesia. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Marked gene: DPP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Added comment: Comment when marking as ready: Single LP variant in ClinVar but reported phenotype is schizophrenia. Original study dates to 2013. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Marked gene: DPP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Classified gene: DPP6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.370 | DPP6 | Zornitza Stark Gene: dpp6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.369 | DPP6 | Zornitza Stark Tag SV/CNV tag was added to gene: DPP6. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | TRAPPC2L |
Arina Puzriakova changed review comment from: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature; to: Total of three families, but two share a founder variant, and there are some disparities between the clinical presentations reported in the two publications. Rating Amber as additional cases required to delineate the genotype-phenotype relationship. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | TRAPPC2L |
Arina Puzriakova gene: TRAPPC2L was added gene: TRAPPC2L was added to Mendeliome. Sources: Literature Mode of inheritance for gene: TRAPPC2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRAPPC2L were set to 30120216; 32843486 Phenotypes for gene: TRAPPC2L were set to Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 Review for gene: TRAPPC2L was set to AMBER Added comment: Gene is associated with Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis in OMIM, but not in G2P. PMID: 30120216 (2018) - Two unrelated probands with an identical homozygous missense (c.109G>T, p.Asp37Tyr) variant in TRAPPC2L. Both individuals presented neurodevelopmental delay, febrile illness-induced encephalopathy, and episodic rhabdomyolysis, followed by developmental arrest, seizures and tetraplegia. The variant segregated with the phenotype in each family, and haplotype analysis suggested a founder effect. The mutant protein was expressed in patient fibroblasts, but displayed membrane trafficking delays. Studies in yeast showed that the variant impaired interaction with TRAPPC10, and increased levels of the active RAB11. PMID: 32843486 (2020) - In an Ashkenazi Jewish family with three affected sibs with GDD/ID, WGS revealed a segregating homozygous missense variant (c.5G>C, p.Ala2Gly) in the TRAPPC2L gene. No seizures, brain MRI abnormalities, or illness provoked regression were documented in this family. Comparable to the previous study, the variant resulted in delayed ER-to-Golgi trafficking and elevated levels of active RAB11. Studies using yeast and in vitro binding, showed that the variant disrupted interaction with another core TRAPP protein, TRAPPC6a. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | TIMM8A | Arina Puzriakova reviewed gene: TIMM8A: Rating: ; Mode of pathogenicity: None; Publications: 32820032; Phenotypes: ; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | TOGARAM1 |
Arina Puzriakova gene: TOGARAM1 was added gene: TOGARAM1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: TOGARAM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TOGARAM1 were set to 32747439 Phenotypes for gene: TOGARAM1 were set to Cleft of the lip and palate; Microphthalmia; Cerebral dysgenesis; Hydrocephalus Added comment: PMID: 32747439 (2020) - Novel gene-disease association. In two sibling fetuses with a malformation disorder characterised by microcephaly, severe cleft lip and palate, microphthalmia, and brain anomalies, WES revealed compound heterozygous variants ([c.1102C>T, p.Arg368Trp] and [c.3619C>T, p.Arg1207*]) in the TOGARAM1 gene. Functional analysis of the missense variant in a C. elegans model showed impaired lipophilic dye uptake, with shorter and altered cilia in sensory neurons. In vitro analysis revealed faster microtubule polymerisation compared to wild-type, suggesting aberrant tubulin binding. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | DPP6 | Ain Roesley edited their review of gene: DPP6: Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | DPP6 | Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | DPP6 | Ain Roesley reviewed gene: DPP6: Rating: AMBER; Mode of pathogenicity: None; Publications: 23832105; Phenotypes: Mental retardation, autosomal dominant 33 (MIM#616311); Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.369 | DPP6 |
Ain Roesley gene: DPP6 was added gene: DPP6 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: DPP6 were set to 23832105 Phenotypes for gene: DPP6 were set to Mental retardation, autosomal dominant 33 (MIM#616311) Penetrance for gene: DPP6 were set to unknown Review for gene: DPP6 was set to AMBER Added comment: PMID: 23832105 - 1x proband (OFC < -3 SD) with a missense which segregated in 3 other family members - 2x probands with 336kb deletion. Both OFCs < -3 SD - mouse KO model with significantly smaller brain weight *unable to find new reports since Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.369 | CTU2 | Zornitza Stark Marked gene: CTU2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.369 | CTU2 | Zornitza Stark Gene: ctu2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.369 | CTU2 | Zornitza Stark Phenotypes for gene: CTU2 were changed from to Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.368 | CTU2 | Zornitza Stark Publications for gene: CTU2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.367 | CTU2 | Zornitza Stark Mode of inheritance for gene: CTU2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | PCGF2 | Zornitza Stark Marked gene: PCGF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | PCGF2 | Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2934 | PCGF2 | Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2933 | PCGF2 | Zornitza Stark Publications for gene: PCGF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.366 | CTU2 | Ain Roesley reviewed gene: CTU2: Rating: GREEN; Mode of pathogenicity: None; Publications: 26633546; Phenotypes: Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome (MIM#618142); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2932 | PCGF2 | Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2931 | PCGF2 | Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | PCGF2 | Zornitza Stark Marked gene: PCGF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | PCGF2 | Zornitza Stark Gene: pcgf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4134 | PCGF2 | Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4133 | PCGF2 | Zornitza Stark Publications for gene: PCGF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4132 | PCGF2 | Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4131 | PCGF2 | Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.366 | PCGF2 | Zornitza Stark Marked gene: PCGF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.366 | PCGF2 | Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.366 | PCGF2 | Zornitza Stark Phenotypes for gene: PCGF2 were changed from to Turnpenny-Fry syndrome, MIM# 618371 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.365 | PCGF2 | Zornitza Stark Publications for gene: PCGF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.364 | PCGF2 | Zornitza Stark Mode of inheritance for gene: PCGF2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.363 | PCGF2 | Zornitza Stark Classified gene: PCGF2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.363 | PCGF2 | Zornitza Stark Gene: pcgf2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | PCGF2 | Zornitza Stark changed review comment from: developmental delay, impaired intellectual development, impaired growth, and recognizable facial features that include frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears. Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65; to: Key features include developmental delay, impaired intellectual development, impaired growth, and recognizable facial features (frontal bossing, sparse hair, malar hypoplasia, small palpebral fissures and oral stoma, and dysplastic 'satyr' ears). Other common findings include feeding problems, constipation, and a range of brain, cardiac, vascular, and skeletal malformations. Head size is variable, with some patients showing relative macrocephaly and others showing microcephaly. Over 10 affected individuals reported to date, all variants affect residue p.Pro65 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | PCGF2 | Zornitza Stark edited their review of gene: PCGF2: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | PCGF2 | Zornitza Stark reviewed gene: PCGF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30343942; Phenotypes: Turnpenny-Fry syndrome, MIM# 618371; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | CTNNB1 | Zornitza Stark Marked gene: CTNNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | CTNNB1 | Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | CTNNB1 | Zornitza Stark Classified gene: CTNNB1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.362 | CTNNB1 | Zornitza Stark Gene: ctnnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.361 | CTNNB1 |
Ain Roesley gene: CTNNB1 was added gene: CTNNB1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CTNNB1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CTNNB1 were set to 25326669; 32039639 Phenotypes for gene: CTNNB1 were set to Neurodevelopmental disorder with spastic diplegia and visual defects (MIM#615075); Exudative vitreoretinopathy 7 (MIM#617572) Penetrance for gene: CTNNB1 were set to unknown Review for gene: CTNNB1 was set to GREEN Added comment: PMID: 32039639; -1x proband with familial exudative vitreoretinopathy (FEVR) and microcephaly. Head circumference <1st centile PMID: 25326669 - 15 families with 16 affecteds. de novo PTVs - included 5 patients from published literature - 10 out of 20 presented with microcephaly, head circumference < -3 SD Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.361 | PCDH12 | Zornitza Stark Phenotypes for gene: PCDH12 were changed from DIENCEPHALIC-MESENCEPHALIC JUNCTION DYSPLASIA SYNDROME 1 to Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.360 | PCDH12 | Zornitza Stark Publications for gene: PCDH12 were set to 27164683; 22822038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.359 | PCDH12 | Zornitza Stark reviewed gene: PCDH12: Rating: GREEN; Mode of pathogenicity: None; Publications: 27164683, 30178464; Phenotypes: Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2931 | TRIT1 | Zornitza Stark Marked gene: TRIT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2931 | TRIT1 | Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2931 | TRIT1 | Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2930 | TRIT1 | Zornitza Stark Publications for gene: TRIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2929 | TRIT1 | Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2928 | TRIT1 | Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.478 | TRIT1 | Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.477 | TRIT1 | Zornitza Stark Publications for gene: TRIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.476 | TRIT1 | Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.475 | TRIT1 | Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4131 | TRIT1 | Zornitza Stark Marked gene: TRIT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4131 | TRIT1 | Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4131 | TRIT1 | Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35, MIM#617873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4130 | TRIT1 | Zornitza Stark Publications for gene: TRIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4129 | TRIT1 | Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4128 | TRIT1 | Zornitza Stark reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35, MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.359 | TRIT1 | Zornitza Stark Marked gene: TRIT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.359 | TRIT1 | Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.359 | TRIT1 | Zornitza Stark Phenotypes for gene: TRIT1 were changed from to Combined oxidative phosphorylation deficiency 35 MIM#617873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.358 | TRIT1 | Zornitza Stark Publications for gene: TRIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.357 | TRIT1 | Zornitza Stark Mode of inheritance for gene: TRIT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.356 | TRIT1 | Zornitza Stark Classified gene: TRIT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.356 | TRIT1 | Zornitza Stark Gene: trit1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.355 | TRIT1 | Paul De Fazio reviewed gene: TRIT1: Rating: AMBER; Mode of pathogenicity: None; Publications: 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35 MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.355 | CTCF | Zornitza Stark Marked gene: CTCF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.355 | CTCF | Zornitza Stark Gene: ctcf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.355 | CTCF | Zornitza Stark Phenotypes for gene: CTCF were changed from to Mental retardation, autosomal dominant 21 (MIM#615502) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.354 | CTCF | Zornitza Stark Publications for gene: CTCF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.353 | CTCF | Zornitza Stark Mode of inheritance for gene: CTCF was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | TBCD | Zornitza Stark Tag umccr was removed from gene: TBCD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.352 | TBCD | Zornitza Stark Marked gene: TBCD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.352 | TBCD | Zornitza Stark Gene: tbcd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.352 | TBCD | Zornitza Stark Phenotypes for gene: TBCD were changed from to Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.351 | TBCD | Zornitza Stark Publications for gene: TBCD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.350 | TBCD | Zornitza Stark Mode of inheritance for gene: TBCD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.349 | TBCD |
Zornitza Stark changed review comment from: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy. Sources: Expert Review; to: 15 children from 9 unrelated families with bi-allelic variants in this gene and a progressive neurodegenerative encephalopathy including progressive microcephaly. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.349 | TSEN15 | Zornitza Stark Marked gene: TSEN15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.349 | TSEN15 | Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.349 | TSEN15 | Zornitza Stark Classified gene: TSEN15 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.349 | TSEN15 | Zornitza Stark Gene: tsen15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.348 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.347 | TSEN2 | Zornitza Stark Marked gene: TSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.347 | TSEN2 | Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.347 | TSEN2 | Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B (MIM#612389) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.346 | TSEN2 | Zornitza Stark Publications for gene: TSEN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.345 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.344 | TSEN15 |
Paul De Fazio gene: TSEN15 was added gene: TSEN15 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: TSEN15 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TSEN15 were set to 27392077 Phenotypes for gene: TSEN15 were set to Pontocerebellar hypoplasia, type 2F MIM#617026 Review for gene: TSEN15 was set to GREEN gene: TSEN15 was marked as current diagnostic Added comment: PMID 27392077 Reports four individuals from three families with PCH type 2 and different homozygous missense variants, all had progressive microcephaly (between -3SD and -9.7SD). Functional studies indicated that all variants resulted in almost complete lack of in vitro tRNA cleavage activity. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.344 | TSEN2 | Zornitza Stark Classified gene: TSEN2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.344 | TSEN2 | Zornitza Stark Gene: tsen2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.343 | TSEN54 | Zornitza Stark Marked gene: TSEN54 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.343 | TSEN54 | Zornitza Stark Gene: tsen54 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.343 | TSEN54 | Zornitza Stark Phenotypes for gene: TSEN54 were changed from to Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.342 | TSEN54 | Zornitza Stark Publications for gene: TSEN54 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.341 | TSEN54 | Zornitza Stark Mode of inheritance for gene: TSEN54 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.340 | TUBB2B | Zornitza Stark Marked gene: TUBB2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.340 | TUBB2B | Zornitza Stark Gene: tubb2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.340 | TUBB2B | Zornitza Stark Phenotypes for gene: TUBB2B were changed from to Cortical dysplasia, complex, with other brain malformations 7 MIM#610031 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.339 | TUBB2B | Zornitza Stark Publications for gene: TUBB2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.338 | TUBB2B | Zornitza Stark Mode of inheritance for gene: TUBB2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.337 | COASY | Zornitza Stark Marked gene: COASY as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.337 | COASY | Zornitza Stark Gene: coasy has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.337 | COASY | Zornitza Stark Classified gene: COASY as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.337 | COASY | Zornitza Stark Gene: coasy has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.336 | VPS51 | Zornitza Stark Marked gene: VPS51 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.336 | VPS51 | Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.336 | VPS51 | Zornitza Stark Classified gene: VPS51 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.336 | VPS51 | Zornitza Stark Gene: vps51 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.335 | TSEN2 | Paul De Fazio reviewed gene: TSEN2: Rating: AMBER; Mode of pathogenicity: None; Publications: 23562994, 20952379, 27392077; Phenotypes: Pontocerebellar hypoplasia type 2B (MIM#612389); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4128 | CRIPT | Zornitza Stark Marked gene: CRIPT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4128 | CRIPT | Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4128 | CRIPT | Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4128 | CRIPT | Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.335 | CRIPT | Zornitza Stark Marked gene: CRIPT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.335 | CRIPT | Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.335 | CRIPT | Zornitza Stark Classified gene: CRIPT as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.335 | CRIPT | Zornitza Stark Gene: cript has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2928 | CREBBP | Zornitza Stark Marked gene: CREBBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2928 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2928 | CREBBP | Zornitza Stark Phenotypes for gene: CREBBP were changed from to Rubinstein-Taybi syndrome 1, MIM# 180849; Menke-Hennekam syndrome 1, MIM# 618332 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2927 | CREBBP | Zornitza Stark Publications for gene: CREBBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2926 | CREBBP | Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2925 | CREBBP | Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4127 | CREBBP | Zornitza Stark Publications for gene: CREBBP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4126 | CREBBP | Zornitza Stark Mode of inheritance for gene: CREBBP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | CREBBP | Zornitza Stark reviewed gene: CREBBP: Rating: GREEN; Mode of pathogenicity: None; Publications: 10699051, 17855048, 27311832, 29460469; Phenotypes: Rubinstein-Taybi syndrome 1, MIM# 180849, Menke-Hennekam syndrome 1, MIM# 618332; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.334 | CREBBP | Zornitza Stark Marked gene: CREBBP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.334 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.334 | CREBBP | Zornitza Stark Classified gene: CREBBP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.334 | CREBBP | Zornitza Stark Gene: crebbp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.333 | ERCC5 | Zornitza Stark Publications for gene: ERCC5 were set to 32052936 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.332 | ERCC5 | Zornitza Stark Publications for gene: ERCC5 were set to 32052936; 32052936 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.331 | ERCC5 | Zornitza Stark Marked gene: ERCC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.331 | ERCC5 | Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.331 | ERCC5 | Zornitza Stark Classified gene: ERCC5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.331 | ERCC5 | Zornitza Stark Gene: ercc5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.330 | TTC5 | Zornitza Stark Marked gene: TTC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.330 | TTC5 | Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.330 | TTC5 | Zornitza Stark Classified gene: TTC5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.330 | TTC5 | Zornitza Stark Gene: ttc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.329 | CKAP2L | Zornitza Stark Marked gene: CKAP2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.329 | CKAP2L | Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.329 | CKAP2L | Zornitza Stark Classified gene: CKAP2L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.329 | CKAP2L | Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | TSEN54 | Paul De Fazio reviewed gene: TSEN54: Rating: GREEN; Mode of pathogenicity: None; Publications: 20952379, 20301773; Phenotypes: Pontocerebellar hypoplasia type 2A (MIM#277470) and type 4 (MIM#225753); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | TTC5 |
Paul De Fazio gene: TTC5 was added gene: TTC5 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: TTC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTC5 were set to 29302074; 32439809 Phenotypes for gene: TTC5 were set to Intellectual disability; microcephaly Review for gene: TTC5 was set to GREEN gene: TTC5 was marked as current diagnostic Added comment: PMID 29302074: 3 affected individuals from 2 consaguinous families described. All had head circumference < -3SD PMID 32439809: Report another 8 affected individuals from 5 families but only 3 individuals from 2 families were microcephalic (OFCs 31cm (unsure age), 32cm (12yo), 31cm (5yo)). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | CTCF | Ain Roesley reviewed gene: CTCF: Rating: GREEN; Mode of pathogenicity: None; Publications: 23746550, 30893510, 28619046; Phenotypes: Mental retardation, autosomal dominant 21 (MIM#615502); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | CRIPT |
Ain Roesley gene: CRIPT was added gene: CRIPT was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRIPT were set to 24389050; 27250922 Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789) Penetrance for gene: CRIPT were set to unknown Review for gene: CRIPT was set to AMBER Added comment: PMID: 24389050 - 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced PMID: 27250922 - 1x proband - het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited *did not find new reports since Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | CRIPT |
Ain Roesley gene: CRIPT was added gene: CRIPT was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CRIPT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CRIPT were set to 24389050; 27250922 Phenotypes for gene: CRIPT were set to Short stature with microcephaly and distinctive facies (MIM#615789) Penetrance for gene: CRIPT were set to unknown Review for gene: CRIPT was set to AMBER Added comment: PMID: 24389050 - 2 unrelated probands homozygous for PTVs. However 1 was deceased and DNA was unavailable therefore parents were sequenced - OFCs -2.5 and -2.7SD PMID: 27250922 - 1x proband with a head circumference of Z= -2.7. - het for a missense which was maternally inherited. Because the father was negative for SNVs, they did CMA and found a small heterozygous deletion 1.6kb in size encompassing exon 1 of CRIPT. This deletion was paternally inherited *did not find new reports since Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | CREBBP |
Ain Roesley gene: CREBBP was added gene: CREBBP was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CREBBP were set to 27311832; 29460469; 24989455 Phenotypes for gene: CREBBP were set to Menke-Hennekam syndrome 1(MIM#618332); Rubinstein-Taybi syndrome 1(MIM#180849) Penetrance for gene: CREBBP were set to unknown Review for gene: CREBBP was set to GREEN Added comment: Microcephaly is a feature of both syndromes (OMIM, GeneReviews) Variants causing Menke-Hennekam syndrome occur in 3' end of exon 30 and 5' end of exon 31 and are de novo missense versus Rubinstein-Taybi which are LoF variants. PMID: 27311832 7 out of 11 Menke-Hennekam probands with microcephaly (<3rd centile) PMID: 29460469 13 new Menke-Hennekam probands with 3 having OFCs of <-3 SD PMID: 24989455 provides growth charts of 92 molecularly diagnosed Rubinstein-Taybi patients. Mean of -1.89 SD for males and -2.71 SD for females Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.328 | COASY |
Seb Lunke gene: COASY was added gene: COASY was added to Microcephaly. Sources: Literature Mode of inheritance for gene: COASY was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: COASY were set to 30089828; 28489334 Phenotypes for gene: COASY were set to Pontocerebellar hypoplasia, type 12, MIM#618266 Review for gene: COASY was set to GREEN Added comment: 6 patients from 3 families published with microcephaly. One paper (2018, 30089828) describes two families, one consanguineous with hom splice region variant c.1486-3 C>G, the other family with a compound heterozygous c.[1549_1550delAG]; [1486-3 C>G] genotype. An earlier paper (2017, 28489334) describes an additional family with two affected siblings compound het c.1495C > T; p.(R499C) and c.C641T; p(A214V) variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | CLTC | Ain Roesley reviewed gene: CLTC: Rating: AMBER; Mode of pathogenicity: None; Publications: 31776469; Phenotypes: Mental retardation, autosomal dominant 56 (MIM#617854); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | ERCC5 |
Paul De Fazio gene: ERCC5 was added gene: ERCC5 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC5 were set to 32052936; 32052936 Phenotypes for gene: ERCC5 were set to Cerebrooculofacioskeletal syndrome 3 MIM#616570 Review for gene: ERCC5 was set to AMBER gene: ERCC5 was marked as current diagnostic Added comment: PMID 9096355 identified a homozygous LoF variant in a boy with microcephaly but this publication was later retracted over data in Figure 6. PMID 24700531 describes 4 fetuses from a large consanguineous Pakistani kindred with a homozygous LoF variant. All were said to be microcephalic with no measurements given. PMID 32052936 describes another 3 microcephalic fetuses from 2 families with homozygous LoF variants, again no measurements given. 3 families described in total but head circumference measurements of affected fetuses not provided so rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.383 | DIAPH1 | Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 24781755, 27707755, 27808407, 28003573, 28815995; Phenotypes: Deafness, autosomal dominant 1, with or without thrombocytopenia 124900; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | ERCC8 | Seb Lunke Marked gene: ERCC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | ERCC8 | Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | ERCC8 | Seb Lunke Classified gene: ERCC8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.327 | ERCC8 | Seb Lunke Gene: ercc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.326 | DIAPH1 | Seb Lunke Marked gene: DIAPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.326 | DIAPH1 | Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.326 | DIAPH1 | Seb Lunke Classified gene: DIAPH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.326 | DIAPH1 | Seb Lunke Gene: diaph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | ERCC8 |
Belinda Chong gene: ERCC8 was added gene: ERCC8 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ERCC8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC8 were set to 14661080; 21108394 Phenotypes for gene: ERCC8 were set to Cockayne syndrome, type A, MIM# 216400 Review for gene: ERCC8 was set to GREEN gene: ERCC8 was marked as current diagnostic Added comment: Well established gene-disease association, with microcephaly a reported feature. (https://www.ncbi.nlm.nih.gov/books/NBK1342/) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | DIAPH1 |
Dean Phelan gene: DIAPH1 was added gene: DIAPH1 was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: DIAPH1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DIAPH1 were set to PMID: 24781755; 26463574 Phenotypes for gene: DIAPH1 were set to Seizures, cortical blindness, microcephaly syndrome 616632 Review for gene: DIAPH1 was set to GREEN Added comment: PMID: 24781755 (2015) - five individuals from a consanguineous family with severe microcephaly >2SD below the mean for age with homozygous nonsense variant in DIAPH1 PMID: 26463574 (2016) - two different homozygous LOF variants identified in two unrelated consanguineous families. The affected individuals were diagnosed with postnatal microcephaly (>2SD), early-onset epilepsy, severe vision impairment, and pulmonary symptoms including bronchiectasis and recurrent respiratory infections. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | ERCC6 | Seb Lunke Marked gene: ERCC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | ERCC6 | Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | ERCC6 | Seb Lunke Classified gene: ERCC6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.325 | ERCC6 | Seb Lunke Gene: ercc6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | ERCC4 | Seb Lunke Marked gene: ERCC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | ERCC4 | Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | ERCC6 |
Naomi Baker gene: ERCC6 was added gene: ERCC6 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ERCC6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ERCC6 were set to PMID: 20301516 Phenotypes for gene: ERCC6 were set to Cockayne syndrome, type B, MIM#133540; Cerebrooculofacioskeletal syndrome 1, MIM#214150; De Sanctis-Cacchione syndrome, MIM#278800 Penetrance for gene: ERCC6 were set to Complete Review for gene: ERCC6 was set to GREEN Added comment: Well established gene-disease association, with microcephaly a reported feature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | CKAP2L | Zornitza Stark Classified gene: CKAP2L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | CKAP2L | Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | FANCF | Zornitza Stark Marked gene: FANCF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | FANCF | Zornitza Stark Gene: fancf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | ERCC4 | Seb Lunke Classified gene: ERCC4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.324 | ERCC4 | Seb Lunke Gene: ercc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | BRIP1 | Zornitza Stark Marked gene: BRIP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | BRIP1 | Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | FANCD2 | Seb Lunke Marked gene: FANCD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | FANCD2 | Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | FANCD2 | Seb Lunke Classified gene: FANCD2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | FANCD2 | Seb Lunke Gene: fancd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.323 | BRIP1 | Zornitza Stark Publications for gene: BRIP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.322 | BRIP1 | Zornitza Stark Classified gene: BRIP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.322 | BRIP1 | Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.321 | FANCD2 |
Dean Phelan gene: FANCD2 was added gene: FANCD2 was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCD2 were set to PMID:20301575 Phenotypes for gene: FANCD2 were set to Fanconi anemia 227646 Review for gene: FANCD2 was set to GREEN Added comment: Well established gene-disease association, microcephaly is a key feature. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.321 | FANCG | Seb Lunke Marked gene: FANCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.321 | FANCG | Seb Lunke Gene: fancg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.321 | FANCG | Seb Lunke Classified gene: FANCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.321 | FANCG | Seb Lunke Gene: fancg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.320 | FANCF | Zornitza Stark Classified gene: FANCF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.320 | FANCF | Zornitza Stark Gene: fancf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.319 | ERCC4 |
Ain Roesley gene: ERCC4 was added gene: ERCC4 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC4 were set to Fanconi anemia, complementation group Q (MIM#615272); Cockayne syndrome (MIM#278760) Penetrance for gene: ERCC4 were set to unknown Review for gene: ERCC4 was set to GREEN Added comment: Microcephaly is a well established feature in Cockayne syndrome Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.319 | FANCE | Seb Lunke Marked gene: FANCE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.319 | FANCE | Seb Lunke Gene: fance has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.319 | FANCE | Seb Lunke Classified gene: FANCE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.319 | FANCE | Seb Lunke Gene: fance has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.318 | FANCI | Zornitza Stark Marked gene: FANCI as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.318 | FANCI | Zornitza Stark Gene: fanci has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.318 | FANCI | Zornitza Stark Classified gene: FANCI as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.318 | FANCI | Zornitza Stark Gene: fanci has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCF |
Belinda Chong gene: FANCF was added gene: FANCF was added to Microcephaly. Sources: Literature Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCF were set to 20301575 Phenotypes for gene: FANCF were set to Fanconi anemia, complementation group F, MIM# 603467 Review for gene: FANCF was set to GREEN Added comment: Well established gene disease association Sources: https://www.ncbi.nlm.nih.gov/books/NBK1401/ Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCG |
Paul De Fazio gene: FANCG was added gene: FANCG was added to Microcephaly. Sources: Literature Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCG were set to 20301575 Phenotypes for gene: FANCG were set to Fanconi anemia, complementation group G MIM#614082 Review for gene: FANCG was set to GREEN gene: FANCG was marked as current diagnostic Added comment: Well-established gene-disease association, microcephaly is a feature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCL | Zornitza Stark Marked gene: FANCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCL | Zornitza Stark Gene: fancl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCL | Zornitza Stark Classified gene: FANCL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.317 | FANCL | Zornitza Stark Gene: fancl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.316 | FANCL |
Zornitza Stark gene: FANCL was added gene: FANCL was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCL were set to 20301575 Phenotypes for gene: FANCL were set to Fanconi anemia, complementation group L, MIM# 614083 Review for gene: FANCL was set to GREEN Added comment: Well established gene-disease association, microcephaly is a key feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.316 | FANCC | Seb Lunke Marked gene: FANCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.316 | FANCC | Seb Lunke Gene: fancc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.316 | FANCC | Seb Lunke Classified gene: FANCC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.316 | FANCC | Seb Lunke Gene: fancc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.315 | FANCI |
Ain Roesley gene: FANCI was added gene: FANCI was added to Microcephaly. Sources: Literature Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCI were set to 20301575 Phenotypes for gene: FANCI were set to Fanconi anemia, complementation group I (MIM#609053) Penetrance for gene: FANCI were set to unknown Review for gene: FANCI was set to GREEN Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 1% cases is caused by FANCI Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.315 | FANCA | Seb Lunke Marked gene: FANCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.315 | FANCA | Seb Lunke Gene: fanca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | FANCD2 | Dean Phelan reviewed gene: FANCD2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:20301575; Phenotypes: Fanconi anemia 227646; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.315 | FANCA | Seb Lunke Classified gene: FANCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.315 | FANCA | Seb Lunke Gene: fanca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCE |
Naomi Baker gene: FANCE was added gene: FANCE was added to Microcephaly. Sources: Literature Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCE were set to PMID: 20301575 Phenotypes for gene: FANCE were set to Fanconi anemia, complementation group E, MIM#600901 Penetrance for gene: FANCE were set to Complete Review for gene: FANCE was set to GREEN Added comment: Well established gene-disease association, with microcephaly a reported feature. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCA |
Seb Lunke gene: FANCA was added gene: FANCA was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCA were set to 20301575 Phenotypes for gene: FANCA were set to Fanconi anemia, complementation group A (MIM#227650) Review for gene: FANCA was set to GREEN gene: FANCA was marked as current diagnostic Added comment: Well established gene disease association Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCB | Zornitza Stark Marked gene: FANCB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCB | Zornitza Stark Gene: fancb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCB | Zornitza Stark Classified gene: FANCB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.314 | FANCB | Zornitza Stark Gene: fancb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.313 | FANCB |
Zornitza Stark gene: FANCB was added gene: FANCB was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: FANCB were set to 20301575 Phenotypes for gene: FANCB were set to Fanconi anemia, complementation group B, MIM# 300514 Review for gene: FANCB was set to GREEN Added comment: Well established gene-disease association, microcephaly is a key feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.312 | FANCC |
Ain Roesley gene: FANCC was added gene: FANCC was added to Microcephaly. Sources: Literature Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FANCC were set to 20301575 Phenotypes for gene: FANCC were set to Fanconi anemia, complementation group C (MIM#227645) Penetrance for gene: FANCC were set to unknown Review for gene: FANCC was set to GREEN Added comment: 75% of Fanconi Anemia (FA) patients have microcephaly and approx 14% cases is caused by FANCC Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.46 | CHD4 | Seb Lunke Marked gene: CHD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.46 | CHD4 | Seb Lunke Gene: chd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.46 | CHD4 | Seb Lunke Classified gene: CHD4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.46 | CHD4 | Seb Lunke Gene: chd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | DIAPH1 | Zornitza Stark Marked gene: DIAPH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | DIAPH1 | Zornitza Stark Gene: diaph1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4125 | DIAPH1 | Zornitza Stark Phenotypes for gene: DIAPH1 were changed from to Deafness; thrombocytopenia 124900; Seizures; cortical blindness; microcephaly 616632 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macrocephaly_Megalencephaly v0.45 | CHD4 |
Ain Roesley gene: CHD4 was added gene: CHD4 was added to Macrocephaly_Megalencephaly. Sources: Literature Mode of inheritance for gene: CHD4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CHD4 were set to 31388190; 27616479 Phenotypes for gene: CHD4 were set to Sifrim-Hitz-Weiss syndrome (MIM#617159) Penetrance for gene: CHD4 were set to unknown Review for gene: CHD4 was set to GREEN Added comment: PMID: 31388190 Out of 32 probands, 5 had OFC of > 3 SD PMID: 27616479 Out of 5 patients, 3 had OFC of >98th percentiles and 1x 90th * all de novo variants Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4124 | DIAPH1 | Zornitza Stark Publications for gene: DIAPH1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4123 | UFC1 | Seb Lunke Marked gene: UFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4123 | UFC1 | Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4123 | DIAPH1 | Zornitza Stark Mode of inheritance for gene: DIAPH1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4122 | UFC1 | Seb Lunke Classified gene: UFC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4122 | UFC1 | Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.312 | UFC1 | Seb Lunke Marked gene: UFC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.312 | UFC1 | Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.312 | UFC1 | Seb Lunke Publications for gene: UFC1 were set to 29868776 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4121 | UFC1 |
Paul De Fazio gene: UFC1 was added gene: UFC1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFC1 were set to 29868776; 30552426 Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076) Review for gene: UFC1 was set to GREEN gene: UFC1 was marked as current diagnostic Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided. The following head circumference measurements were provided for 6 of the affecteds: 51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo. 3 of the families were consanguineous Saudi families with the same homozygous missense variant. In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal. PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.311 | UFC1 | Seb Lunke Classified gene: UFC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.311 | UFC1 | Seb Lunke Gene: ufc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.310 | CHD4 | Seb Lunke Marked gene: CHD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.310 | CHD4 | Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.310 | CHD4 | Seb Lunke Phenotypes for gene: CHD4 were changed from to Sifrim-Hitz-Weiss syndrome (MIM#617159) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | UFC1 | Paul De Fazio edited their review of gene: UFC1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | TUBGCP4 | Zornitza Stark Marked gene: TUBGCP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | UFC1 |
Paul De Fazio changed review comment from: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided. The following head circumference measurements were provided for 6 of the affecteds: 51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo. 3 of the families were consanguineous Saudi families with the same homozygous missense variant. Sources: Literature; to: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided. The following head circumference measurements were provided for 6 of the affecteds: 51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo. 3 of the families were consanguineous Saudi families with the same homozygous missense variant. In vitro functional expression studies showed that both mutations caused impaired thioester binding with UFM1. Patient cells also showed decreased UFC1 intermediate formation with UFM1. The decrease in function was consistent with a hypomorphic allele, and the authors suggested that complete loss of function would be embryonic lethal. PMID 30552426: 1 more individual with epileptic encephalopathy reported with a different homozygous missense variant in UFC1. The patient had microcephaly <3rd percentile. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | TUBGCP4 | Zornitza Stark Classified gene: TUBGCP4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.309 | CHD4 | Seb Lunke Publications for gene: CHD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.308 | CHD4 | Seb Lunke Mode of inheritance for gene: CHD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.308 | UBA5 | Zornitza Stark Marked gene: UBA5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.308 | UBA5 | Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.308 | UBA5 | Zornitza Stark Classified gene: UBA5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.308 | UBA5 | Zornitza Stark Gene: uba5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.307 | CHD4 | Seb Lunke Classified gene: CHD4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.307 | CHD4 | Seb Lunke Added comment: Comment on list classification: Unclear what would differentiate Macro- from micro-cephaly in this gene, or if micro-cephaly is actually a feature of the condition | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.307 | CHD4 | Seb Lunke Gene: chd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.306 | DNM1L | Zornitza Stark Marked gene: DNM1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.306 | DNM1L | Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green, but overall a small proportion of individuals have microcephaly. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.306 | DNM1L | Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.306 | DNM1L | Zornitza Stark Phenotypes for gene: DNM1L were changed from to Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.305 | UFC1 | Paul De Fazio edited their review of gene: UFC1: Changed publications: 29868776, 30552426 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.305 | DNM1L | Zornitza Stark Classified gene: DNM1L as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.305 | DNM1L | Zornitza Stark Gene: dnm1l has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.305 | DNM1L | Zornitza Stark Publications for gene: DNM1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.304 | DNM1L | Zornitza Stark Mode of inheritance for gene: DNM1L was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CENPF | Zornitza Stark Marked gene: CENPF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CENPF | Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CIT | Zornitza Stark Marked gene: CIT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CIT | Zornitza Stark Gene: cit has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CIT | Zornitza Stark Classified gene: CIT as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.303 | CIT | Zornitza Stark Gene: cit has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.302 | UBE3A | Zornitza Stark Marked gene: UBE3A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.302 | UBE3A | Zornitza Stark Gene: ube3a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.302 | UBE3A | Zornitza Stark Phenotypes for gene: UBE3A were changed from to Angelman syndrome MIM#105830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.301 | UBE3A | Zornitza Stark Mode of inheritance for gene: UBE3A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.300 | CHAMP1 | Zornitza Stark Marked gene: CHAMP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.300 | CHAMP1 | Zornitza Stark Gene: champ1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.300 | CHAMP1 | Zornitza Stark Publications for gene: CHAMP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.299 | CHAMP1 | Zornitza Stark Mode of inheritance for gene: CHAMP1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.298 | CHAMP1 | Zornitza Stark Phenotypes for gene: CHAMP1 were changed from to Mental retardation, autosomal dominant 40 (MIM#616579) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.297 | CDKL5 | Zornitza Stark Marked gene: CDKL5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.297 | CDKL5 | Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.297 | CENPF | Zornitza Stark Classified gene: CENPF as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.297 | CENPF | Zornitza Stark Gene: cenpf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4121 | CENPE | Seb Lunke Marked gene: CENPE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4121 | CENPE | Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4121 | CENPE | Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.296 | CDKL5 | Zornitza Stark Phenotypes for gene: CDKL5 were changed from to Epileptic encephalopathy, early infantile, 2 (MIM#300672) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4120 | CENPE | Seb Lunke Publications for gene: CENPE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Tag founder tag was added to gene: UFM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Marked gene: UFM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Added comment: Comment when marking as ready: Green rating in view of the marked microcephaly, and large number of individuals reported with the founder variant. Rating is borderline but consistent across panels. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4119 | CENPE | Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | CENPE | Seb Lunke Marked gene: CENPE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | CENPE | Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4118 | CENPE | Seb Lunke Classified gene: CENPE as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4118 | CENPE | Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Classified gene: UFM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | UFM1 | Zornitza Stark Gene: ufm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.295 | CENPE | Seb Lunke Phenotypes for gene: CENPE were changed from to Microcephaly 13, primary, autosomal recessive (MIM#616051) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4117 | CENPE | Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.294 | CENPE | Seb Lunke Publications for gene: CENPE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.293 | CENPE | Seb Lunke Mode of inheritance for gene: CENPE was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.292 | CENPE | Seb Lunke Classified gene: CENPE as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.292 | CENPE | Seb Lunke Gene: cenpe has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4117 | CDC6 | Seb Lunke Marked gene: CDC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4117 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.291 | CKAP2L |
Ain Roesley gene: CKAP2L was added gene: CKAP2L was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CKAP2L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CKAP2L were set to 29473684; 25439729 Phenotypes for gene: CKAP2L were set to Filippi syndrome (MIM#272440) Penetrance for gene: CKAP2L were set to unknown Review for gene: CKAP2L was set to GREEN Added comment: PMID: 29473684 - 1x proband with head circumference -3SD PMID: 25439729 - 11 patients, 7 have OFCs <= -3SD Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.291 | TUBB2B | Paul De Fazio reviewed gene: TUBB2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19465910, 22333901; Phenotypes: Cortical dysplasia, complex, with other brain malformations 7 MIM#610031; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4117 | CDC6 | Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.291 | CDKL5 | Zornitza Stark Publications for gene: CDKL5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2925 | CDC6 | Seb Lunke Marked gene: CDC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2925 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2925 | CDC6 | Seb Lunke Phenotypes for gene: CDC6 were changed from to Meier-Gorlin syndrome 5 (MIM#613805) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.290 | CDKL5 | Zornitza Stark Mode of inheritance for gene: CDKL5 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4116 | CDC6 | Seb Lunke Publications for gene: CDC6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.289 | CDKL5 | Zornitza Stark Classified gene: CDKL5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.289 | CDKL5 | Zornitza Stark Gene: cdkl5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4115 | CDC6 | Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2924 | CDC6 | Seb Lunke Publications for gene: CDC6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4114 | DIAPH1 | Dean Phelan reviewed gene: DIAPH1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24781755, 26463574, 24781755, 27808407, 28003573, 28815995; Phenotypes: Deafness, thrombocytopenia, Seizures, cortical blindness, microcephaly; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4114 | CDC6 | Seb Lunke Classified gene: CDC6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4114 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2923 | CDC6 | Seb Lunke Mode of inheritance for gene: CDC6 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2922 | CDC6 | Seb Lunke Classified gene: CDC6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2922 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.288 | CDK13 | Seb Lunke Marked gene: CDK13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.288 | CDK13 | Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.288 | CDK13 | Seb Lunke Phenotypes for gene: CDK13 were changed from to Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.287 | UNC80 | Zornitza Stark Marked gene: UNC80 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.287 | UNC80 | Zornitza Stark Gene: unc80 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.287 | CDK13 | Seb Lunke Publications for gene: CDK13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.287 | UNC80 | Zornitza Stark Phenotypes for gene: UNC80 were changed from to Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.286 | CDK13 | Seb Lunke Mode of inheritance for gene: CDK13 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.286 | UNC80 | Zornitza Stark Publications for gene: UNC80 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.285 | UNC80 | Zornitza Stark Mode of inheritance for gene: UNC80 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4113 | CDC6 | Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.284 | CDK13 | Seb Lunke Classified gene: CDK13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.284 | CDK13 | Seb Lunke Gene: cdk13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2921 | CDC6 | Ain Roesley reviewed gene: CDC6: Rating: RED; Mode of pathogenicity: None; Publications: 21358632; Phenotypes: Meier-Gorlin syndrome 5 (MIM#613805); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.283 | DDX11 | Zornitza Stark Marked gene: DDX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.283 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.283 | DDX11 | Zornitza Stark Classified gene: DDX11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.283 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.282 | TUBGCP4 |
Paul De Fazio gene: TUBGCP4 was added gene: TUBGCP4 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: TUBGCP4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TUBGCP4 were set to 25817018 Phenotypes for gene: TUBGCP4 were set to Microcephaly and chorioretinopathy, autosomal recessive, MIM#616335 Review for gene: TUBGCP4 was set to GREEN gene: TUBGCP4 was marked as current diagnostic Added comment: 4 patients from 3 families with biallelic variants reported, all with microcephaly < -3SD. All had a synonymous splice variant on one allele. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.282 | USP18 | Zornitza Stark Marked gene: USP18 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.282 | USP18 | Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.282 | USP18 | Zornitza Stark Phenotypes for gene: USP18 were changed from to Pseudo-TORCH syndrome 2 MIM#617397 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.281 | USP18 | Zornitza Stark Publications for gene: USP18 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.280 | CDC6 | Seb Lunke Marked gene: CDC6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.280 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.280 | CDC6 | Seb Lunke Classified gene: CDC6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.280 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.280 | USP18 | Zornitza Stark Mode of inheritance for gene: USP18 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.279 | CDC6 | Seb Lunke Classified gene: CDC6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.279 | CDC6 | Seb Lunke Gene: cdc6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.279 | USP18 | Zornitza Stark Classified gene: USP18 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.279 | USP18 | Zornitza Stark Gene: usp18 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.278 | CCDC88A | Zornitza Stark Classified gene: CCDC88A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.278 | CCDC88A | Zornitza Stark Gene: ccdc88a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.277 | CCDC88A | Ain Roesley edited their review of gene: CCDC88A: Changed rating: GREEN; Changed phenotypes: PEHO syndrome-like (MIM#617507) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.277 | BUB1B | Seb Lunke Marked gene: BUB1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.277 | BUB1B | Seb Lunke Gene: bub1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.277 | BUB1B | Seb Lunke Phenotypes for gene: BUB1B were changed from to Mosaic variegated aneuploidy syndrome 1 (MIM#257300) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.276 | CCDC88A | Zornitza Stark Marked gene: CCDC88A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.276 | CCDC88A | Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.276 | BUB1B | Seb Lunke Publications for gene: BUB1B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.276 | CCDC88A | Zornitza Stark Classified gene: CCDC88A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.276 | CCDC88A | Zornitza Stark Gene: ccdc88a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.275 | BUB1B | Seb Lunke Mode of inheritance for gene: BUB1B was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.274 | DHCR7 | Zornitza Stark Marked gene: DHCR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.274 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.274 | DHCR7 | Zornitza Stark Classified gene: DHCR7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.274 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | UBA5 |
Paul De Fazio gene: UBA5 was added gene: UBA5 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: UBA5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UBA5 were set to 27545674; 27545681 Phenotypes for gene: UBA5 were set to Epileptic encephalopathy, early infantile, 44 (MIM#617132) Review for gene: UBA5 was set to GREEN gene: UBA5 was marked as current diagnostic Added comment: PMID 27545674: 8 patients from 5 unrelated families with biallelic variants reported. All had the same missense variant on one allele (517hets in gnomAD), which they referred to as a hypomorphic allele. 7 of the 8 were microcephalic (they used < -3SD as diagnostic criteria). PMID 27545681: 5 patients from 4 families with biallelic variants reported. Head circumferences were cited as: -3.5SD, -2SD, 4th centile, -2.5SD, -2.4SD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | DHCR7 |
Belinda Chong changed review comment from: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/) More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7) Sources: Literature; to: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/, ClinVar) More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | DNM1L |
Naomi Baker changed review comment from: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype. PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified. PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity. PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified. Loss-of-function and dominant negative; to: Most individuals reported with variants in DNM1L do not have microcephaly listed as a phenotype. PMID: 17460227 - Reports a newborn girl with microcephaly (head circumference below the 0.4 percentile), abnormal brain development, optic atrophy and hypoplasia, persistent lactic acidemia, and a mildly elevated plasma concentration of very-long-chain fatty acids. She died suddenly at the age of 37 days. A monoallelic missense variant was identified. PMID: 26992161 - A monoallelic missense variant reported in a 2 year old boy with a chronic neurological disorder, characterized by postnatal microcephaly (OFC 45.5 cm (<3rd centile)), developmental delay, and pain insensitivity. PMID: 30801875 - Five patients presenting with severe epileptic encephalopathy; microcephaly (<3rd percentile) reported in one patient. Five de novo dominant DNM1L variants were identified. Both loss-of-function (variants within the GTPase domain) and dominant negative (variants within the middle domain) mechanisms have been reported. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | DNM1L | Naomi Baker reviewed gene: DNM1L: Rating: AMBER; Mode of pathogenicity: Other; Publications: PMID: 17460227, 26992161, 30801875; Phenotypes: Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MIM#614388; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CIT |
Ain Roesley gene: CIT was added gene: CIT was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CIT was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CIT were set to 27453578; 27503289; 27453579 Phenotypes for gene: CIT were set to Microcephaly 17, primary, autosomal recessive (MIM#617090) Penetrance for gene: CIT were set to unknown Review for gene: CIT was set to GREEN Added comment: PMID: 27453578 - 3 consanguineous families with 7 affecteds and head circumferences ranging from -5.6 SD to -8.4 SD PMID: 27503289 - 2 consanguineous families with 2 affecteds and OFCs of -9 and -10 SDs PMID: 27453579 - 3 families (2 consanguineous) with 6 affecteds - only 3 had OFCs records:: birth and last examined ranged from -3.5 to -12 SDs *mix of missense and PTVs Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CHD4 | Ain Roesley reviewed gene: CHD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 31388190; Phenotypes: Sifrim-Hitz-Weiss syndrome (MIM#617159); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | UBE3A | Paul De Fazio reviewed gene: UBE3A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Angelman syndrome MIM#105830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed); Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CHAMP1 | Ain Roesley reviewed gene: CHAMP1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27148580, 26340335; Phenotypes: Mental retardation, autosomal dominant 40 (MIM#616579); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | UFC1 |
Paul De Fazio gene: UFC1 was added gene: UFC1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: UFC1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFC1 were set to 29868776 Phenotypes for gene: UFC1 were set to Neurodevelopmental disorder with spasticity and poor growth (MIM#618076) Review for gene: UFC1 was set to AMBER gene: UFC1 was marked as current diagnostic Added comment: PMID 29868776: 8 affected individuals from 4 families reported. 7 were described to be postnatally microcephalic (at or below 3rd percentile). One was -5.1SD and one was -3.6SD. SD values for the others weren't provided. The following head circumference measurements were provided for 6 of the affecteds: 51cm at 16yo; 50cm at 19yo; 42.5cm at 12mo, 45cm at 28mo, 45.2cm at 7yo; 45cm at 4yo. 3 of the families were consanguineous Saudi families with the same homozygous missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CENPF |
Ain Roesley gene: CENPF was added gene: CENPF was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CENPF was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CENPF were set to 25564561; 28407396; 27300082; 31953238 Phenotypes for gene: CENPF were set to Stromme syndrome (MIM#243605) Penetrance for gene: CENPF were set to unknown Review for gene: CENPF was set to GREEN Added comment: *Several Stromme syndrome patients reported with microcephaly however only the following were genetically confirmed. PMID: 31953238 - 2 siblings from a consanguineous Saudi family - Patient 1: head circumference -3.33 SD (44cm) at 3 years and -4.4 SD (45.5cm) at 6 years - Patient 2: +5.07 SD (39.5cm) at birth and +8.99 SD (49cm) at 2 months - homozygous splice variant PMID: 28407396 - 1x proband with head circumference -6.29 SD (at birth) and -7.57 SD at 18 months - homozygous fs variant PMID: 25564561; - 1x proband with OFC <0.4 centile (29.5cm) at birth and adult OFC of <0.4 centile (45.5cm) - cHet for 2x nonsense variants PMID: 27300082 ; - 1x proband with OFC <3rd centile - chet for PTVs Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | UFM1 |
Paul De Fazio gene: UFM1 was added gene: UFM1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: UFM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UFM1 were set to 28931644; 29868776; 31914610 Phenotypes for gene: UFM1 were set to Leukodystrophy, hypomyelinating, 14 MIM#617899 Review for gene: UFM1 was set to AMBER gene: UFM1 was marked as current diagnostic Added comment: Summary: Only 2 variants reported in this gene, one a founder promoter variant and one a missense variant found in 2 Sudanese families (3 hets in gnomAD). All affected individuals were reported with microcephaly but measurements only provided for two. A Drosophila model supports an association of this gene with microcephaly, but it's Drosophila. PMID 28931644: Found a 3bp deletion in the promoter region of UFM1 in 16 Roma individuals with hypomyelination with atrophy of the basal ganglia and cerebellum who were negative for TUBB4A mutations. Functional studies showed an effect on gene expressin in neuronal cell lines but not other cell lines. All affected individuals had microcephaly but no measurements were provided. PMID 29868776: 4 affected individuals from 2 Sudanese families reported with the same missense variant. All four were said to have microcephaly but measurments only provided for two: Proband from family 1 had a head circumference of 40cm at 2yo; proband from family 2 had head circumference of < -4SD at 13mo. PMID 31914610: Used Drosophila embryos to show that UFM1 knockdown was associated with developmental processes that lead to microcephaly. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CENPE | Ain Roesley reviewed gene: CENPE: Rating: RED; Mode of pathogenicity: None; Publications: 24748105, 30086807; Phenotypes: Microcephaly 13, primary, autosomal recessive (MIM#616051); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CDKL5 | Ain Roesley reviewed gene: CDKL5: Rating: AMBER; Mode of pathogenicity: None; Publications: 15689447, 19396824, 22678952, 31122804, 30928302; Phenotypes: Epileptic encephalopathy, early infantile, 2 (MIM#300672); Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | UNC80 | Paul De Fazio reviewed gene: UNC80: Rating: GREEN; Mode of pathogenicity: None; Publications: 26708751, 26708753, 26545877, 29572195; Phenotypes: Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 MIM#616801; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | DDX11 |
Naomi Baker gene: DDX11 was added gene: DDX11 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: DDX11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DDX11 were set to PMID: 31824187; 20137776; 23033317. Phenotypes for gene: DDX11 were set to Warsaw breakage syndrome, MIM#613398 Penetrance for gene: DDX11 were set to Complete Review for gene: DDX11 was set to GREEN Added comment: The cardinal clinical features observed in Warsaw breakage syndrome (WABS) patients include severe pre- and post-natal growth retardation, microcephaly, sensorineural hearing loss, cochlear anomalies, facial dysmorphia and sister chromatid cohesion defects (PMID: 31824187). A male patient with biallelic DDX11 variants (splice site and in-frame deletion) presented with several congenital abnormalities, including microcephaly, facial dysmorphy, high arched palate, coloboma of the right optic disc, deafness, small ventricular septal defect, bilateral clinodactyly of the fifth fingers, syndactyly of the second and third toes, cutis marmorata, and one hypo- and three hyperpigmented patches on the skin. Authors proposed to name the syndrome associated with defective DDX11 “Warsaw breakage syndrome” (WABS) (PMID: 20137776). Three siblings carrying a biallelic DDX11 missense variant with clinical presentation of WABS: ID, growth retardation, and severe congenital abnormalities including microcephaly, facial dysmorphism, deafness due to cochlear abnormalities (in two of the sibs), and cardiac malformations (in one of the sibs) (PMID: 23033317). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CDK13 |
Ain Roesley changed review comment from: Mild microcephaly in some patients (OMIM) PMID: 29021403; - 15 patients, all de novo missense - OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles (includes patients reported in PMID: 27479907) PMID: 31238879; - 7 patients with likely path variants in CDK13 (ACMG was used in classifications) - 2 with microcephaly but measurements not provided; to: Mild microcephaly in some patients (OMIM) PMID: 29021403; - 15 patients, all de novo missense - OFC ranges from 50th to <0.4th centile. Only 4 patients have <0.4 centiles and 2 with 1st centile (includes patients reported in PMID: 27479907) PMID: 31238879; - 7 patients with likely path variants in CDK13 (ACMG was used in classifications) - 2 with microcephaly but measurements not provided |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CDK13 | Ain Roesley reviewed gene: CDK13: Rating: AMBER; Mode of pathogenicity: None; Publications: 27479907, 29021403, 31238879; Phenotypes: Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder (MIM#617360); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | USP18 | Paul De Fazio reviewed gene: USP18: Rating: RED; Mode of pathogenicity: None; Publications: 27325888, 31940699; Phenotypes: Pseudo-TORCH syndrome 2 MIM#617397; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CDC6 |
Ain Roesley gene: CDC6 was added gene: CDC6 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CDC6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDC6 were set to 21358632 Phenotypes for gene: CDC6 were set to Meier-Gorlin syndrome 5 (MIM#613805) Penetrance for gene: CDC6 were set to unknown Review for gene: CDC6 was set to RED Added comment: PMID: 21358632; - 1x proband with OFC -3.3SD - homozygous for a missense *no new reports since Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | CCDC88A |
Ain Roesley gene: CCDC88A was added gene: CCDC88A was added to Microcephaly. Sources: Literature Mode of inheritance for gene: CCDC88A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC88A were set to 30392057; 26917597 Phenotypes for gene: CCDC88A were set to PEHO syndrome-like (MIM#617507) Penetrance for gene: CCDC88A were set to unknown Review for gene: CCDC88A was set to AMBER Added comment: PMID: 30392057 - consanguineous Saudi family with 2 affecteds. Homozygous for a nonsense variant - microcephaly, dev delay, ID, epilepsy, dysmorphism and brain atropy - no measurements provided PMID: 26917597 - consanguineous family with 3 affecteds. Homozygous fs variant - infantile hypotonia, dev delay, optic and brain atrophy, seizures and microcephaly (measurements not provided) - functional studies on KO mice Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4113 | GMNN | Zornitza Stark changed review comment from: Three unrelated individuals reported.; to: Three unrelated individuals reported, all variants in exon 2 (first coding exon). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | GMNN | Zornitza Stark Marked gene: GMNN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | GMNN | Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.273 | GMNN | Zornitza Stark Mode of inheritance for gene: GMNN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.272 | GMNN | Zornitza Stark Classified gene: GMNN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.272 | GMNN | Zornitza Stark Gene: gmnn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.271 | GMNN | Zornitza Stark edited their review of gene: GMNN: Changed phenotypes: Meier-Gorlin syndrome 6, MIM# 616835; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.271 | GMNN |
Zornitza Stark gene: GMNN was added gene: GMNN was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: GMNN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GMNN were set to 26637980 Phenotypes for gene: GMNN were set to Meier-Gorlin syndrome 6, MIM# 616835 Review for gene: GMNN was set to GREEN Added comment: Three unrelated individuals reported with variants in exon 2 (first coding exon) and primordial dwarfism (including microcephaly), microtia, and absent patellae. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.270 | BUB1B | Ain Roesley reviewed gene: BUB1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 18548531; Phenotypes: Mosaic variegated aneuploidy syndrome 1 (MIM#257300); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.270 | KIF21B | Zornitza Stark Marked gene: KIF21B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.270 | KIF21B | Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.270 | KIF21B | Zornitza Stark Classified gene: KIF21B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.270 | KIF21B | Zornitza Stark Gene: kif21b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.269 | KIF21B |
Zornitza Stark gene: KIF21B was added gene: KIF21B was added to Microcephaly. Sources: Literature Mode of inheritance for gene: KIF21B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF21B were set to 32415109 Phenotypes for gene: KIF21B were set to Global developmental delay; Intellectual disability; Abnormality of brain morphology; Microcephaly Mode of pathogenicity for gene: KIF21B was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: KIF21B was set to GREEN Added comment: Asselin et al (2020 - PMID: 32415109) report on 4 individuals with KIF21B pathogenic variants. DD/ID (borderline intellectual functioning to severe ID) was a feature in all. Variable other findings included brain malformations (CCA) and microcephaly. 3 missense variants and a 4-bp insertion were identified, in 3 cases as de novo events while in a single subject the variant was inherited from the father who was also affected. The authors provide evidence for a role of KIF21B in the regulation of processes involved in cortical development and deleterious effect of the missense variants impeding neuronal migration and kinesin autoinhibition. Phenotypes specific to variants (e.g. CCA or microcephaly) were recapitulated in animal models. Missense variants are thought to exert a gain-of-function effect. As commented on, the 4-bp duplication (/frameshift) variant might not be pathogenic. In blood sample from the respective individual, RT-qPCR analysis suggested that haploinsufficiency (NMD) applies. Although Kif21b haploinsufficiency in mice was shown to lead to impaired neuronal positioning, the gene might partially tolerate LoF variants as also suggested by 28 such variants in gnomAD. Homozygous Kif21b ko mice display severe morphological abnormalities, partial loss of commissural fibers, cognitive deficits and altered synaptic transmission (several refs to previous studies provided by the authors). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2921 | CTNND1 | Zornitza Stark Marked gene: CTNND1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2921 | CTNND1 | Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2921 | CTNND1 | Zornitza Stark Classified gene: CTNND1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2921 | CTNND1 | Zornitza Stark Gene: ctnnd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2920 | CTNND1 |
Zornitza Stark gene: CTNND1 was added gene: CTNND1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CTNND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CTNND1 were set to 28301459; 32196547 Phenotypes for gene: CTNND1 were set to Blepharocheilodontic syndrome 2, MIM# 617681 Review for gene: CTNND1 was set to AMBER Added comment: 4 individuals from 3 unrelated families with blepharocheilodontic syndrome and mutations in the CTNND1 gene reported originally in PMID 28301459. All had eyelid anomalies, including ectropion of the lower lids, euryblepharon, lagophthalmia, and distichiasis. In addition, all 4 showed typical facial dysmorphism with hypertelorism, flat face, and high forehead, and all had conical teeth and tooth agenesis. Three had cleft lip and palate, 3 had hair anomalies, and 1 had hypothyroidism due to hypoplasia or aplasia of the thyroid gland. None of the patients exhibited anal atresia or neural tube defects. PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13). This more recent publication suggests a broader phenotype associated with CTNND1 variants including dev delay, ADHD/ASD, behavioural issues. Unclear from description whether significant ID present. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4113 | CTNND1 | Zornitza Stark Marked gene: CTNND1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4113 | CTNND1 | Zornitza Stark Gene: ctnnd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4113 | CTNND1 | Zornitza Stark Publications for gene: CTNND1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4112 | CTNND1 | Zornitza Stark reviewed gene: CTNND1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28301459; Phenotypes: Blepharocheilodontic syndrome 2, MIM# 617681; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | DHCR7 | Belinda Chong edited their review of gene: DHCR7: Changed rating: GREEN; Changed phenotypes: Smith-Lemli-Opitz syndrome 270400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | DHCR7 |
Belinda Chong gene: DHCR7 was added gene: DHCR7 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHCR7 were set to 9634533; 12949967; 15670717; 14981719 Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome 270400 Added comment: 80%-84% of individuals have Microcephaly (https://www.ncbi.nlm.nih.gov/books/NBK1143/) More than 200 mutations that cause Smith-Lemli-Opitz syndrome have been identified in the DHCR7 gene. (https://databases.lovd.nl/shared/genes/DHCR7) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4112 | CTNND1 | Zornitza Stark Phenotypes for gene: CTNND1 were changed from to Blepharocheilodontic syndrome 2, MIM# 617681 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4111 | CTNND1 | Zornitza Stark Mode of inheritance for gene: CTNND1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.383 | DNMT1 | Zornitza Stark Marked gene: DNMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.383 | DNMT1 | Zornitza Stark Gene: dnmt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.383 | DNMT1 | Zornitza Stark Phenotypes for gene: DNMT1 were changed from to Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121; Neuropathy, hereditary sensory, type IE, 614116 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.382 | DNMT1 | Zornitza Stark Publications for gene: DNMT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.381 | DNMT1 | Zornitza Stark Mode of inheritance for gene: DNMT1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.380 | DNMT1 | Zornitza Stark reviewed gene: DNMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 22328086, 21532572, 31984424; Phenotypes: Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121, Neuropathy, hereditary sensory, type IE, 614116; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4110 | DNMT1 | Zornitza Stark Publications for gene: DNMT1 were set to 22328086; 21532572 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.380 | RIPOR2 | Zornitza Stark Marked gene: RIPOR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.380 | RIPOR2 | Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.380 | RIPOR2 | Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.380 | RIPOR2 | Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.379 | RIPOR2 | Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4109 | RIPOR2 | Zornitza Stark Phenotypes for gene: RIPOR2 were changed from Deafness, autosomal recessive 104, MIM# 616515 to Deafness, autosomal recessive 104, MIM# 616515; Deafness, autosomal dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.378 | RIPOR2 | Zornitza Stark Publications for gene: RIPOR2 were set to 24958875 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.377 | RIPOR2 | Zornitza Stark Tag founder tag was added to gene: RIPOR2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.377 | RIPOR2 |
Zornitza Stark changed review comment from: Single family and animal model data. Sources: Expert list; to: Single family with bi-allelic variants and animal model data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v0.377 | RIPOR2 |
Zornitza Stark edited their review of gene: RIPOR2: Added comment: PMID: 32631815 (2020) - A heterozygous 12 nucleotide in-frame deletion (c.1696_1707del, p.Gln566_Lys569del) in RIPOR2 was detected in 12 families of Dutch origin with non-syndromic hearing loss. In total, the variant was detected in 59/63 affected participants, but also in five unaffected subjects from three family. Age of onset was highly variable, from congenital to 70 years (mean age: 30.6 years) - unaffected family members who harboured the variant were aged 23, 40, 49, 50, and 51 years, respectively. The authors speculate that the four affected subjects without the variant represent phenocopies. The presence of an identical variant in 12 families of common origin, as well as haplotype analysis, indicates a founder effect. Functional analysis of the variant showed aberrant localisation of mutant-RIPOR2 in early postnatal mouse hair cells, ex vivo; and failure to rescue the stereocilia defects of Ripor2 knockout mice, in contrast to the rescue effect observed in cells expressing wild-type RIPOR2.; Changed publications: 24958875, 32631815; Changed phenotypes: Deafness, autosomal recessive 104, MIM# 616515, Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4108 | RIPOR2 |
Zornitza Stark changed review comment from: Single family and animal model data. Sources: Expert list; to: Single family with bi-allelic variants and animal model data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4108 | RIPOR2 | Zornitza Stark Marked gene: RIPOR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4108 | RIPOR2 | Zornitza Stark Added comment: Comment when marking as ready: Insufficient evidence for Green rating for either MOI. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4108 | RIPOR2 | Zornitza Stark Gene: ripor2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4108 | RIPOR2 | Zornitza Stark Publications for gene: RIPOR2 were set to 24958875 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4107 | RIPOR2 | Zornitza Stark Mode of inheritance for gene: RIPOR2 was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4106 | RIPOR2 | Zornitza Stark Tag founder tag was added to gene: RIPOR2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4106 | NOTCH3 | Zornitza Stark Classified gene: NOTCH3 as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4106 | NOTCH3 | Zornitza Stark Gene: notch3 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Marked gene: NOTCH3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | BRIP1 |
Ain Roesley gene: BRIP1 was added gene: BRIP1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: BRIP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BRIP1 were set to Fanconi anemia, complementation group J (MIM#609054) Penetrance for gene: BRIP1 were set to unknown Review for gene: BRIP1 was set to GREEN Added comment: 75% of Fanconi anemia (FA) patients present with microcephaly and BRIP1 contributes to approx 2% of FA diagnosis (gene reviews) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.76 | NOTCH3 | Zornitza Stark Phenotypes for gene: NOTCH3 were changed from to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.75 | NOTCH3 | Zornitza Stark Publications for gene: NOTCH3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.74 | NOTCH3 | Zornitza Stark Mode of inheritance for gene: NOTCH3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | NOTCH3 | Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v0.55 | NOTCH3 | Zornitza Stark Marked gene: NOTCH3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v0.55 | NOTCH3 | Zornitza Stark Gene: notch3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v0.55 | NOTCH3 | Zornitza Stark Publications for gene: NOTCH3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Stroke v0.54 | NOTCH3 | Zornitza Stark reviewed gene: NOTCH3: Rating: GREEN; Mode of pathogenicity: None; Publications: 31960911; Phenotypes: Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4105 | TET2 | Zornitza Stark Phenotypes for gene: TET2 were changed from to Dementia; Lymphoma/myeloid malignancy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4104 | TET2 | Zornitza Stark Mode of inheritance for gene: TET2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4103 | TET2 | Zornitza Stark Publications for gene: TET2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 | Zornitza Stark Marked gene: TET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 | Zornitza Stark Gene: tet2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.73 | TET2 |
Zornitza Stark gene: TET2 was added gene: TET2 was added to Early-onset Dementia. Sources: Literature Mode of inheritance for gene: TET2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TET2 were set to 32330418; 31943063 Phenotypes for gene: TET2 were set to Dementia Review for gene: TET2 was set to RED Added comment: Association study (PMID 32330418) found enrichment of non-coding and LoF TET2 variants in cohort of individuals with early onset dementia, unclear if this is monogenic or polygenic contribution. PMID: 31943063 - Li et al 2020 - functional studies in mice show that Tet2 depletion in the hippocampus exacerbates Alzheimer disease pathology and cognitive dysfunction at early disease stages. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4102 | TET2 | Zornitza Stark edited their review of gene: TET2: Changed phenotypes: Dementia, Lymphoma/myeloid malignancy; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.179 | ZFYVE19 | Zornitza Stark Marked gene: ZFYVE19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.179 | ZFYVE19 | Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.179 | ZFYVE19 | Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.179 | ZFYVE19 | Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.178 | ZFYVE19 |
Zornitza Stark gene: ZFYVE19 was added gene: ZFYVE19 was added to Cholestasis. Sources: Literature Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZFYVE19 were set to 32737136 Phenotypes for gene: ZFYVE19 were set to Cholestasis Review for gene: ZFYVE19 was set to GREEN Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis. ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4102 | ZFYVE19 | Zornitza Stark Marked gene: ZFYVE19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4102 | ZFYVE19 | Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4102 | ZFYVE19 | Zornitza Stark Classified gene: ZFYVE19 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4102 | ZFYVE19 | Zornitza Stark Gene: zfyve19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4101 | TRPM7 | Zornitza Stark Phenotypes for gene: TRPM7 were changed from {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500 to {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500; Cardiac arrhythmia, stillbirth | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4100 | TRPM7 | Zornitza Stark Publications for gene: TRPM7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4099 | TRPM7 | Zornitza Stark Mode of inheritance for gene: TRPM7 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4098 | TRPM7 | Zornitza Stark Classified gene: TRPM7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4098 | TRPM7 | Zornitza Stark Gene: trpm7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4097 | TRPM7 | Zornitza Stark edited their review of gene: TRPM7: Added comment: Ion channel expressed in the nervous and cardiac systems. The variant associated with ALS/dementia in the Guam population, p.Thr1482Ile is present in >23,000 hets in gnomad, which is out of keeping for a rare Mendelian disorder. Note recent publication associating missense variants with cardiac arrhythmia and stillbirth, with some functional data provided to substantiate effect of variant on protein function but not necessarily establish gene-disease association.; Changed rating: AMBER; Changed publications: 32503408, 31423533; Changed phenotypes: {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500, Cardiac arrhythmia, stillbirth; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.475 | CHCHD10 | Zornitza Stark Marked gene: CHCHD10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.475 | CHCHD10 | Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.475 | CHCHD10 | Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.474 | CHCHD10 | Zornitza Stark Publications for gene: CHCHD10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.473 | CHCHD10 | Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.472 | CHCHD10 | Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.471 | CHCHD10 | Zornitza Stark Tag founder tag was added to gene: CHCHD10. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.471 | CHCHD10 | Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923, 31261376; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4097 | CHCHD10 | Zornitza Stark Marked gene: CHCHD10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4097 | CHCHD10 | Zornitza Stark Gene: chchd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4097 | CHCHD10 | Zornitza Stark Tag founder tag was added to gene: CHCHD10. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4097 | CHCHD10 | Zornitza Stark Phenotypes for gene: CHCHD10 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911; Spinal muscular atrophy, Jokela type 615048; Myopathy, isolated mitochondrial, autosomal dominant 616209 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4096 | CHCHD10 | Zornitza Stark Publications for gene: CHCHD10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4095 | CHCHD10 | Zornitza Stark Mode of pathogenicity for gene: CHCHD10 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4094 | CHCHD10 | Zornitza Stark Mode of inheritance for gene: CHCHD10 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4093 | CHCHD10 | Zornitza Stark reviewed gene: CHCHD10: Rating: GREEN; Mode of pathogenicity: Other; Publications: 24934289, 25428574, 25193783, 32042922, 31690696, 30877432, 30874923; Phenotypes: Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911, Spinal muscular atrophy, Jokela type 615048, Myopathy, isolated mitochondrial, autosomal dominant 616209; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2919 | ADARB1 | Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2918 | ADARB1 | Zornitza Stark Publications for gene: ADARB1 were set to 32220291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.830 | ADARB1 | Zornitza Stark Marked gene: ADARB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.830 | ADARB1 | Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.830 | ADARB1 | Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.829 | ADARB1 | Zornitza Stark Publications for gene: ADARB1 were set to 32220291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4093 | ADARB1 | Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4092 | ADARB1 | Zornitza Stark Publications for gene: ADARB1 were set to 32220291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | ADARB1 | Zornitza Stark Marked gene: ADARB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | ADARB1 | Zornitza Stark Gene: adarb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.268 | ADARB1 | Zornitza Stark Phenotypes for gene: ADARB1 were changed from Intellectual disability; microcephaly; seizures to Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Intellectual disability; microcephaly; seizures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.267 | ADARB1 | Zornitza Stark Publications for gene: ADARB1 were set to 32220291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | CTNND1 | Eleanor Williams changed review comment from: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13).; to: PMID: 32196547 - Alharatani et al 2020 - report an expanded phenotype for CTNND1 patients. They report 13 individuals from nine families with novel protein-truncating variants in CTNND1 identified by WES. The mutations were not previously described in blepharocheilodontic (BCD), orofacial cleft cases nor in gnomAD. 8 patients had de novo variants, 2 inherited from affected parents, 2 participants inherited a variant from a parent with a mild phenotype. 8/13 patients showed cleft palate Additional phenotypic features seen include mild limb phenotypes (9/13), cardiovascular anomalies (6/13) and Developmental delay and other neurodevelopmental problems (8/13). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | CTNND1 | Eleanor Williams reviewed gene: CTNND1: Rating: ; Mode of pathogenicity: None; Publications: 32196547; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | DNMT1 | Eleanor Williams reviewed gene: DNMT1: Rating: ; Mode of pathogenicity: None; Publications: 31984424; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | RIPOR2 | Arina Puzriakova reviewed gene: RIPOR2: Rating: AMBER; Mode of pathogenicity: None; Publications: 32631815; Phenotypes: Sensorineural hearing loss; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | NOTCH3 |
Eleanor Williams gene: NOTCH3 was added gene: NOTCH3 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: NOTCH3 were set to 31960911 Phenotypes for gene: NOTCH3 were set to CADASIL Review for gene: NOTCH3 was set to AMBER Added comment: PMID: 31960911 - Gravesteijn et al 2020 - describe a family with a unique cysteine-altering NOTCH3 variant in exon 9 in 5 individuals, which is predicted to cause natural exon 9 skipping. This mimics the therapeutic NOTCH3 cysteine correction approach and allows the effect of cysteine corrective exon skipping on NOTCH3 protein aggregation and disease severity in humans to be studied. In this family the CADASIL phenotype was mild. Note this gene is rated green on the Neurodegenerative disorders - adult onset panel in the Genomics England instance of PanelApp https://panelapp.genomicsengland.co.uk/panels/474/gene/NOTCH3/ Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | TET2 | Eleanor Williams commented on gene: TET2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | TRPM7 | Eleanor Williams commented on gene: TRPM7: PMID: 31423533 - Cartwright et al 2020 - functional studies on four heterozygous nonsynonymous variants that were observed in TRPM7 in four individual cases of unexplained still birth which were screened for variants in 35 candidate genes in PMID: 29874177 (Munroe et al 2018). TRPM7 is a ubiquitously expressed ion channel known to regulate cardiac development and repolarization in mice. They found two variants in TRPM7, p.G179V and p.T860M, reduce ion channel current expression, which in the case of p.T860M is likely due to rapid degradation mediated by the proteasome. In addition, the p.R494Q TRPM7 variant significantly increases TRPM7 ion channel current, in a cell-type specific manner. They believe that TRPM7 may play a key role in ensuring correct cardiac development of the fetus. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | ZFYVE19 |
Arina Puzriakova gene: ZFYVE19 was added gene: ZFYVE19 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ZFYVE19 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZFYVE19 were set to 32737136 Phenotypes for gene: ZFYVE19 were set to Cholestasis Review for gene: ZFYVE19 was set to GREEN Added comment: PMID: 32737136 (2020) - Nine Han Chinese children from seven families with biallelic, predicted complete LoF variants in ZFYVE19. All patients had high-GGT intrahepatic cholestasis, portal hypertension, and histopathological features of the ductal plate malformation/congenital hepatic fibrosis. ZFYVE19 depletion in cultured cells from one patient yielded centriolar and axonemal abnormalities, and immunostaining for two ciliary proteins DCDC2 and ACALT showed abnormal localisation in patient cholangiocytes, indicating this as a novel ciliopathy disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | TRPM7 | Eleanor Williams reviewed gene: TRPM7: Rating: AMBER; Mode of pathogenicity: None; Publications: 31423533, 29874177; Phenotypes: still birth, cardiac development; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | CHCHD10 | Eleanor Williams reviewed gene: CHCHD10: Rating: ; Mode of pathogenicity: None; Publications: 31261376; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | ADARB1 | Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2917 | ADARB1 | Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.828 | ADARB1 | Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.266 | ADARB1 | Arina Puzriakova reviewed gene: ADARB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32220291, 32719099; Phenotypes: Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.266 | HDAC8 | Zornitza Stark Marked gene: HDAC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.266 | HDAC8 | Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.266 | HDAC8 | Zornitza Stark Classified gene: HDAC8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.266 | HDAC8 | Zornitza Stark Gene: hdac8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.265 | HDAC8 |
Zornitza Stark gene: HDAC8 was added gene: HDAC8 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for gene: HDAC8 were set to 24403048 Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome 5, MIM# 300882 Review for gene: HDAC8 was set to GREEN Added comment: Over 35 individuals reported, ~30% had microcephaly. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2917 | IARS | Zornitza Stark Tag new gene name tag was added to gene: IARS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | IARS | Zornitza Stark Tag new gene name tag was added to gene: IARS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.264 | IARS | Zornitza Stark Marked gene: IARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.264 | IARS | Zornitza Stark Gene: iars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.264 | IARS | Zornitza Stark Tag new gene name tag was added to gene: IARS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.264 | IARS | Zornitza Stark Classified gene: IARS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.264 | IARS | Zornitza Stark Gene: iars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.263 | IARS |
Zornitza Stark gene: IARS was added gene: IARS was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: IARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IARS were set to 27426735; 27891590 Phenotypes for gene: IARS were set to Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM# 617093 Review for gene: IARS was set to GREEN Added comment: Microcephaly -3 to -5SD is part of the phenotype of this autosomal recessive multisystem disorder characterised by poor overall growth, impaired intellectual development, hypotonia, and variable liver dysfunction. Additional features, such as seizures and hearing loss, may also be present. At least 4 families reported. Note HGNC approved name is IARS1. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.262 | IGF1 | Zornitza Stark Marked gene: IGF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.262 | IGF1 | Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.262 | IGF1 | Zornitza Stark Classified gene: IGF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.262 | IGF1 | Zornitza Stark Gene: igf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.261 | IGF1 |
Zornitza Stark gene: IGF1 was added gene: IGF1 was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IGF1 were set to 15769976; 14684690; 8857020 Phenotypes for gene: IGF1 were set to Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM# 608747 Review for gene: IGF1 was set to GREEN Added comment: Severe growth retardation including significant microcephaly. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.260 | IGF1R | Zornitza Stark Marked gene: IGF1R as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.260 | IGF1R | Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.260 | IGF1R | Zornitza Stark Classified gene: IGF1R as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.260 | IGF1R | Zornitza Stark Gene: igf1r has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.259 | IGF1R |
Zornitza Stark gene: IGF1R was added gene: IGF1R was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: IGF1R was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: IGF1R were set to 14657428; 25040157; 23045302; 26252249; 15928254 Phenotypes for gene: IGF1R were set to Insulin-like growth factor I, resistance to, MIM# 270450 Review for gene: IGF1R was set to GREEN Added comment: Severe IUGR including significant microcephaly, both mono-allelic and bi-allelic variants reported. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | SRD5A3 | Zornitza Stark Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4091 | SRD5A3 | Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM#612379; Kahrizi syndrome, MIM# 612713 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4090 | SRD5A3 | Zornitza Stark Publications for gene: SRD5A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4089 | SRD5A3 | Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4088 | SRD5A3 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4088 | SRD5A3 | Zornitza Stark edited their review of gene: SRD5A3: Added comment: Over 25 families reported, well established gene-disease association for CDG. Allelic disorder Kahrizi syndrome has overlapping features, may not be distinct entity.; Changed publications: 32424323; Changed phenotypes: Congenital disorder of glycosylation, type Iq, MIM#612379, Kahrizi syndrome, MIM# 612713 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.163 | SRD5A3 | Zornitza Stark Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.163 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.163 | SRD5A3 | Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq, MIM# 612379; Kahrizi syndrome, MIM# 612713 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.162 | SRD5A3 | Zornitza Stark Publications for gene: SRD5A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.161 | SRD5A3 | Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.160 | SRD5A3 | Zornitza Stark reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323; Phenotypes: Congenital disorder of glycosylation, type Iq, MIM# 612379, Kahrizi syndrome, MIM# 612713; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2917 | KIF14 | Zornitza Stark Marked gene: KIF14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2917 | KIF14 | Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2917 | KIF14 | Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2916 | KIF14 | Zornitza Stark Publications for gene: KIF14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2915 | KIF14 | Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2914 | KIF14 | Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4088 | KIF14 | Zornitza Stark Marked gene: KIF14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4088 | KIF14 | Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4088 | KIF14 | Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914; Meckel syndrome 12, MIM# 616258 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4087 | KIF14 | Zornitza Stark Publications for gene: KIF14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4086 | KIF14 | Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4085 | KIF14 | Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805, 24128419; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914, Meckel syndrome 12, MIM# 616258; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.258 | KIF14 | Zornitza Stark Marked gene: KIF14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.258 | KIF14 | Zornitza Stark Gene: kif14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.258 | KIF14 | Zornitza Stark Phenotypes for gene: KIF14 were changed from to Microcephaly 20, primary, autosomal recessive, MIM# 617914 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.257 | KIF14 | Zornitza Stark Publications for gene: KIF14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.256 | KIF14 | Zornitza Stark Mode of inheritance for gene: KIF14 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.255 | KIF14 | Zornitza Stark reviewed gene: KIF14: Rating: GREEN; Mode of pathogenicity: None; Publications: 28892560, 29343805; Phenotypes: Microcephaly 20, primary, autosomal recessive, MIM# 617914; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4085 | KIF1BP | Zornitza Stark Marked gene: KIF1BP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4085 | KIF1BP | Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4085 | KIF1BP | Zornitza Stark Phenotypes for gene: KIF1BP were changed from to Goldberg-Shprintzen megacolon syndrome, MIM# 609460 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4084 | KIF1BP | Zornitza Stark Publications for gene: KIF1BP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4083 | KIF1BP | Zornitza Stark Mode of inheritance for gene: KIF1BP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4082 | KIF1BP | Zornitza Stark Tag new gene name tag was added to gene: KIF1BP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4082 | KIF1BP | Zornitza Stark reviewed gene: KIF1BP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23427148; Phenotypes: Goldberg-Shprintzen megacolon syndrome, MIM# 609460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.255 | KIF1BP | Zornitza Stark Marked gene: KIF1BP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.255 | KIF1BP | Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.255 | KIF1BP | Zornitza Stark Classified gene: KIF1BP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.255 | KIF1BP | Zornitza Stark Gene: kif1bp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.254 | KIF1BP | Zornitza Stark Tag new gene name tag was added to gene: KIF1BP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.254 | KIF1BP |
Zornitza Stark gene: KIF1BP was added gene: KIF1BP was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF1BP were set to 23427148 Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome, MIM# 609460 Review for gene: KIF1BP was set to GREEN Added comment: Autosomal recessive multiple congenital anomaly syndrome characterised by intellectual disability, microcephaly, and dysmorphic facial features. Most individuals also have Hirschsprung disease and/or gyral abnormalities of the brain, consistent with defects in migration of neural crest cells and neurons. Other features, such as megalocornea or urogenital anomalies, may also be present. Well established gene-disease association, multiple families reported. Note HGNC approved name is KIAA1279. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.253 | KLHL7 | Zornitza Stark Marked gene: KLHL7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.253 | KLHL7 | Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.253 | KLHL7 | Zornitza Stark Phenotypes for gene: KLHL7 were changed from to PERCHING syndrome, MIM# 617055 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.252 | KLHL7 | Zornitza Stark Publications for gene: KLHL7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.251 | KLHL7 | Zornitza Stark Mode of inheritance for gene: KLHL7 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.250 | KLHL7 | Zornitza Stark Classified gene: KLHL7 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.250 | KLHL7 | Zornitza Stark Gene: klhl7 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | KLHL7 | Zornitza Stark reviewed gene: KLHL7: Rating: AMBER; Mode of pathogenicity: None; Publications: 27392078, 29074562; Phenotypes: PERCHING syndrome, MIM# 617055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.31 | TRIP11 | Zornitza Stark Marked gene: TRIP11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.31 | TRIP11 | Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.31 | TRIP11 | Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Achondrogenesis, type IA, MIM# 200600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.30 | TRIP11 | Zornitza Stark Publications for gene: TRIP11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.29 | TRIP11 | Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal Dysplasia_Fetal v0.28 | TRIP11 | Zornitza Stark reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: 20089971; Phenotypes: Achondrogenesis, type IA, MIM# 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4082 | TRIP11 | Zornitza Stark Marked gene: TRIP11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4082 | TRIP11 | Zornitza Stark Gene: trip11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4082 | TRIP11 | Zornitza Stark Phenotypes for gene: TRIP11 were changed from to Osteochondrodysplasia, 184260; Achondrogenesis, type IA, 200600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4081 | TRIP11 | Zornitza Stark Publications for gene: TRIP11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4080 | TRIP11 | Zornitza Stark Mode of inheritance for gene: TRIP11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4079 | PRF1 | Zornitza Stark Marked gene: PRF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4079 | PRF1 | Zornitza Stark Added comment: Comment when marking as ready: Principal association is between bi-allelic variants and HLH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4079 | PRF1 | Zornitza Stark Gene: prf1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4079 | PRF1 | Zornitza Stark Phenotypes for gene: PRF1 were changed from to Aplastic anemia 609135; Hemophagocytic lymphohistiocytosis, familial, 2 603553; Lymphoma, non-Hodgkin 605027 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4078 | PRF1 | Zornitza Stark Publications for gene: PRF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4077 | PRF1 | Zornitza Stark Mode of inheritance for gene: PRF1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4076 | HLCS | Zornitza Stark Marked gene: HLCS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4076 | HLCS | Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4076 | HLCS | Zornitza Stark Phenotypes for gene: HLCS were changed from to Holocarboxylase synthetase deficiency, MIM# 253270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4075 | HLCS | Zornitza Stark Publications for gene: HLCS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4074 | HLCS | Zornitza Stark Mode of inheritance for gene: HLCS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4073 | HLCS | Zornitza Stark reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Holocarboxylase synthetase deficiency, MIM# 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4073 | CA5A | Zornitza Stark reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.471 | CA5A | Zornitza Stark Tag SV/CNV tag was added to gene: CA5A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4073 | CA5A | Zornitza Stark Marked gene: CA5A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4073 | CA5A | Zornitza Stark Gene: ca5a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4073 | CA5A | Zornitza Stark Phenotypes for gene: CA5A were changed from to Hyperammonemia due to carbonic anhydrase VA deficiency, 615751 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4072 | CA5A | Zornitza Stark Publications for gene: CA5A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4071 | CA5A | Zornitza Stark Mode of inheritance for gene: CA5A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4070 | CA5A | Zornitza Stark Tag SV/CNV tag was added to gene: CA5A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2914 | MOCS1 | Zornitza Stark Marked gene: MOCS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2914 | MOCS1 | Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2914 | MOCS1 | Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2913 | MOCS1 | Zornitza Stark Publications for gene: MOCS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2912 | MOCS1 | Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2911 | MOCS1 | Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.828 | MOCS1 | Zornitza Stark Marked gene: MOCS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.828 | MOCS1 | Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.828 | MOCS1 | Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.827 | MOCS1 | Zornitza Stark Publications for gene: MOCS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.826 | MOCS1 | Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.825 | MOCS1 | Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701, 21031595; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4070 | MOCS1 | Zornitza Stark Phenotypes for gene: MOCS1 were changed from to Molybdenum cofactor deficiency A, MIM# 252150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4069 | MOCS1 | Zornitza Stark Publications for gene: MOCS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4068 | MOCS1 | Zornitza Stark reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 9921896, 12754701; Phenotypes: Molybdenum cofactor deficiency A, MIM# 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4068 | MOCS1 | Zornitza Stark Mode of inheritance for gene: MOCS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4067 | OSR1 | Zornitza Stark Marked gene: OSR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4067 | OSR1 | Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4067 | OSR1 | Zornitza Stark Classified gene: OSR1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4067 | OSR1 | Zornitza Stark Gene: osr1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4066 | OSR1 | Zornitza Stark reviewed gene: OSR1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2911 | KDM1A | Zornitza Stark Marked gene: KDM1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2911 | KDM1A | Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2911 | KDM1A | Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2910 | KDM1A | Zornitza Stark Publications for gene: KDM1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2909 | KDM1A | Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2908 | KDM1A | Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4066 | KDM1A | Zornitza Stark reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 26656649, 24838796, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4066 | KDM1A | Zornitza Stark Marked gene: KDM1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4066 | KDM1A | Zornitza Stark Gene: kdm1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4066 | KDM1A | Zornitza Stark Phenotypes for gene: KDM1A were changed from to Cleft palate, psychomotor retardation, and distinctive facial features 616728; Multiple myeloma | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4065 | KDM1A | Zornitza Stark Mode of inheritance for gene: KDM1A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4064 | KDM1A | Zornitza Stark Publications for gene: KDM1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4063 | TRIP11 | Elena Savva reviewed gene: TRIP11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31903676, 30728324; Phenotypes: Osteochondrodysplasia, 184260, Achondrogenesis, type IA, 200600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4063 | COL11A1 | Zornitza Stark Marked gene: COL11A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4063 | COL11A1 | Zornitza Stark Gene: col11a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4063 | COL11A1 | Zornitza Stark Phenotypes for gene: COL11A1 were changed from to Fibrochondrogenesis 1 (MIM#228520); Marshall syndrome (MIM#154780); Stickler syndrome, type II (MIM#604841) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4062 | COL11A1 | Zornitza Stark Publications for gene: COL11A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4061 | PRF1 | Elena Savva reviewed gene: PRF1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 19487666; Phenotypes: Aplastic anemia 609135, Hemophagocytic lymphohistiocytosis, familial, 2 603553, Lymphoma, non-Hodgkin 605027; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4061 | COL11A1 | Zornitza Stark Mode of pathogenicity for gene: COL11A1 was changed from to Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4060 | COL11A1 | Zornitza Stark Mode of inheritance for gene: COL11A1 was changed from Unknown to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | HLCS | Elena Savva reviewed gene: HLCS: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 10190325; Phenotypes: Holocarboxylase synthetase deficiency, 253270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | CA5A | Elena Savva reviewed gene: CA5A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26913920, 32381389; Phenotypes: Hyperammonemia due to carbonic anhydrase VA deficiency, 615751; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | MOCS1 | Elena Savva reviewed gene: MOCS1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 21031595; Phenotypes: Molybdenum cofactor deficiency A 252150; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | KDM1A | Elena Savva reviewed gene: KDM1A: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 29559475, 27094131; Phenotypes: Cleft palate, psychomotor retardation, and distinctive facial features 616728, Multiple myeloma; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | COL11A1 | Elena Savva reviewed gene: COL11A1: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID 25073711, 30245514, 32427345, 27081569, 21035103; Phenotypes: Fibrochondrogenesis 1 (MIM#228520), Marshall syndrome (MIM#154780), Stickler syndrome, type II (MIM#604841), {Lumbar disc herniation, susceptibility to}, (MIM#603932), ?Deafness, autosomal dominant 37, (MIM#618533); Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliary Dyskinesia v0.123 | GAS2L2 | Zornitza Stark Classified gene: GAS2L2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliary Dyskinesia v0.123 | GAS2L2 | Zornitza Stark Gene: gas2l2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | GON7 | Zornitza Stark Tag founder tag was added to gene: GON7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | GON7 | Zornitza Stark Tag founder tag was added to gene: GON7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | GON7 | Zornitza Stark Tag founder tag was added to gene: GON7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | YRDC | Zornitza Stark Marked gene: YRDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | YRDC | Zornitza Stark Classified gene: YRDC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.249 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | YRDC | Zornitza Stark Marked gene: YRDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | YRDC | Zornitza Stark Classified gene: YRDC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.130 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | YRDC | Zornitza Stark Marked gene: YRDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.248 | YRDC |
Zornitza Stark gene: YRDC was added gene: YRDC was added to Microcephaly. Sources: Literature Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YRDC were set to 31481669 Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome Review for gene: YRDC was set to GREEN Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | YRDC | Zornitza Stark Classified gene: YRDC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4059 | YRDC | Zornitza Stark Gene: yrdc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.129 | YRDC |
Zornitza Stark gene: YRDC was added gene: YRDC was added to Proteinuria. Sources: Literature Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YRDC were set to 31481669 Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome Review for gene: YRDC was set to GREEN Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4058 | YRDC |
Zornitza Stark gene: YRDC was added gene: YRDC was added to Mendeliome. Sources: Literature Mode of inheritance for gene: YRDC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: YRDC were set to 31481669 Phenotypes for gene: YRDC were set to Galloway-Mowat syndrome Review for gene: YRDC was set to GREEN Added comment: Three individuals from two unrelated families with typical features of Galloway-Mowat syndrome including proteinuria, microcephaly, developmental delay and brain malformations. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4057 | GON7 | Zornitza Stark Marked gene: GON7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4057 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4057 | GON7 | Zornitza Stark Classified gene: GON7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4057 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4056 | GON7 |
Zornitza Stark gene: GON7 was added gene: GON7 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GON7 were set to 31481669 Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome Review for gene: GON7 was set to GREEN Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.247 | GON7 | Zornitza Stark Marked gene: GON7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.247 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.247 | GON7 | Zornitza Stark Classified gene: GON7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.247 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.246 | GON7 |
Zornitza Stark gene: GON7 was added gene: GON7 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GON7 were set to 31481669 Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome Review for gene: GON7 was set to GREEN Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.128 | GON7 | Zornitza Stark Marked gene: GON7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.128 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.128 | GON7 | Zornitza Stark Classified gene: GON7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.128 | GON7 | Zornitza Stark Gene: gon7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.127 | GON7 |
Zornitza Stark gene: GON7 was added gene: GON7 was added to Proteinuria. Sources: Literature Mode of inheritance for gene: GON7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GON7 were set to 31481669 Phenotypes for gene: GON7 were set to Galloway-Mowat syndrome Review for gene: GON7 was set to GREEN Added comment: 11 individuals from 5 families. Four of the families had the same homozygous variant, shared haplotype suggestive of founder effect. Clinical features included proteinuria, microcephaly, brain malformations and developmental delay. Supportive functional data. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.126 | LAGE3 | Zornitza Stark Marked gene: LAGE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.126 | LAGE3 | Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.126 | LAGE3 | Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.125 | LAGE3 | Zornitza Stark Publications for gene: LAGE3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.124 | LAGE3 | Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.123 | LAGE3 | Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4055 | LAGE3 | Zornitza Stark Marked gene: LAGE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4055 | LAGE3 | Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4055 | LAGE3 | Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4054 | LAGE3 | Zornitza Stark Publications for gene: LAGE3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4053 | LAGE3 | Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4052 | LAGE3 | Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.245 | LAGE3 | Zornitza Stark Marked gene: LAGE3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.245 | LAGE3 | Zornitza Stark Gene: lage3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.245 | LAGE3 | Zornitza Stark Phenotypes for gene: LAGE3 were changed from to Galloway-Mowat syndrome 2, X-linked, MIM# 301006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.244 | LAGE3 | Zornitza Stark Publications for gene: LAGE3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.243 | LAGE3 | Zornitza Stark Mode of inheritance for gene: LAGE3 was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.242 | LAGE3 | Zornitza Stark reviewed gene: LAGE3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828; Phenotypes: Galloway-Mowat syndrome 2, X-linked, MIM# 301006; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4052 | LINGO1 | Zornitza Stark Marked gene: LINGO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4052 | LINGO1 | Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4052 | LINGO1 | Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4051 | LINGO1 | Zornitza Stark Publications for gene: LINGO1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4050 | LINGO1 | Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4049 | LINGO1 | Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4049 | LINGO1 | Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4048 | LINGO1 | Zornitza Stark reviewed gene: LINGO1: Rating: AMBER; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.242 | LINGO1 | Zornitza Stark Marked gene: LINGO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.242 | LINGO1 | Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.242 | LINGO1 | Zornitza Stark Phenotypes for gene: LINGO1 were changed from to Mental retardation, autosomal recessive 64, MIM# 618103 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.241 | LINGO1 | Zornitza Stark Publications for gene: LINGO1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.240 | LINGO1 | Zornitza Stark Mode of inheritance for gene: LINGO1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.239 | LINGO1 | Zornitza Stark Classified gene: LINGO1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.239 | LINGO1 | Zornitza Stark Gene: lingo1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.238 | LINGO1 | Zornitza Stark edited their review of gene: LINGO1: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.238 | LINGO1 | Zornitza Stark reviewed gene: LINGO1: Rating: ; Mode of pathogenicity: None; Publications: 31668702; Phenotypes: Mental retardation, autosomal recessive 64, MIM# 618103; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.123 | TRIM8 | Tiong Tan Marked gene: TRIM8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.123 | TRIM8 | Tiong Tan Gene: trim8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.123 | TRIM8 | Tiong Tan Classified gene: TRIM8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.123 | TRIM8 | Tiong Tan Gene: trim8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.122 | TRIM8 |
Tiong Tan gene: TRIM8 was added gene: TRIM8 was added to Proteinuria. Sources: Literature Mode of inheritance for gene: TRIM8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRIM8 were set to 30244534; 32193649 Phenotypes for gene: TRIM8 were set to intellectual disability; epileptic encephalopathy; nephrotic syndrome; proteinuria Penetrance for gene: TRIM8 were set to Complete Review for gene: TRIM8 was set to GREEN Added comment: ~50% affected individuals have proteinuria, one confirmed with FSGS Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.121 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.121 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.121 | OSGEP | Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.120 | OSGEP | Zornitza Stark Publications for gene: OSGEP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.119 | OSGEP | Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.118 | OSGEP | Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.238 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.238 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4048 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4048 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4048 | OSGEP | Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4047 | OSGEP | Zornitza Stark Publications for gene: OSGEP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4046 | OSGEP | Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4045 | OSGEP | Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.238 | OSGEP | Zornitza Stark Phenotypes for gene: OSGEP were changed from to Galloway-Mowat syndrome 3, MIM# 617729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.237 | OSGEP | Zornitza Stark Publications for gene: OSGEP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.236 | OSGEP | Zornitza Stark Mode of inheritance for gene: OSGEP was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.235 | OSGEP | Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4045 | NUP107 | Zornitza Stark Tag founder tag was added to gene: NUP107. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.118 | NUP107 | Zornitza Stark Marked gene: NUP107 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.118 | NUP107 | Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.118 | NUP107 | Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.117 | NUP107 | Zornitza Stark Publications for gene: NUP107 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.116 | NUP107 | Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.115 | NUP107 | Zornitza Stark Tag founder tag was added to gene: NUP107. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proteinuria v0.115 | NUP107 | Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4045 | NUP107 | Zornitza Stark Marked gene: NUP107 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4045 | NUP107 | Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4045 | NUP107 | Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4044 | NUP107 | Zornitza Stark Publications for gene: NUP107 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4043 | NUP107 | Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4042 | NUP107 | Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.235 | NUP107 | Zornitza Stark Marked gene: NUP107 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.235 | NUP107 | Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.235 | NUP107 | Zornitza Stark Tag founder tag was added to gene: NUP107. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.235 | NUP107 | Zornitza Stark Phenotypes for gene: NUP107 were changed from to Galloway-Mowat syndrome 7, MIM# 618348 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.234 | NUP107 | Zornitza Stark Publications for gene: NUP107 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.233 | NUP107 | Zornitza Stark Mode of inheritance for gene: NUP107 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.232 | NUP107 | Zornitza Stark reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065; Phenotypes: Galloway-Mowat syndrome 7, MIM# 618348; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.232 | VRK1 | Zornitza Stark Marked gene: VRK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.232 | VRK1 | Zornitza Stark Gene: vrk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.232 | VRK1 | Zornitza Stark Phenotypes for gene: VRK1 were changed from to Pontocerebellar hypoplasia type 1A MIM#607596 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.231 | VRK1 | Zornitza Stark Publications for gene: VRK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.230 | VRK1 | Zornitza Stark Mode of inheritance for gene: VRK1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.229 | BRD4 | Zornitza Stark Marked gene: BRD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.229 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.229 | BRD4 | Zornitza Stark Tag SV/CNV tag was added to gene: BRD4. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.229 | BRD4 | Zornitza Stark Phenotypes for gene: BRD4 were changed from to Cornelia de Lange-like syndrome | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.228 | BRD4 | Zornitza Stark Publications for gene: BRD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.227 | BRD4 | Zornitza Stark Mode of inheritance for gene: BRD4 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.226 | BRD4 | Zornitza Stark Classified gene: BRD4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.226 | BRD4 | Zornitza Stark Gene: brd4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.225 | WDR4 | Zornitza Stark Marked gene: WDR4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.225 | WDR4 | Zornitza Stark Gene: wdr4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.225 | WDR4 | Zornitza Stark Phenotypes for gene: WDR4 were changed from to Galloway-Mowat syndrome 6 MIM#618347 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.224 | WDR4 | Zornitza Stark Publications for gene: WDR4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.223 | WDR4 | Zornitza Stark Mode of inheritance for gene: WDR4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2908 | NSD2 | Zornitza Stark Marked gene: NSD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2908 | NSD2 | Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2908 | NSD2 | Zornitza Stark Publications for gene: NSD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2907 | NSD2 | Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.222 | NSD2 | Zornitza Stark Marked gene: NSD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.222 | NSD2 | Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2906 | NSD2 | Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2905 | NSD2 | Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4042 | NSD2 | Zornitza Stark Marked gene: NSD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4042 | NSD2 | Zornitza Stark Gene: nsd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4042 | NSD2 | Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4041 | NSD2 | Zornitza Stark Publications for gene: NSD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4040 | NSD2 | Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4039 | NSD2 | Zornitza Stark changed review comment from: Microcephaly reported in 6 of 7 individuals with LOF variants in this gene.; to: 7 individuals with LOF variants in this gene, gene thought to be responsible for key features of Wolf-Hirschorn syndrome. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4039 | NSD2 | Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.222 | NSD2 | Zornitza Stark Phenotypes for gene: NSD2 were changed from to Microcephaly; intellectual disability | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.221 | NSD2 | Zornitza Stark Publications for gene: NSD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.220 | NSD2 | Zornitza Stark Mode of inheritance for gene: NSD2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.219 | NSD2 | Zornitza Stark reviewed gene: NSD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30345613, 31171569; Phenotypes: Microcephaly, intellectual disability; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.219 | NIPBL | Zornitza Stark Marked gene: NIPBL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.219 | NIPBL | Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.219 | NIPBL | Zornitza Stark Classified gene: NIPBL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.219 | NIPBL | Zornitza Stark Gene: nipbl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.218 | VRK1 | Paul De Fazio reviewed gene: VRK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19646678, 24126608, 27281532, 31560180; Phenotypes: Pontocerebellar hypoplasia type 1A MIM#607596; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.218 | NIPBL |
Zornitza Stark gene: NIPBL was added gene: NIPBL was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome 1, MIM# 122470 Review for gene: NIPBL was set to GREEN Added comment: Well established gene-disease association, microcephaly is a prominent feature of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4039 | NCAPH | Zornitza Stark Marked gene: NCAPH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4039 | NCAPH | Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4039 | NCAPH | Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4038 | NCAPH | Zornitza Stark Publications for gene: NCAPH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4037 | NCAPH | Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4036 | NCAPH | Zornitza Stark Classified gene: NCAPH as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4036 | NCAPH | Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4035 | NCAPH | Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.217 | NCAPH | Zornitza Stark Marked gene: NCAPH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.217 | NCAPH | Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.217 | NCAPH | Zornitza Stark Phenotypes for gene: NCAPH were changed from to Microcephaly 23, primary, autosomal recessive 617985 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.216 | NCAPH | Zornitza Stark Publications for gene: NCAPH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.215 | NCAPH | Zornitza Stark Mode of inheritance for gene: NCAPH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.214 | NCAPH | Zornitza Stark Classified gene: NCAPH as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.214 | NCAPH | Zornitza Stark Gene: ncaph has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | NCAPH | Zornitza Stark reviewed gene: NCAPH: Rating: RED; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 23, primary, autosomal recessive 617985; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | BRD4 | Ain Roesley reviewed gene: BRD4: Rating: AMBER; Mode of pathogenicity: None; Publications: 29379197, 30302754; Phenotypes: Cornelia de Lange-like syndrome; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | WDR4 | Paul De Fazio reviewed gene: WDR4: Rating: GREEN; Mode of pathogenicity: None; Publications: 26416026, 28617965, 30079490, 29597095; Phenotypes: Galloway-Mowat syndrome 6 MIM#618347; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | NCAPD3 | Zornitza Stark Marked gene: NCAPD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | NCAPD3 | Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.213 | NCAPD3 | Zornitza Stark Phenotypes for gene: NCAPD3 were changed from to Microcephaly 22, primary, autosomal recessive, MIM# 617984 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.212 | NCAPD3 | Zornitza Stark Publications for gene: NCAPD3 were set to 27737959 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.211 | BRCA2 | Zornitza Stark Marked gene: BRCA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.211 | BRCA2 | Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.211 | BRCA2 | Zornitza Stark Classified gene: BRCA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.211 | BRCA2 | Zornitza Stark Gene: brca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.210 | BRCA2 |
Ain Roesley gene: BRCA2 was added gene: BRCA2 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: BRCA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BRCA2 were set to Fanconi anemia, complementation group D1 (MIM#605724) Penetrance for gene: BRCA2 were set to unknown Review for gene: BRCA2 was set to GREEN Added comment: Approx 75% of FA patients present with microcephaly and approx 3% of FA patients have variants in BRCA2 (GeneReviews) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4035 | ATRIP | Zornitza Stark Marked gene: ATRIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4035 | ATRIP | Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4035 | ATRIP | Zornitza Stark Classified gene: ATRIP as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4035 | ATRIP | Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.210 | WDR73 | Zornitza Stark Marked gene: WDR73 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.210 | WDR73 | Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.210 | WDR73 | Zornitza Stark Classified gene: WDR73 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.210 | WDR73 | Zornitza Stark Gene: wdr73 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.209 | BLM | Zornitza Stark Marked gene: BLM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.209 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.209 | BLM | Zornitza Stark Publications for gene: BLM were set to 30214071 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.208 | BLM | Zornitza Stark Classified gene: BLM as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.208 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.207 | WDR37 | Zornitza Stark Marked gene: WDR37 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.207 | WDR37 | Zornitza Stark Gene: wdr37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.207 | WDR37 | Zornitza Stark Phenotypes for gene: WDR37 were changed from to Neurooculocardiogenitourinary syndrome MIM#618652 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.206 | WDR37 | Zornitza Stark Publications for gene: WDR37 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.205 | WDR37 | Zornitza Stark Mode of inheritance for gene: WDR37 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.204 | ZNF335 | Zornitza Stark Marked gene: ZNF335 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.204 | ZNF335 | Zornitza Stark Gene: znf335 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.204 | ZNF335 | Zornitza Stark Phenotypes for gene: ZNF335 were changed from to Microcephaly 10, primary, autosomal recessive (MIM#615095) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.204 | WDR37 | Paul De Fazio reviewed gene: WDR37: Rating: GREEN; Mode of pathogenicity: None; Publications: 31327508, 31327510; Phenotypes: Neurooculocardiogenitourinary syndrome MIM#618652; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.204 | ZNF335 | Zornitza Stark Publications for gene: ZNF335 were set to 23178126; 27540107; 29652087 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.203 | BLM |
Ain Roesley edited their review of gene: BLM: Added comment: Microcephaly is a feature of Bloom Syndrome PMID: 30214071; - in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant PMID: 29056561 - 1x proband. At 36 yrs of age her head circumference was 47.8cm (-6.2SD) PMID: 23928670; - 1x patient of a consanguineous Dutch family. At 4 years of age: head circumference 45.9 cm (3.2 SDS). Homozygous nonsense - 1x patient of a consanguineous Turkish family. At 5 years of age: head circumference 46.3 cm (2.7 SDS). Homozygous nonsense PMID: 25129257; - 1 family with 3 affecteds. 1 had a head circumference of -4SD. Homozygous fs; Changed rating: GREEN; Changed publications: 30214071, 29056561, 23928670; Changed phenotypes: Bloom syndrome (MIM#210900) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.203 | ZNF335 | Zornitza Stark Publications for gene: ZNF335 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.203 | NCAPD3 | Zornitza Stark Publications for gene: NCAPD3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.202 | ZNF335 | Zornitza Stark Mode of inheritance for gene: ZNF335 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.201 | NCAPD3 | Zornitza Stark Mode of inheritance for gene: NCAPD3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.200 | NCAPD3 | Zornitza Stark Classified gene: NCAPD3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.200 | NCAPD3 | Zornitza Stark Gene: ncapd3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.199 | NCAPD3 | Zornitza Stark reviewed gene: NCAPD3: Rating: AMBER; Mode of pathogenicity: None; Publications: 27737959; Phenotypes: Microcephaly 22, primary, autosomal recessive, MIM# 617984; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.199 | NACC1 | Zornitza Stark Marked gene: NACC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.199 | NACC1 | Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.199 | NACC1 | Zornitza Stark Phenotypes for gene: NACC1 were changed from to Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.198 | NACC1 | Zornitza Stark Publications for gene: NACC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.197 | NACC1 | Zornitza Stark Mode of inheritance for gene: NACC1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.196 | NACC1 | Zornitza Stark Classified gene: NACC1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.196 | NACC1 | Zornitza Stark Gene: nacc1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | NACC1 | Zornitza Stark reviewed gene: NACC1: Rating: AMBER; Mode of pathogenicity: None; Publications: 28132692; Phenotypes: Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination , MIM#617393; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | MYCN | Zornitza Stark edited their review of gene: MYCN: Changed rating: GREEN; Changed phenotypes: Feingold syndrome 1, MIM# 164280 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | MYCN | Zornitza Stark Marked gene: MYCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | MYCN | Zornitza Stark Gene: mycn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | MYCN | Zornitza Stark Classified gene: MYCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.195 | MYCN | Zornitza Stark Gene: mycn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.194 | MYCN |
Zornitza Stark gene: MYCN was added gene: MYCN was added to Microcephaly. Sources: Expert list Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: MYCN were set to 18470948 Phenotypes for gene: MYCN were set to Feingold syndrome 1, MIM# 164280 Added comment: Well established gene-disease association, microcephaly is a key feature. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.193 | MRE11 | Zornitza Stark Marked gene: MRE11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.193 | MRE11 | Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.193 | MRE11 | Zornitza Stark Phenotypes for gene: MRE11 were changed from to Nijmegen breakage syndrome-like severe microcephaly | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.192 | MRE11 | Zornitza Stark Publications for gene: MRE11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.191 | ZNF335 | Paul De Fazio reviewed gene: ZNF335: Rating: GREEN; Mode of pathogenicity: None; Publications: 23178126, 27540107, 29652087; Phenotypes: Microcephaly 10, primary, autosomal recessive (MIM#615095); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.191 | MRE11 | Zornitza Stark Mode of inheritance for gene: MRE11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.190 | MRE11 | Zornitza Stark Classified gene: MRE11 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.190 | MRE11 | Zornitza Stark Gene: mre11 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.189 | MRE11 | Zornitza Stark reviewed gene: MRE11: Rating: AMBER; Mode of pathogenicity: None; Publications: 21227757; Phenotypes: Nijmegen breakage syndrome-like severe microcephaly; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.189 | BLM | Ain Roesley Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.189 | MED17 | Zornitza Stark Marked gene: MED17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.189 | MED17 | Zornitza Stark Gene: med17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.189 | MED17 | Zornitza Stark Phenotypes for gene: MED17 were changed from to Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.188 | WDR73 |
Paul De Fazio gene: WDR73 was added gene: WDR73 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: WDR73 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WDR73 were set to 25466283; 26123727; 25873735; 26070982; 30315938 Phenotypes for gene: WDR73 were set to Galloway-Mowat syndrome 1 MIM#251300 Review for gene: WDR73 was set to GREEN gene: WDR73 was marked as current diagnostic Added comment: Summary: many individuals with progressive microcephaly reported, though only a few (4 families) with head circumference -3SD. PMID 25466283: Three affected children from two families with LoF variants. All had progressive microcephaly among other phenotypes (e.g. facial dysmorphisms, brain MRI anomalies). Head circumferences were -3SD at 5yo, -2.5SD at 2yo, -3SD at 10yo. PMID 26123727: 9 individuals from 4 families with "Microcephaly (< 3rd centile)" and biallelic variants, ranging in age from 2.5yo to 31yo. PMID 26070982: describes 30 Amish individuals with the same homozygous LoF variant, 80% of whom (24 individuals) had head circumference <-2SD. PMID 25873735: 2 sibs with biallelic LoF variants and head circumference -1.8SD at 12yo and −1.15SD at 5yo respectively. PMID 30315938: 2 families with homozygous missense variants. All had postnatal microcephaly: -2.5SD, -4,5SD, -3,8SD from 1 family and -3 SD from the other. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.188 | MED17 | Zornitza Stark Publications for gene: MED17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.187 | MED17 | Zornitza Stark Mode of inheritance for gene: MED17 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.186 | MED17 | Zornitza Stark reviewed gene: MED17: Rating: GREEN; Mode of pathogenicity: None; Publications: 20950787, 30345598, 26004231; Phenotypes: Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM# 613668; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.186 | MECP2 | Zornitza Stark Marked gene: MECP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.186 | MECP2 | Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.186 | MECP2 | Zornitza Stark Phenotypes for gene: MECP2 were changed from to Rett syndrome, MIM# 312750; Encephalopathy, neonatal severe 300673 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.185 | MECP2 | Zornitza Stark Mode of inheritance for gene: MECP2 was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.184 | MECP2 | Zornitza Stark reviewed gene: MECP2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Rett syndrome, MIM# 312750, Encephalopathy, neonatal severe 300673; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4034 | ATRIP |
Ain Roesley gene: ATRIP was added gene: ATRIP was added to Mendeliome. Sources: Literature Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATRIP were set to 23144622 Phenotypes for gene: ATRIP were set to Seckel Syndrome Penetrance for gene: ATRIP were set to unknown Review for gene: ATRIP was set to RED Added comment: PMID: 23144622; - 1x proband from a consanguineous family - progressive severe microcephaly (-9 to -10SD) - cHet for a nonsense and a splice Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.184 | ATRIP | Zornitza Stark Marked gene: ATRIP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.184 | ATRIP | Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.184 | ATRIP | Zornitza Stark Classified gene: ATRIP as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.184 | ATRIP | Zornitza Stark Gene: atrip has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.183 | ATP1A2 | Zornitza Stark Marked gene: ATP1A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.183 | ATP1A2 | Zornitza Stark Gene: atp1a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.183 | ATP1A2 | Zornitza Stark Phenotypes for gene: ATP1A2 were changed from to hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.182 | ATP1A2 | Zornitza Stark Publications for gene: ATP1A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.181 | ATP1A2 | Zornitza Stark Mode of inheritance for gene: ATP1A2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.180 | ARCN1 | Zornitza Stark Marked gene: ARCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.180 | ARCN1 | Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green. Microcephaly is a key part of the phenotype but few measurements actually reported. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.180 | ARCN1 | Zornitza Stark Gene: arcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.180 | ARCN1 | Zornitza Stark Phenotypes for gene: ARCN1 were changed from to Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.179 | ARCN1 | Zornitza Stark Publications for gene: ARCN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.178 | ARCN1 | Zornitza Stark Mode of inheritance for gene: ARCN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.177 | AP4S1 | Zornitza Stark Marked gene: AP4S1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.177 | AP4S1 | Zornitza Stark Added comment: Comment when marking as ready: Borderline Amber/Green as only one affected individual <-3SD; however, part of same gene family as other spastic paraplegias with microcephaly. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.177 | AP4S1 | Zornitza Stark Gene: ap4s1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.177 | AP4S1 | Zornitza Stark Phenotypes for gene: AP4S1 were changed from to Spastic paraplegia 52, autosomal recessive (MIM#614067) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.176 | AP4S1 | Zornitza Stark Publications for gene: AP4S1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.175 | AP4S1 | Zornitza Stark Mode of inheritance for gene: AP4S1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.174 | AP4M1 | Zornitza Stark Marked gene: AP4M1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.174 | AP4M1 | Zornitza Stark Gene: ap4m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.174 | AP4M1 | Zornitza Stark Phenotypes for gene: AP4M1 were changed from to Spastic paraplegia 50, autosomal recessive (MIM#612936) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.173 | AP4M1 | Zornitza Stark Publications for gene: AP4M1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.172 | AP4M1 | Zornitza Stark Mode of inheritance for gene: AP4M1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | BLM |
Ain Roesley gene: BLM was added gene: BLM was added to Microcephaly. Sources: Literature Mode of inheritance for gene: BLM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BLM were set to 30214071 Phenotypes for gene: BLM were set to Bloom syndrome (MIM#210900) Penetrance for gene: BLM were set to unknown Review for gene: BLM was set to RED Added comment: Microcephaly is a feature of Bloom Syndrome, however there is limited evidence for the association of microcephaly with BLM gene specifically. PMID: 30214071; in a cohort of microcephalic patients (<=-2SD), 1 family with 2 affecteds are homozygous for a nonsense variant Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | ATRIP |
Ain Roesley gene: ATRIP was added gene: ATRIP was added to Microcephaly. Sources: Literature Mode of inheritance for gene: ATRIP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ATRIP were set to 23144622 Phenotypes for gene: ATRIP were set to Seckel Syndrome Penetrance for gene: ATRIP were set to unknown Review for gene: ATRIP was set to RED Added comment: PMID: 23144622; - 1x proband from a consanguineous family - progressive severe microcephaly (-9 to -10SD) - cHet for a nonsense and a splice Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | ATP1A2 | Ain Roesley reviewed gene: ATP1A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30690204, 31608932; Phenotypes: hydrops fetalis, microcephaly, arthrogryposis and extensive cortical malformations; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | ARCN1 | Ain Roesley reviewed gene: ARCN1: Rating: AMBER; Mode of pathogenicity: None; Publications: 27476655; Phenotypes: Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AP4S1 | Ain Roesley reviewed gene: AP4S1: Rating: AMBER; Mode of pathogenicity: None; Publications: 21620353, 25552650, 27444738; Phenotypes: Spastic paraplegia 52, autosomal recessive (MIM#614067); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AP4M1 | Ain Roesley edited their review of gene: AP4M1: Changed publications: 28464862, 24700674 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AP4M1 |
Ain Roesley changed review comment from: PMID: 28464862; - 1x with severe progressive microcephaly (< - 4 SD) - homozygous nonsense PMID: 24700674; - 2x unrelated patients (1 and 3) < -3 SD head circumference - 2x homozygous nonsense PMID: 21620353 ; - 3 families with 4 affecteds ( < -3 SD) - all PTVs; to: PMID: 28464862; - 1x with severe progressive microcephaly (< - 4 SD) - homozygous nonsense PMID: 24700674; - 2x unrelated patients (1 and 3) < -3 SD head circumference - 2x homozygous nonsense |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AP4M1 | Ain Roesley reviewed gene: AP4M1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28464862, 24700674, 21620353; Phenotypes: Spastic paraplegia 50, autosomal recessive (MIM#612936); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AKT3 | Zornitza Stark changed review comment from: Activating variants in AKT2 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance.; to: Activating variants in AKT3 and micro duplications are associated with macrocephaly/megalencephaly. Note that deletions involving AKT3 have consistently been associated with microcephaly. However, most involve at least one other gene apart from AKT3. One family reported with only AKT3 deleted: deletion was inherited from a phenotypically normal parent, suggesting either additional effects in bigger deletions or incomplete penetrance. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AKT3 | Zornitza Stark Marked gene: AKT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AKT3 | Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.171 | AKT3 | Zornitza Stark Phenotypes for gene: AKT3 were changed from to Microcephaly | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.170 | AKT3 | Zornitza Stark Publications for gene: AKT3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.169 | AKT3 | Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.168 | AKT3 | Zornitza Stark Classified gene: AKT3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.168 | AKT3 | Zornitza Stark Gene: akt3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.167 | AKT3 | Zornitza Stark Tag SV/CNV tag was added to gene: AKT3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.167 | AKT3 | Zornitza Stark reviewed gene: AKT3: Rating: AMBER; Mode of pathogenicity: None; Publications: 32827175, 31929334, 30853971, 30053339, 25424989; Phenotypes: Microcephaly; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2905 | AP4E1 | Zornitza Stark Marked gene: AP4E1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2905 | AP4E1 | Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2905 | AP4E1 | Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2904 | AP4E1 | Zornitza Stark Publications for gene: AP4E1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2903 | AP4E1 | Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2902 | AP4E1 | Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.24 | AP4E1 | Zornitza Stark Marked gene: AP4E1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.24 | AP4E1 | Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.24 | AP4E1 | Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.23 | AP4E1 | Zornitza Stark Publications for gene: AP4E1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.22 | AP4E1 | Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.21 | AP4E1 | Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4034 | AP4E1 | Zornitza Stark Marked gene: AP4E1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4034 | AP4E1 | Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4034 | AP4E1 | Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4033 | AP4E1 | Zornitza Stark Publications for gene: AP4E1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4032 | AP4E1 | Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4031 | AP4E1 | Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.167 | AP4E1 | Zornitza Stark Marked gene: AP4E1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.167 | AP4E1 | Zornitza Stark Gene: ap4e1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.167 | AP4E1 | Zornitza Stark Phenotypes for gene: AP4E1 were changed from to Spastic paraplegia 51, autosomal recessive, MIM# 613744 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.166 | AP4E1 | Zornitza Stark Publications for gene: AP4E1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.165 | AP4E1 | Zornitza Stark Mode of inheritance for gene: AP4E1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.164 | AP4E1 | Zornitza Stark reviewed gene: AP4E1: Rating: GREEN; Mode of pathogenicity: None; Publications: 20972249, 21620353, 21937992; Phenotypes: Spastic paraplegia 51, autosomal recessive, MIM# 613744; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.21 | AP4B1 | Zornitza Stark Marked gene: AP4B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.21 | AP4B1 | Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.21 | AP4B1 | Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.20 | AP4B1 | Zornitza Stark Publications for gene: AP4B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.19 | AP4B1 | Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebral Palsy v0.18 | AP4B1 | Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4031 | AP4B1 | Zornitza Stark Marked gene: AP4B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4031 | AP4B1 | Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4031 | AP4B1 | Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4030 | AP4B1 | Zornitza Stark Publications for gene: AP4B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4029 | AP4B1 | Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4028 | AP4B1 | Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.164 | AP4B1 | Zornitza Stark Marked gene: AP4B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.164 | AP4B1 | Zornitza Stark Gene: ap4b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.164 | AP4B1 | Zornitza Stark Phenotypes for gene: AP4B1 were changed from to Spastic paraplegia 47, autosomal recessive, MIM# 614066 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.163 | AP4B1 | Zornitza Stark Publications for gene: AP4B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.162 | AP4B1 | Zornitza Stark Mode of inheritance for gene: AP4B1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.161 | AP4B1 | Zornitza Stark reviewed gene: AP4B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 21620353, 22290197, 24700674, 24781758; Phenotypes: Spastic paraplegia 47, autosomal recessive, MIM# 614066; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4028 | ANKLE2 | Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.161 | ANKLE2 | Zornitza Stark Marked gene: ANKLE2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.161 | ANKLE2 | Zornitza Stark Gene: ankle2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.161 | ANKLE2 | Zornitza Stark Phenotypes for gene: ANKLE2 were changed from to Microcephaly 16, primary, autosomal recessive, MIM# 616681 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.160 | ANKLE2 | Zornitza Stark Publications for gene: ANKLE2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.159 | ANKLE2 | Zornitza Stark Mode of inheritance for gene: ANKLE2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.158 | ANKLE2 | Zornitza Stark reviewed gene: ANKLE2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25259927, 30214071, 31735666; Phenotypes: Microcephaly 16, primary, autosomal recessive, MIM# 616681; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4028 | TSEN2 | Zornitza Stark Marked gene: TSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4028 | TSEN2 | Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.148 | TSEN2 | Zornitza Stark Marked gene: TSEN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.148 | TSEN2 | Zornitza Stark Gene: tsen2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.148 | TSEN2 | Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.147 | TSEN2 | Zornitza Stark Publications for gene: TSEN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.146 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cerebellar and Pontocerebellar Hypoplasia v0.145 | TSEN2 | Zornitza Stark reviewed gene: TSEN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23562994, 20952379; Phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4028 | TSEN2 | Zornitza Stark Phenotypes for gene: TSEN2 were changed from to Pontocerebellar hypoplasia type 2B, MIM# 612389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4027 | TSEN2 | Zornitza Stark Publications for gene: TSEN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4026 | TSEN2 | Zornitza Stark Mode of inheritance for gene: TSEN2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4025 | TSEN2 | Zornitza Stark edited their review of gene: TSEN2: Added comment: At least 3 unrelated families reported.; Changed rating: GREEN; Changed publications: 23562994, 20952379; Changed phenotypes: Pontocerebellar hypoplasia type 2B, MIM# 612389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4025 | TSEN2 | Zornitza Stark Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.4 | ZSWIM6 | Zornitza Stark Marked gene: ZSWIM6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.4 | ZSWIM6 | Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.4 | ZSWIM6 | Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Acromelic frontonasal dysostosis, MIM# 603671 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.3 | ZSWIM6 | Zornitza Stark Publications for gene: ZSWIM6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.2 | ZSWIM6 | Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Frontonasal dysplasia v0.1 | ZSWIM6 | Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25105228, 26706854; Phenotypes: Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4025 | ZSWIM6 | Zornitza Stark Marked gene: ZSWIM6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4025 | ZSWIM6 | Zornitza Stark Gene: zswim6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4025 | ZSWIM6 | Zornitza Stark Phenotypes for gene: ZSWIM6 were changed from to Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865; Acromelic frontonasal dysostosis, MIM# 603671 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4024 | ZSWIM6 | Zornitza Stark Publications for gene: ZSWIM6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4023 | ZSWIM6 | Zornitza Stark Mode of inheritance for gene: ZSWIM6 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4022 | ZSWIM6 | Zornitza Stark reviewed gene: ZSWIM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 29198722, 25105228, 26706854; Phenotypes: Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865, Acromelic frontonasal dysostosis, MIM# 603671; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.177 | ABCB11 | Zornitza Stark Publications for gene: ABCB11 were set to 23141890 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cholestasis v0.176 | ABCB11 | Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4022 | ABCB11 | Zornitza Stark Marked gene: ABCB11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4022 | ABCB11 | Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4022 | ABCB11 | Zornitza Stark Phenotypes for gene: ABCB11 were changed from to Cholestasis, progressive familial intrahepatic 2, MIM# 601847; Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4021 | ABCB11 | Zornitza Stark Publications for gene: ABCB11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4020 | ABCB11 | Zornitza Stark Mode of inheritance for gene: ABCB11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4019 | ABCB11 | Zornitza Stark reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4019 | ABCB1 | Zornitza Stark Marked gene: ABCB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4019 | ABCB1 | Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4019 | ABCB1 | Zornitza Stark Phenotypes for gene: ABCB1 were changed from to {Inflammatory bowel disease 13} 612244 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4018 | ABCB1 | Zornitza Stark Publications for gene: ABCB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4017 | ABCB1 | Zornitza Stark Mode of inheritance for gene: ABCB1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4016 | ABCB1 | Zornitza Stark Classified gene: ABCB1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4016 | ABCB1 | Zornitza Stark Gene: abcb1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4015 | ABCB1 | Zornitza Stark reviewed gene: ABCB1: Rating: RED; Mode of pathogenicity: None; Publications: 14610718; Phenotypes: {Inflammatory bowel disease 13} 612244; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4015 | AASS | Zornitza Stark Tag disputed tag was added to gene: AASS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2902 | AASS | Zornitza Stark Tag disputed tag was added to gene: AASS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2902 | AASS | Zornitza Stark Mode of inheritance for gene: AASS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.9 | ABCA3 | Zornitza Stark Marked gene: ABCA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.9 | ABCA3 | Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2901 | AASS | Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.9 | ABCA3 | Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4015 | ABCA3 | Zornitza Stark Marked gene: ABCA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4015 | ABCA3 | Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.8 | ABCA3 | Zornitza Stark Publications for gene: ABCA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4015 | ABCA3 | Zornitza Stark Phenotypes for gene: ABCA3 were changed from to Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4014 | ABCA3 | Zornitza Stark Publications for gene: ABCA3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.7 | ABCA3 | Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pulmonary Fibrosis_Interstitial Lung Disease v0.6 | ABCA3 | Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4013 | ABCA3 | Zornitza Stark Mode of inheritance for gene: ABCA3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4012 | ABCA3 | Zornitza Stark reviewed gene: ABCA3: Rating: GREEN; Mode of pathogenicity: None; Publications: 15044640; Phenotypes: Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.97 | ABCA12 | Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4012 | ABCA12 | Zornitza Stark Marked gene: ABCA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4012 | ABCA12 | Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4012 | ABCA12 | Zornitza Stark Phenotypes for gene: ABCA12 were changed from to Ichthyosis, congenital, autosomal recessive 4A (MIM#601277); Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4011 | ABCA12 | Zornitza Stark Publications for gene: ABCA12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4010 | ABCA12 | Zornitza Stark Mode of inheritance for gene: ABCA12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4009 | ABCA12 | Zornitza Stark reviewed gene: ABCA12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31168818, 19664001, 31489029; Phenotypes: Ichthyosis, congenital, autosomal recessive 4A (MIM#601277), Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dyslipidaemia v0.3 | ABCA1 | Zornitza Stark Marked gene: ABCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dyslipidaemia v0.3 | ABCA1 | Zornitza Stark Gene: abca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dyslipidaemia v0.3 | ABCA1 | Zornitza Stark Phenotypes for gene: ABCA1 were changed from Tangier disease, ABCA1 deficiency, HDL deficiency, Familial hypoalphalipoproteinemia to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dyslipidaemia v0.2 | ABCA1 | Zornitza Stark Publications for gene: ABCA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dyslipidaemia v0.1 | ABCA1 | Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4009 | ABCA1 | Zornitza Stark Phenotypes for gene: ABCA1 were changed from to Tangier disease, MIM# 205400; HDL deficiency, familial, 1, MIM# 604091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4008 | ABCA1 | Zornitza Stark Publications for gene: ABCA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4007 | ABCA1 | Zornitza Stark Mode of inheritance for gene: ABCA1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4006 | ABCA1 | Zornitza Stark reviewed gene: ABCA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 10431237, 10431236; Phenotypes: Tangier disease, MIM# 205400, HDL deficiency, familial, 1, MIM# 604091; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2900 | AASS | Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4006 | AASS | Zornitza Stark Marked gene: AASS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4006 | AASS | Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2899 | AASS | Zornitza Stark Publications for gene: AASS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2898 | AASS | Zornitza Stark Classified gene: AASS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2898 | AASS | Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4006 | AASS | Zornitza Stark Phenotypes for gene: AASS were changed from to Hyperlysinemia, MIM# 238700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2897 | AASS | Zornitza Stark reviewed gene: AASS: Rating: AMBER; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4005 | AASS | Zornitza Stark Publications for gene: AASS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4004 | AASS | Zornitza Stark Mode of inheritance for gene: AASS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4003 | AASS | Zornitza Stark Classified gene: AASS as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4003 | AASS | Zornitza Stark Gene: aass has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AASS | Zornitza Stark changed review comment from: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. Hyperlysinemia is generally considered to be a benign metabolic variant rather than a disease entity.; to: Hyperlysinemia type I is an autosomal recessive metabolic condition with variable clinical features. Some patients who present in infancy with nonspecific seizures, hypotonia, or mildly delayed psychomotor development have been found to have increased serum lysine and pipecolic acid on laboratory analysis. However, about 50% of probands are reported to be asymptomatic. Given the broad range of clinical features and the presence of consanguinity in several families, there was not strong evidence for causality of symptoms. It has been suggested that hyperlysinemia is a benign metabolic variant rather than a disease entity. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AASS | Zornitza Stark edited their review of gene: AASS: Changed rating: AMBER | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AASS | Zornitza Stark reviewed gene: AASS: Rating: RED; Mode of pathogenicity: None; Publications: 23570448; Phenotypes: Hyperlysinemia, MIM# 238700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.208 | AARS2 | Zornitza Stark Marked gene: AARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.208 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.208 | AARS2 | Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.207 | AARS2 | Zornitza Stark Publications for gene: AARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.206 | AARS2 | Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.205 | AARS2 | Zornitza Stark Classified gene: AARS2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.205 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.204 | AARS2 | Zornitza Stark reviewed gene: AARS2: Rating: RED; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.139 | AARS2 | Zornitza Stark Marked gene: AARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.139 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.139 | AARS2 | Zornitza Stark Phenotypes for gene: AARS2 were changed from to Leukoencephalopathy, progressive, with ovarian failure MIM#615889 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.138 | AARS2 | Zornitza Stark Publications for gene: AARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.137 | AARS2 | Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.136 | AARS2 | Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.136 | AARS2 | Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.471 | AARS2 | Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.470 | AARS2 | Zornitza Stark Publications for gene: AARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.469 | AARS2 | Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | AARS2 | Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AARS2 | Zornitza Stark Marked gene: AARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4002 | AARS2 | Zornitza Stark Phenotypes for gene: AARS2 were changed from to Combined oxidative phosphorylation deficiency 8 MIM#614096; Leukoencephalopathy, progressive, with ovarian failure MIM#615889; MONDO:0013570 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4001 | AARS2 | Zornitza Stark Publications for gene: AARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.4000 | AARS2 | Zornitza Stark Mode of inheritance for gene: AARS2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3999 | AARS2 | Zornitza Stark edited their review of gene: AARS2: Changed phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889, MONDO:0013570 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3999 | AARS2 | Zornitza Stark reviewed gene: AARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30706699, 27839525, 21549344, 25058219, 24808023; Phenotypes: Combined oxidative phosphorylation deficiency 8 MIM#614096, Leukoencephalopathy, progressive, with ovarian failure MIM#615889; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3999 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3999 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3999 | AARS | Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339; Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3998 | AARS | Zornitza Stark Publications for gene: AARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3997 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3996 | AARS | Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015, 20045102, 22009580, 22206013, 30373780, 26032230; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339, Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.158 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.158 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.158 | AARS | Zornitza Stark Classified gene: AARS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.158 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.157 | AARS |
Zornitza Stark gene: AARS was added gene: AARS was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: AARS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AARS were set to 28493438; 25817015 Phenotypes for gene: AARS were set to Epileptic encephalopathy, early infantile, 29, MIM# 616339 Review for gene: AARS was set to GREEN Added comment: Bi-allelic variants associated with a severe phenotype comprising leukodystrophy, epilepsy, microcephaly and neurodevelopmental delay reported in three families. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2897 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2897 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2897 | AARS | Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2896 | AARS | Zornitza Stark Publications for gene: AARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2896 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2895 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2894 | AARS | Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.171 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.171 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.171 | AARS | Zornitza Stark Publications for gene: AARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.170 | AARS | Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.825 | AARS | Zornitza Stark Marked gene: AARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.825 | AARS | Zornitza Stark Gene: aars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.825 | AARS | Zornitza Stark Phenotypes for gene: AARS were changed from to Epileptic encephalopathy, early infantile, 29, MIM# 616339 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.824 | AARS | Zornitza Stark Publications for gene: AARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.823 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.823 | AARS | Zornitza Stark Mode of inheritance for gene: AARS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.822 | AARS | Zornitza Stark reviewed gene: AARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 28493438, 25817015; Phenotypes: Epileptic encephalopathy, early infantile, 29, MIM# 616339; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3996 | AAGAB | Zornitza Stark Marked gene: AAGAB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3996 | AAGAB | Zornitza Stark Gene: aagab has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3996 | AAGAB | Zornitza Stark Phenotypes for gene: AAGAB were changed from to Keratoderma, palmoplantar, punctate type IA (MIM#148600) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3995 | AAGAB | Zornitza Stark Publications for gene: AAGAB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3994 | AAGAB | Zornitza Stark Mode of inheritance for gene: AAGAB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3993 | AAGAB | Zornitza Stark reviewed gene: AAGAB: Rating: GREEN; Mode of pathogenicity: None; Publications: 30451279, 26608363; Phenotypes: Keratoderma, palmoplantar, punctate type IA (MIM#148600); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3993 | A4GALT | Zornitza Stark Marked gene: A4GALT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3993 | A4GALT | Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3993 | A4GALT | Zornitza Stark Phenotypes for gene: A4GALT were changed from to [Blood group, P1Pk system, p phenotype], MIM# 111400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3992 | A4GALT | Zornitza Stark Classified gene: A4GALT as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3992 | A4GALT | Zornitza Stark Gene: a4galt has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3991 | A4GALT | Zornitza Stark reviewed gene: A4GALT: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: [Blood group, P1Pk system, p phenotype], MIM# 111400; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.822 | RELN | Zornitza Stark Marked gene: RELN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.822 | RELN | Zornitza Stark Gene: reln has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.822 | RELN | Zornitza Stark Phenotypes for gene: RELN were changed from to {Epilepsy, familial temporal lobe, 7}, MIM# 616436; MONDO:0014639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.821 | RELN | Zornitza Stark Publications for gene: RELN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.820 | RELN | Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.819 | RELN | Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 28142128; Phenotypes: {Epilepsy, familial temporal lobe, 7}, MIM# 616436, MONDO:0014639; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.107 | RELN | Zornitza Stark Marked gene: RELN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.107 | RELN | Zornitza Stark Gene: reln has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.107 | RELN | Zornitza Stark Phenotypes for gene: RELN were changed from to Lissencephaly 2 (Norman-Roberts type), MIM# 257320 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.106 | RELN | Zornitza Stark Publications for gene: RELN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.105 | RELN | Zornitza Stark Mode of inheritance for gene: RELN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | RELN | Zornitza Stark reviewed gene: RELN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10973257, 29671837, 31805691; Phenotypes: Lissencephaly 2 (Norman-Roberts type), MIM# 257320; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | LAMB1 | Zornitza Stark Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | LAMB1 | Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.204 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.204 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.204 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.204 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.203 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.202 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.156 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.156 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.156 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.155 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.154 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2894 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2894 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2894 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2893 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2892 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.819 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.819 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.819 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.819 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.818 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.817 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3991 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3991 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3991 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3991 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3990 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3989 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark changed review comment from: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia.; to: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia. Note deletions are common. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.103 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.102 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Marked gene: LARGE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Gene: large1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.100 | LARGE1 | Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.99 | LARGE1 | Zornitza Stark reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3987 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3986 | LAMB1 | Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | LAMB1 | Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986, 32548278; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.99 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.98 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.97 | LAMB1 | Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | LAMB1 | Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467; Phenotypes: Lissencephaly 5, MIM# 615191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.72 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.71 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3984 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3983 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.11 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.10 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.95 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.94 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | TMEM5 | Zornitza Stark edited their review of gene: TMEM5: Changed publications: 23217329, 23519211 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.200 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.199 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2890 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2889 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.815 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.814 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3981 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3980 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.141 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.140 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.139 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.92 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.91 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.197 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.196 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.195 | KIF2A | Zornitza Stark Classified gene: KIF2A as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.195 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: RED; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Classified gene: KIF2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.152 | KIF2A |
Zornitza Stark gene: KIF2A was added gene: KIF2A was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF2A were set to 23603762; 27896282; 27747449; 29077851; 31919497 Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 Review for gene: KIF2A was set to GREEN Added comment: At least five unrelated families reported, with various malformations of cortical development including lissencephaly, agyria, posterior or frontal pachygyria, subcortical band heterotopia, and thin corpus callosum; microcephaly, intellectual disability and seizures. Microcephaly is in the range of -2SD -4.5SD, described as progressive in at least one individual. Some normocephalic but lower end of normal range. Some recurrent missense at p.Ser317 and p.His321. Functional data supports gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.812 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.811 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3978 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3977 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.89 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.88 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.52 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.55 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.54 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3975 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3974 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.69 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.68 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.67 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.67 | Zornitza Stark Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | ISPD | Zornitza Stark edited their review of gene: ISPD: Changed publications: 22522421, 23217329 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.52 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | ISPD | Zornitza Stark Publications for gene: ISPD were set to 22522421 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.85 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.84 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Marked gene: DYNC1H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to Mental retardation, autosomal dominant 13, MIM# 614563 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.82 | DYNC1H1 | Zornitza Stark Publications for gene: DYNC1H1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.81 | DYNC1H1 | Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3972 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3971 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | DCX | Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.79 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.78 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | DCX | Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Marked gene: B3GALNT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Gene: b3galnt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.76 | B3GALNT2 | Zornitza Stark Publications for gene: B3GALNT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.75 | B3GALNT2 | Zornitza Stark Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | B3GALNT2 | Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Phenotypes for gene: ARX were changed from to Lissencephaly, X-linked 2, MIM# 300215 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.73 | ARX | Zornitza Stark Publications for gene: ARX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.72 | ARX | Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.71 | ARX | Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | DPM3 | Zornitza Stark edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Marked gene: TLR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Classified gene: TLR7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.64 | TLR7 |
Zornitza Stark gene: TLR7 was added gene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list Mode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TLR7 were set to 32706371 Phenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051 Review for gene: TLR7 was set to GREEN Added comment: Four affected individuals from two unrelated families and some functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | TLR7 | Zornitza Stark reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.94 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.93 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.97 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.96 | ASPRV1 | Zornitza Stark edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis and Porokeratosis v0.96 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.6 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.5 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3968 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3967 | MRPL44 | Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.467 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.466 | MRPL44 | Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | MRPL44 | Zornitza Stark edited their review of gene: MRPL44: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL | Bryony Thompson Marked gene: FANCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL | Bryony Thompson Gene: fancl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL |
Bryony Thompson gene: FANCL was added gene: FANCL was added to Amenorrhoea. Sources: Literature Mode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FANCL were set to 32048394; 32851770; 11823446 Phenotypes for gene: FANCL were set to Primary ovarian insufficiency Review for gene: FANCL was set to AMBER Added comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Classified STR: PRNP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Str: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.71 | PRNP |
Bryony Thompson STR: PRNP was added STR: PRNP was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: PRNP. Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP were set to 20301407 Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP was set to GREEN STR: PRNP was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Marked gene: KBTBD13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Gene: kbtbd13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Phenotypes for gene: KBTBD13 were changed from to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3965 | KBTBD13 | Zornitza Stark Publications for gene: KBTBD13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3964 | KBTBD13 | Zornitza Stark Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | KBTBD13 | Zornitza Stark edited their review of gene: KBTBD13: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | KBTBD13 | Zornitza Stark reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | NDUFA13 | Zornitza Stark Publications for gene: NDUFA13 were set to 25901006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | NDUFA13 | Zornitza Stark Publications for gene: NDUFA13 were set to 25901006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3962 | NDUFA13 | Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3962 | NDUFA13 | Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | NDUFA13 | Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.464 | NDUFA13 | Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.464 | NDUFA13 | Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.463 | NDUFA13 | Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | KBTBD13 | Elena Savva reviewed gene: KBTBD13: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 28403181, 31167812, 31671076, 30208948; Phenotypes: Nemaline myopathy 6, autosomal dominant, 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Classified STR: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.69 | C9orf72 |
Bryony Thompson STR: C9orf72 was added STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: C9orf72. Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: C9orf72 were set to 25577942 Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: C9orf72 was set to GREEN STR: C9orf72 was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.206 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.205 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.65 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.64 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.63 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3960 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3959 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.71 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from LAMA2-related muscular dystrophy to LAMA2-related muscular dystrophy; Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.106 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.105 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.104 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.809 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.808 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.807 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3957 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3956 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3955 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2887 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2886 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2885 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.139 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from GRIN2B-related neurodevelopmental disorder to GRIN2B-related neurodevelopmental disorder; Mental retardation, autosomal dominant 6, MIM# 613970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.72 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.72 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.72 | GRIN1 | Zornitza Stark Classified gene: GRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.72 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||