PanelApp

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Prepair 500+ v1.541 ITGB4 Zornitza Stark Gene: itgb4 has been classified as Green List (High Evidence).
Prepair 500+ v1.541 ITGB4 Zornitza Stark Phenotypes for gene: ITGB4 were changed from Epidermolysis bullosa, junctional, with pyloric atresia, 226730 (3) to Epidermolysis bullosa, junctional 5B, with pyloric atresia, MIM#226730
Prepair 500+ v1.540 ITGB4 Zornitza Stark Publications for gene: ITGB4 were set to
Prepair 500+ v1.539 ITGA6 Zornitza Stark Marked gene: ITGA6 as ready
Prepair 500+ v1.539 ITGA6 Zornitza Stark Gene: itga6 has been classified as Green List (High Evidence).
Prepair 500+ v1.539 ITGA6 Zornitza Stark Phenotypes for gene: ITGA6 were changed from Epidermolysis bullosa, junctional, with pyloric stenosis, 226730 (3) to Epidermolysis bullosa, junctional 6, with pyloric atresia (MIM#619817)
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Marked gene: IQSEC2 as ready
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Gene: iqsec2 has been classified as Green List (High Evidence).
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Publications for gene: IQSEC2 were set to
Prepair 500+ v1.537 INVS Zornitza Stark Marked gene: INVS as ready
Prepair 500+ v1.537 INVS Zornitza Stark Gene: invs has been classified as Green List (High Evidence).
Prepair 500+ v1.537 INVS Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088)
Prepair 500+ v1.536 INPP5E Zornitza Stark Marked gene: INPP5E as ready
Prepair 500+ v1.536 INPP5E Zornitza Stark Gene: inpp5e has been classified as Green List (High Evidence).
Prepair 500+ v1.536 INPP5E Zornitza Stark Phenotypes for gene: INPP5E were changed from Joubert syndrome 1, 213300 (3) to Joubert syndrome 1, MIM# 213300; MONDO:0008944
Prepair 500+ v1.535 INPP5E Zornitza Stark Publications for gene: INPP5E were set to
Prepair 500+ v1.534 IL7R Zornitza Stark Marked gene: IL7R as ready
Prepair 500+ v1.534 IL7R Zornitza Stark Gene: il7r has been classified as Green List (High Evidence).
Prepair 500+ v1.534 IL2RG Zornitza Stark Marked gene: IL2RG as ready
Prepair 500+ v1.534 IL2RG Zornitza Stark Gene: il2rg has been classified as Green List (High Evidence).
Prepair 500+ v1.534 IL2RG Zornitza Stark Phenotypes for gene: IL2RG were changed from Severe combined immunodeficiency, X-linked, 300400 (3) to Severe combined immunodeficiency, X-linked, MIM#300400
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Marked gene: IL1RAPL1 as ready
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Gene: il1rapl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Phenotypes for gene: IL1RAPL1 were changed from Mental retardation, X-linked 21/34, 300143 (3) to Intellectual developmental disorder, X-linked 21, MIM#300143
Prepair 500+ v1.532 IL1RAPL1 Zornitza Stark Publications for gene: IL1RAPL1 were set to
Prepair 500+ v1.531 IKBKB Zornitza Stark Marked gene: IKBKB as ready
Prepair 500+ v1.531 IKBKB Zornitza Stark Gene: ikbkb has been classified as Green List (High Evidence).
Prepair 500+ v1.531 IKBKB Zornitza Stark Phenotypes for gene: IKBKB were changed from Immunodeficiency 15, 615592 (3) to Immunodeficiency 15, MIM#615592
Prepair 500+ v1.530 IKBKB Zornitza Stark Publications for gene: IKBKB were set to
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Marked gene: IGHMBP2 as ready
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Gene: ighmbp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Phenotypes for gene: IGHMBP2 were changed from Neuronopathy, distal hereditary motor, type VI, 604320 (3) to Neuronopathy, distal hereditary motor, autosomal recessive 1 MIM#604320; Charcot-Marie-Tooth disease, axonal, type 2S MIM#616155
Prepair 500+ v1.528 IGHMBP2 Zornitza Stark Publications for gene: IGHMBP2 were set to
Prepair 500+ v1.527 IDUA Zornitza Stark Marked gene: IDUA as ready
Prepair 500+ v1.527 IDUA Zornitza Stark Gene: idua has been classified as Green List (High Evidence).
Prepair 500+ v1.527 IDUA Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih, MIM#607014
Prepair 500+ v1.526 IDS Zornitza Stark Marked gene: IDS as ready
Prepair 500+ v1.526 IDS Zornitza Stark Gene: ids has been classified as Green List (High Evidence).
Prepair 500+ v1.526 IDS Zornitza Stark Phenotypes for gene: IDS were changed from Mucopolysaccharidosis II, 309900 (3) to Mucopolysaccharidosis II, MIM# 309900; Hunter syndrome, MONDO:0010674
Prepair 500+ v1.525 IDS Zornitza Stark Publications for gene: IDS were set to
Prepair 500+ v1.524 HYLS1 Zornitza Stark Marked gene: HYLS1 as ready
Prepair 500+ v1.524 HYLS1 Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence).
Prepair 500+ v1.524 HYLS1 Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680); Ciliopathy
Prepair 500+ v1.523 HYLS1 Zornitza Stark Publications for gene: HYLS1 were set to
Prepair 500+ v1.522 HUWE1 Zornitza Stark Marked gene: HUWE1 as ready
Prepair 500+ v1.522 HUWE1 Zornitza Stark Gene: huwe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.522 HUWE1 Zornitza Stark Phenotypes for gene: HUWE1 were changed from Mental retardation, X-linked syndromic, Turner type, 300706 (3) to Intellectual developmental disorder, X-linked syndromic, Turner type, MIM#309590
Prepair 500+ v1.521 HUWE1 Zornitza Stark Publications for gene: HUWE1 were set to
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Marked gene: HSD3B2 as ready
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Gene: hsd3b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Phenotypes for gene: HSD3B2 were changed from 3-beta-hydroxysteroid dehydrogenase, type II, deficiency, 201810 (3) to Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency, MIM#201810
Prepair 500+ v1.519 HSD3B2 Zornitza Stark Publications for gene: HSD3B2 were set to
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Marked gene: HSD17B4 as ready
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Gene: hsd17b4 has been classified as Green List (High Evidence).
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Phenotypes for gene: HSD17B4 were changed from D-bifunctional protein deficiency, 261515 (3) to D-bifunctional protein deficiency, MIM#261515
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Marked gene: HSD17B10 as ready
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Gene: hsd17b10 has been classified as Green List (High Evidence).
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Phenotypes for gene: HSD17B10 were changed from HSD10 mitochondrial disease to HSD10 mitochondrial disease, MIM#300438
Prepair 500+ v1.516 HSD17B10 Zornitza Stark Publications for gene: HSD17B10 were set to
Prepair 500+ v1.515 HPS6 Zornitza Stark Marked gene: HPS6 as ready
Prepair 500+ v1.515 HPS6 Zornitza Stark Gene: hps6 has been classified as Green List (High Evidence).
Prepair 500+ v1.515 HPS6 Zornitza Stark Phenotypes for gene: HPS6 were changed from Hermansky-Pudlak syndrome 6, 614075 (3) to Hermansky-Pudlak syndrome 6, MIM# 614075
Prepair 500+ v1.514 HPS6 Zornitza Stark Publications for gene: HPS6 were set to
Prepair 500+ v1.513 HPS5 Zornitza Stark Marked gene: HPS5 as ready
Prepair 500+ v1.513 HPS5 Zornitza Stark Gene: hps5 has been classified as Green List (High Evidence).
Prepair 500+ v1.513 HPS5 Zornitza Stark Phenotypes for gene: HPS5 were changed from Hermansky-Pudlak syndrome 5, 614074 (3) to Hermansky-Pudlak syndrome 5 MIM#614074
Prepair 500+ v1.512 HPS4 Zornitza Stark Marked gene: HPS4 as ready
Prepair 500+ v1.512 HPS4 Zornitza Stark Gene: hps4 has been classified as Green List (High Evidence).
Prepair 500+ v1.512 HPS4 Zornitza Stark Phenotypes for gene: HPS4 were changed from Hermansky-Pudlak syndrome 4, 614073 (3) to Hermansky-Pudlak syndrome 4, MIM #614073
Prepair 500+ v1.511 HPS4 Zornitza Stark Publications for gene: HPS4 were set to
Prepair 500+ v1.510 HPS3 Zornitza Stark Marked gene: HPS3 as ready
Prepair 500+ v1.510 HPS3 Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence).
Prepair 500+ v1.510 HPS3 Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072
Prepair 500+ v1.509 HPS3 Zornitza Stark Publications for gene: HPS3 were set to
Prepair 500+ v1.508 HPS1 Zornitza Stark Marked gene: HPS1 as ready
Prepair 500+ v1.508 HPS1 Zornitza Stark Gene: hps1 has been classified as Green List (High Evidence).
Prepair 500+ v1.508 HPS1 Zornitza Stark Phenotypes for gene: HPS1 were changed from Hermansky-Pudlak syndrome 1, 203300 (3) to Hermansky-Pudlak syndrome 1, MIM#203300
Prepair 500+ v1.507 HPS1 Zornitza Stark Publications for gene: HPS1 were set to
Prepair 500+ v1.506 HPRT1 Zornitza Stark Marked gene: HPRT1 as ready
Prepair 500+ v1.506 HPRT1 Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence).
Prepair 500+ v1.506 HPRT1 Zornitza Stark Phenotypes for gene: HPRT1 were changed from Lesch-Nyhan syndrome, 300322 (3) to Lesch-Nyhan syndrome (MIM#300322)
Prepair 500+ v1.505 HPRT1 Zornitza Stark Publications for gene: HPRT1 were set to
Prepair 500+ v1.504 HPD Zornitza Stark Marked gene: HPD as ready
Prepair 500+ v1.504 HPD Zornitza Stark Gene: hpd has been classified as Green List (High Evidence).
Prepair 500+ v1.504 HPD Zornitza Stark Phenotypes for gene: HPD were changed from Tyrosinemia, type III, 276710 (3) to Tyrosinaemia, type III, MIM#276710
Prepair 500+ v1.503 HPD Zornitza Stark Publications for gene: HPD were set to
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Marked gene: HMGCS2 as ready
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Gene: hmgcs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Phenotypes for gene: HMGCS2 were changed from HMG-CoA synthase-2 deficiency, 605911 (3) to HMG-CoA synthase-2 deficiency, MIM#605911
Prepair 500+ v1.501 HMGCS2 Zornitza Stark Publications for gene: HMGCS2 were set to
Prepair 500+ v1.500 HMGCL Zornitza Stark Marked gene: HMGCL as ready
Prepair 500+ v1.500 HMGCL Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence).
Prepair 500+ v1.500 HMGCL Zornitza Stark Phenotypes for gene: HMGCL were changed from HMG-CoA lyase deficiency, 246450 (3) to HMG-CoA lyase deficiency, MIM# 246450
Prepair 500+ v1.499 HLCS Zornitza Stark Marked gene: HLCS as ready
Prepair 500+ v1.499 HLCS Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence).
Prepair 500+ v1.499 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from Holocarboxylase synthetase deficiency, 253270 (3) to Holocarboxylase synthetase deficiency MIM#253270
Prepair 500+ v1.498 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Prepair 500+ v1.498 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Prepair 500+ v1.498 HIBCH Zornitza Stark Phenotypes for gene: HIBCH were changed from 3-hydroxyisobutryl-CoA hydrolase deficiency, 250620 (3) to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#250620
Prepair 500+ v1.497 HIBCH Zornitza Stark Publications for gene: HIBCH were set to
Prepair 500+ v1.496 HGSNAT Zornitza Stark Marked gene: HGSNAT as ready
Prepair 500+ v1.496 HGSNAT Zornitza Stark Gene: hgsnat has been classified as Green List (High Evidence).
Prepair 500+ v1.496 HGSNAT Zornitza Stark Phenotypes for gene: HGSNAT were changed from Mucopolysaccharidosis type IIIC (Sanfilippo C), 252930 (3) to Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM#252930; Retinitis pigmentosa 73, MIM#616544
Prepair 500+ v1.495 HGSNAT Zornitza Stark Publications for gene: HGSNAT were set to
Prepair 500+ v1.494 HFE2 Zornitza Stark Marked gene: HFE2 as ready
Prepair 500+ v1.494 HFE2 Zornitza Stark Gene: hfe2 has been classified as Green List (High Evidence).
Prepair 500+ v1.494 HFE2 Zornitza Stark Phenotypes for gene: HFE2 were changed from Hemochromatosis, type 2A, 602390 (3) to Haemochromatosis, type 2A, MIM#602390
Prepair 500+ v1.493 HEXB Zornitza Stark Marked gene: HEXB as ready
Prepair 500+ v1.493 HEXB Zornitza Stark Gene: hexb has been classified as Green List (High Evidence).
Prepair 500+ v1.493 HEXB Zornitza Stark Phenotypes for gene: HEXB were changed from Sandhoff disease, infantile, juvenile, and adult forms, 268800 (3) to Sandhoff disease, infantile, juvenile, and adult forms, MIM#268800
Prepair 500+ v1.492 HEXB Zornitza Stark Publications for gene: HEXB were set to
Prepair 500+ v1.491 HEXA Zornitza Stark Marked gene: HEXA as ready
Prepair 500+ v1.491 HEXA Zornitza Stark Gene: hexa has been classified as Green List (High Evidence).
Prepair 500+ v1.491 HEXA Zornitza Stark Phenotypes for gene: HEXA were changed from Tay-Sachs disease, 272800 (3) to Tay-Sachs disease, MIM#272800
Prepair 500+ v1.490 HEXA Zornitza Stark Publications for gene: HEXA were set to
Prepair 500+ v1.489 HCFC1 Zornitza Stark Marked gene: HCFC1 as ready
Prepair 500+ v1.489 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.489 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ), 309541 (3) to Methylmalonic aciduria and homocysteinemia, cblX type, MIM#309541
Prepair 500+ v1.488 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Prepair 500+ v1.487 HBB Zornitza Stark Marked gene: HBB as ready
Prepair 500+ v1.487 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Prepair 500+ v1.487 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Sickle cell anaemia, MIM# 603903
Prepair 500+ v1.486 HAX1 Zornitza Stark Marked gene: HAX1 as ready
Prepair 500+ v1.486 HAX1 Zornitza Stark Gene: hax1 has been classified as Green List (High Evidence).
Prepair 500+ v1.486 HAX1 Zornitza Stark Phenotypes for gene: HAX1 were changed from Neutropenia, severe congenital 3, autosomal recessive, 610738 (3) to Neutropenia, severe congenital 3, autosomal recessive, MIM#610738
Prepair 500+ v1.485 HAX1 Zornitza Stark Publications for gene: HAX1 were set to
Prepair 500+ v1.484 HAMP Zornitza Stark Marked gene: HAMP as ready
Prepair 500+ v1.484 HAMP Zornitza Stark Gene: hamp has been classified as Green List (High Evidence).
Prepair 500+ v1.484 HAMP Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313
Prepair 500+ v1.483 HAMP Zornitza Stark Publications for gene: HAMP were set to
Prepair 500+ v1.482 HADHB Zornitza Stark Marked gene: HADHB as ready
Prepair 500+ v1.482 HADHB Zornitza Stark Gene: hadhb has been classified as Green List (High Evidence).
Prepair 500+ v1.482 HADHB Zornitza Stark Phenotypes for gene: HADHB were changed from Trifunctional protein deficiency, 609015 (3) to Mitochondrial trifunctional protein deficiency 2 MIM#620300
Prepair 500+ v1.481 HADHA Zornitza Stark Marked gene: HADHA as ready
Prepair 500+ v1.481 HADHA Zornitza Stark Gene: hadha has been classified as Green List (High Evidence).
Prepair 500+ v1.481 HADHA Zornitza Stark Phenotypes for gene: HADHA were changed from Fatty liver, acute, of pregnancy, 609016 (3) to LCHAD deficiency MIM#609016; Mitochondrial trifunctional protein deficiency 1 MIM#609015
Prepair 500+ v1.480 HADH Zornitza Stark Marked gene: HADH as ready
Prepair 500+ v1.480 HADH Zornitza Stark Gene: hadh has been classified as Green List (High Evidence).
Prepair 500+ v1.480 HADH Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530
Prepair 500+ v1.479 HADH Zornitza Stark Publications for gene: HADH were set to
Prepair 500+ v1.478 GUSB Zornitza Stark Marked gene: GUSB as ready
Prepair 500+ v1.478 GUSB Zornitza Stark Gene: gusb has been classified as Green List (High Evidence).
Prepair 500+ v1.478 GUSB Zornitza Stark Phenotypes for gene: GUSB were changed from Mucopolysaccharidosis VII, 253220 (3) to Mucopolysaccharidosis VII, MIM# 253220
Prepair 500+ v1.477 GUSB Zornitza Stark Publications for gene: GUSB were set to
Prepair 500+ v1.476 GUCY2D Zornitza Stark Marked gene: GUCY2D as ready
Prepair 500+ v1.476 GUCY2D Zornitza Stark Gene: gucy2d has been classified as Green List (High Evidence).
Prepair 500+ v1.476 GUCY2D Zornitza Stark Phenotypes for gene: GUCY2D were changed from Leber congenital amaurosis 1, 204000 (3) to Leber congenital amaurosis 1, MIM #204000
Prepair 500+ v1.475 GUCY2D Zornitza Stark Publications for gene: GUCY2D were set to
Prepair 500+ v1.474 GSS Zornitza Stark Marked gene: GSS as ready
Prepair 500+ v1.474 GSS Zornitza Stark Gene: gss has been classified as Green List (High Evidence).
Prepair 500+ v1.474 GSS Zornitza Stark Phenotypes for gene: GSS were changed from Glutathione synthetase deficiency, 266130 (3) to Glutathione synthetase deficiency MIM#266130
Prepair 500+ v1.473 GPSM2 Zornitza Stark Marked gene: GPSM2 as ready
Prepair 500+ v1.473 GPSM2 Zornitza Stark Gene: gpsm2 has been classified as Green List (High Evidence).
Prepair 500+ v1.473 GPSM2 Zornitza Stark Phenotypes for gene: GPSM2 were changed from Chudley-McCullough syndrome, 604213 (3) to Chudley-McCullough syndrome MIM#604213
Prepair 500+ v1.472 GPSM2 Zornitza Stark Publications for gene: GPSM2 were set to
Prepair 500+ v1.471 GPR143 Zornitza Stark Marked gene: GPR143 as ready
Prepair 500+ v1.471 GPR143 Zornitza Stark Gene: gpr143 has been classified as Green List (High Evidence).
Prepair 500+ v1.471 GPR143 Zornitza Stark Phenotypes for gene: GPR143 were changed from Ocular albinism, type I, Nettleship-Falls type, 300500 (3) to Nystagmus 6, congenital, X-linked, MIM#300814; Ocular albinism, type I, Nettleship-Falls type, MIM#300500
Prepair 500+ v1.470 GPR143 Zornitza Stark Publications for gene: GPR143 were set to
Prepair 500+ v1.469 GPC3 Zornitza Stark Marked gene: GPC3 as ready
Prepair 500+ v1.469 GPC3 Zornitza Stark Gene: gpc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.469 GPC3 Zornitza Stark Phenotypes for gene: GPC3 were changed from Simpson-Golabi-Behmel syndrome, type 1, 312870 (3) to Simpson-Golabi-Behmel syndrome, type 1, MIM #312870
Prepair 500+ v1.468 GPC3 Zornitza Stark Publications for gene: GPC3 were set to
Prepair 500+ v1.467 GORAB Zornitza Stark Marked gene: GORAB as ready
Prepair 500+ v1.467 GORAB Zornitza Stark Gene: gorab has been classified as Green List (High Evidence).
Prepair 500+ v1.467 GORAB Zornitza Stark Phenotypes for gene: GORAB were changed from Geroderma osteodysplasticum, 231070 (3) to Geroderma osteodysplasticum, MIM#231070; MONDO:0009271
Prepair 500+ v1.466 GORAB Zornitza Stark Publications for gene: GORAB were set to
Prepair 500+ v1.465 GNS Zornitza Stark Marked gene: GNS as ready
Prepair 500+ v1.465 GNS Zornitza Stark Gene: gns has been classified as Green List (High Evidence).
Prepair 500+ v1.465 GNS Zornitza Stark Phenotypes for gene: GNS were changed from Mucopolysaccharidosis type IIID, 252940 (3) to Mucopolysaccharidosis type IIID, MIM# 252940; Sanfilippo syndrome type D, MONDO:0009658
Prepair 500+ v1.464 GNS Zornitza Stark Publications for gene: GNS were set to
Prepair 500+ v1.463 GNPTG Zornitza Stark Marked gene: GNPTG as ready
Prepair 500+ v1.463 GNPTG Zornitza Stark Gene: gnptg has been classified as Green List (High Evidence).
Prepair 500+ v1.463 GNPTG Zornitza Stark Phenotypes for gene: GNPTG were changed from Mucolipidosis III gamma, 252605 (3) to Mucolipidosis III gamma, MIM# 252605
Prepair 500+ v1.462 GNPTG Zornitza Stark Publications for gene: GNPTG were set to
Prepair 500+ v1.461 GNPTAB Zornitza Stark Marked gene: GNPTAB as ready
Prepair 500+ v1.461 GNPTAB Zornitza Stark Gene: gnptab has been classified as Green List (High Evidence).
Prepair 500+ v1.461 GNPTAB Zornitza Stark Phenotypes for gene: GNPTAB were changed from Mucolipidosis III alpha/beta, 252600 (3) to Mucolipidosis III alpha/beta MIM#252600; Mucolipidosis II alpha/beta MIM#252500
Prepair 500+ v1.460 GNPAT Zornitza Stark Marked gene: GNPAT as ready
Prepair 500+ v1.460 GNPAT Zornitza Stark Gene: gnpat has been classified as Green List (High Evidence).
Prepair 500+ v1.460 GNPAT Zornitza Stark Phenotypes for gene: GNPAT were changed from Chondrodysplasia punctata, rhizomelic, type 2, 222765 (3) to Rhizomelic chondrodysplasia punctata, type 2 (MIM# 222765)
Prepair 500+ v1.459 GNPAT Zornitza Stark Publications for gene: GNPAT were set to
Prepair 500+ v1.458 GNB5 Zornitza Stark Marked gene: GNB5 as ready
Prepair 500+ v1.458 GNB5 Zornitza Stark Gene: gnb5 has been classified as Green List (High Evidence).
Prepair 500+ v1.458 GNB5 Zornitza Stark Phenotypes for gene: GNB5 were changed from Intellectual developmental disorder with cardiac arrhythmia, 617173 (3), Autosomal recessive to Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173); Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)
Prepair 500+ v1.457 GNB5 Zornitza Stark Publications for gene: GNB5 were set to
Prepair 500+ v1.456 GLE1 Zornitza Stark Marked gene: GLE1 as ready
Prepair 500+ v1.456 GLE1 Zornitza Stark Gene: gle1 has been classified as Green List (High Evidence).
Prepair 500+ v1.456 GLE1 Zornitza Stark Phenotypes for gene: GLE1 were changed from Arthrogryposis, lethal, with anterior horn cell disease, 611890 (3) to Congenital arthrogryposis with anterior horn cell disease, MIM #611890; Lethal congenital contracture syndrome 1, MIM #253310
Prepair 500+ v1.455 GLE1 Zornitza Stark Publications for gene: GLE1 were set to
Prepair 500+ v1.454 GLDC Zornitza Stark Marked gene: GLDC as ready
Prepair 500+ v1.454 GLDC Zornitza Stark Gene: gldc has been classified as Green List (High Evidence).
Prepair 500+ v1.454 GLDC Zornitza Stark Phenotypes for gene: GLDC were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy1 (MIM#605899)
Prepair 500+ v1.453 GLDC Zornitza Stark Publications for gene: GLDC were set to
Prepair 500+ v1.452 GLB1 Zornitza Stark Marked gene: GLB1 as ready
Prepair 500+ v1.452 GLB1 Zornitza Stark Gene: glb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.452 GLB1 Zornitza Stark Phenotypes for gene: GLB1 were changed from Mucopolysaccharidosis type IVB (Morquio), 253010 (3) to GM1-gangliosidosis, type I MIM#230500; GM1-gangliosidosis, type II MIM#230600; GM1-gangliosidosis, type III MIM#230650; Mucopolysaccharidosis type IVB (Morquio) MIM#253010
Prepair 500+ v1.451 GLB1 Zornitza Stark Publications for gene: GLB1 were set to
Prepair 500+ v1.450 GLA Zornitza Stark Marked gene: GLA as ready
Prepair 500+ v1.450 GLA Zornitza Stark Gene: gla has been classified as Green List (High Evidence).
Prepair 500+ v1.450 GLA Zornitza Stark Publications for gene: GLA were set to 29649853; 20301469
Prepair 500+ v1.449 GJB1 Zornitza Stark Marked gene: GJB1 as ready
Prepair 500+ v1.449 GJB1 Zornitza Stark Gene: gjb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.449 GJB1 Zornitza Stark Phenotypes for gene: GJB1 were changed from Charcot-Marie-Tooth neuropathy, X-linked dominant, 1 (MIM#302800) to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM#302800
Prepair 500+ v1.448 GJB1 Zornitza Stark Publications for gene: GJB1 were set to
Prepair 500+ v1.447 GHR Zornitza Stark Marked gene: GHR as ready
Prepair 500+ v1.447 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Prepair 500+ v1.447 GHR Zornitza Stark Phenotypes for gene: GHR were changed from Laron dwarfism, 262500 (3) to Laron dwarfism, MIM#262500
Prepair 500+ v1.446 GHR Zornitza Stark Publications for gene: GHR were set to
Prepair 500+ v1.445 GFM1 Zornitza Stark Marked gene: GFM1 as ready
Prepair 500+ v1.445 GFM1 Zornitza Stark Gene: gfm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.445 GFM1 Zornitza Stark Phenotypes for gene: GFM1 were changed from Combined oxidative phosphorylation deficiency 1, 609060 (3) to Combined oxidative phosphorylation deficiency 1, MIM#609060
Prepair 500+ v1.444 GDF5 Zornitza Stark Marked gene: GDF5 as ready
Prepair 500+ v1.444 GDF5 Zornitza Stark Gene: gdf5 has been classified as Green List (High Evidence).
Prepair 500+ v1.444 GDF5 Zornitza Stark Phenotypes for gene: GDF5 were changed from Chondrodysplasia, Grebe type, 200700 (3) to Acromesomelic dysplasia 2A MIM#200700; Acromesomelic dysplasia 2B MIM#228900
Prepair 500+ v1.443 GDF5 Zornitza Stark Publications for gene: GDF5 were set to
Prepair 500+ v1.442 GDF1 Zornitza Stark Marked gene: GDF1 as ready
Prepair 500+ v1.442 GDF1 Zornitza Stark Gene: gdf1 has been classified as Green List (High Evidence).
Prepair 500+ v1.442 GDF1 Zornitza Stark Phenotypes for gene: GDF1 were changed from Right atrial isomerism, 208530 (3) to Right atrial isomerism (Ivemark), MIM #208530
Prepair 500+ v1.441 GDF1 Zornitza Stark Publications for gene: GDF1 were set to
Prepair 500+ v1.440 GDAP1 Zornitza Stark Marked gene: GDAP1 as ready
Prepair 500+ v1.440 GDAP1 Zornitza Stark Gene: gdap1 has been classified as Green List (High Evidence).
Prepair 500+ v1.440 GDAP1 Zornitza Stark Phenotypes for gene: GDAP1 were changed from Charcot-Marie-Tooth disease, recessive intermediate, A, 608340 (3) to Charcot-Marie-Tooth disease, axonal, type 2K, MIM #607831; Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM #607706; Charcot-Marie-Tooth disease, recessive intermediate, A, MIM #608340; Charcot-Marie-Tooth disease, type 4A, MIM#214400
Prepair 500+ v1.439 GDAP1 Zornitza Stark Publications for gene: GDAP1 were set to
Prepair 500+ v1.438 GCH1 Zornitza Stark Marked gene: GCH1 as ready
Prepair 500+ v1.438 GCH1 Zornitza Stark Gene: gch1 has been classified as Green List (High Evidence).
Prepair 500+ v1.438 GCH1 Zornitza Stark Phenotypes for gene: GCH1 were changed from Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, 128230 (3) to Dystonia, DOPA-responsive, with or without hyperphenylalaninaemia, MIM#128230
Prepair 500+ v1.437 GCH1 Zornitza Stark Publications for gene: GCH1 were set to
Prepair 500+ v1.436 GCDH Zornitza Stark Marked gene: GCDH as ready
Prepair 500+ v1.436 GCDH Zornitza Stark Gene: gcdh has been classified as Green List (High Evidence).
Prepair 500+ v1.436 GCDH Zornitza Stark Phenotypes for gene: GCDH were changed from Glutaricaciduria, type I, 231670 (3) to Glutaric aciduria, type I, MIM#231670
Prepair 500+ v1.435 GCDH Zornitza Stark Publications for gene: GCDH were set to
Prepair 500+ v1.434 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Prepair 500+ v1.434 GBE1 Zornitza Stark Gene: gbe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.434 GBE1 Zornitza Stark Phenotypes for gene: GBE1 were changed from Glycogen storage disease IV, 232500 (3) to Glycogen storage disease IV, MIM#232500
Prepair 500+ v1.433 GATM Zornitza Stark Marked gene: GATM as ready
Prepair 500+ v1.433 GATM Zornitza Stark Gene: gatm has been classified as Green List (High Evidence).
Prepair 500+ v1.433 GATM Zornitza Stark Phenotypes for gene: GATM were changed from Cerebral creatine deficiency syndrome 3, 612718 (3) to Cerebral creatine deficiency syndrome 3 MIM#612718; AGAT deficiency MONDO:0012996
Prepair 500+ v1.432 GATM Zornitza Stark Publications for gene: GATM were set to
Prepair 500+ v1.431 GAMT Zornitza Stark Marked gene: GAMT as ready
Prepair 500+ v1.431 GAMT Zornitza Stark Gene: gamt has been classified as Green List (High Evidence).
Prepair 500+ v1.431 GAMT Zornitza Stark Phenotypes for gene: GAMT were changed from Cerebral creatine deficiency syndrome 2, 612736 (3) to Cerebral creatine deficiency syndrome 2 (MIM#612736)
Prepair 500+ v1.430 GAMT Zornitza Stark Publications for gene: GAMT were set to
Prepair 500+ v1.429 GALT Zornitza Stark Marked gene: GALT as ready
Prepair 500+ v1.429 GALT Zornitza Stark Gene: galt has been classified as Green List (High Evidence).
Prepair 500+ v1.429 GALT Zornitza Stark Phenotypes for gene: GALT were changed from Galactosemia, 230400 (3) to Galactosaemia MIM# 230400
Prepair 500+ v1.428 GALNS Zornitza Stark Marked gene: GALNS as ready
Prepair 500+ v1.428 GALNS Zornitza Stark Gene: galns has been classified as Green List (High Evidence).
Prepair 500+ v1.428 GALNS Zornitza Stark Phenotypes for gene: GALNS were changed from Mucopolysaccharidosis IVA, 253000 (3) to Mucopolysaccharidosis IVA, MIM#253000
Prepair 500+ v1.427 GALNS Zornitza Stark Publications for gene: GALNS were set to
Prepair 500+ v1.426 GALC Zornitza Stark Marked gene: GALC as ready
Prepair 500+ v1.426 GALC Zornitza Stark Gene: galc has been classified as Green List (High Evidence).
Prepair 500+ v1.426 GALC Zornitza Stark Phenotypes for gene: GALC were changed from Krabbe disease, 245200 (3) to Krabbe disease, MIM# 245200; MONDO:0009499
Prepair 500+ v1.425 GALC Zornitza Stark Publications for gene: GALC were set to
Prepair 500+ v1.424 GAA Zornitza Stark Marked gene: GAA as ready
Prepair 500+ v1.424 GAA Zornitza Stark Gene: gaa has been classified as Green List (High Evidence).
Prepair 500+ v1.424 GAA Zornitza Stark Phenotypes for gene: GAA were changed from Glycogen storage disease II, 232300 (3) to Glycogen storage disease II, MIM#232300
Prepair 500+ v1.423 GAA Zornitza Stark Publications for gene: GAA were set to
Prepair 500+ v1.422 G6PC3 Zornitza Stark Marked gene: G6PC3 as ready
Prepair 500+ v1.422 G6PC3 Zornitza Stark Gene: g6pc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.422 G6PC3 Zornitza Stark Phenotypes for gene: G6PC3 were changed from Dursun syndrome, 612541 (3) to Dursun syndrome, MIM# 612541; Neutropenia, severe congenital 4, autosomal recessive, MIM# 612541
Prepair 500+ v1.421 G6PC Zornitza Stark Marked gene: G6PC as ready
Prepair 500+ v1.421 G6PC Zornitza Stark Gene: g6pc has been classified as Green List (High Evidence).
Prepair 500+ v1.421 G6PC Zornitza Stark Phenotypes for gene: G6PC were changed from Glycogen storage disease Ia, 232200 (3) to Glycogen storage disease Ia (MIM# 232200)
Prepair 500+ v1.420 FUCA1 Zornitza Stark Marked gene: FUCA1 as ready
Prepair 500+ v1.420 FUCA1 Zornitza Stark Gene: fuca1 has been classified as Green List (High Evidence).
Prepair 500+ v1.420 FUCA1 Zornitza Stark Phenotypes for gene: FUCA1 were changed from Fucosidosis, 230000 (3) to Fucosidosis, MIM# 230000
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Marked gene: FTSJ1 as ready
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence).
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549
Prepair 500+ v1.418 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Prepair 500+ v1.417 FREM2 Zornitza Stark Marked gene: FREM2 as ready
Prepair 500+ v1.417 FREM2 Zornitza Stark Gene: frem2 has been classified as Green List (High Evidence).
Prepair 500+ v1.417 FREM2 Zornitza Stark Phenotypes for gene: FREM2 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome, MIM#219000
Prepair 500+ v1.416 FREM2 Zornitza Stark Publications for gene: FREM2 were set to
Prepair 500+ v1.415 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Prepair 500+ v1.415 FRAS1 Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence).
Prepair 500+ v1.415 FRAS1 Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000
Prepair 500+ v1.414 FRAS1 Zornitza Stark Publications for gene: FRAS1 were set to
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Marked gene: FOXRED1 as ready
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Gene: foxred1 has been classified as Green List (High Evidence).
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Phenotypes for gene: FOXRED1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 19, MIM# 618241
Prepair 500+ v1.412 FOXRED1 Zornitza Stark Publications for gene: FOXRED1 were set to
Prepair 500+ v1.411 FOXN1 Zornitza Stark Marked gene: FOXN1 as ready
Prepair 500+ v1.411 FOXN1 Zornitza Stark Gene: foxn1 has been classified as Green List (High Evidence).
Prepair 500+ v1.411 FOXN1 Zornitza Stark Phenotypes for gene: FOXN1 were changed from T-cell immunodeficiency, congenital alopecia, and nail dystrophy, 601705 (3) to T-cell immunodeficiency, congenital alopecia, and nail dystrophy MIM#601705
Prepair 500+ v1.410 FOXN1 Zornitza Stark Publications for gene: FOXN1 were set to
Prepair 500+ v1.409 FMR1 Zornitza Stark Marked gene: FMR1 as ready
Prepair 500+ v1.409 FMR1 Zornitza Stark Gene: fmr1 has been classified as Green List (High Evidence).
Prepair 500+ v1.409 FMR1 Zornitza Stark Phenotypes for gene: FMR1 were changed from Fragile X syndrome to Fragile X syndrome, MIM #300624
Prepair 500+ v1.408 FMR1 Zornitza Stark Publications for gene: FMR1 were set to
Prepair 500+ v1.407 FLNA Zornitza Stark Marked gene: FLNA as ready
Prepair 500+ v1.407 FLNA Zornitza Stark Gene: flna has been classified as Green List (High Evidence).
Prepair 500+ v1.407 FLNA Zornitza Stark Phenotypes for gene: FLNA were changed from FG syndrome 2, 300321 (3) to Frontometaphyseal dysplasia 1, MIM#305620; Heterotopia, periventricular, 1, MIM#300049; Intestinal pseudoobstruction, neuronal, MIM#300048; Melnick-Needles syndrome, MIM#309350; Otopalatodigital syndrome, type I, MIM#311300; Otopalatodigital syndrome, type II, MIM#304120; Terminal osseous dysplasia, MIM#300244
Prepair 500+ v1.406 FLNA Zornitza Stark Publications for gene: FLNA were set to
Prepair 500+ v1.405 FKTN Zornitza Stark Marked gene: FKTN as ready
Prepair 500+ v1.405 FKTN Zornitza Stark Gene: fktn has been classified as Green List (High Evidence).
Prepair 500+ v1.405 FKTN Zornitza Stark Phenotypes for gene: FKTN were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4, 253800 (3) to Muscular dystrophy-dystroglycanopathy MONDO:0018276
Prepair 500+ v1.404 FKTN Zornitza Stark Publications for gene: FKTN were set to
Prepair 500+ v1.403 FKRP Zornitza Stark Marked gene: FKRP as ready
Prepair 500+ v1.403 FKRP Zornitza Stark Gene: fkrp has been classified as Green List (High Evidence).
Prepair 500+ v1.403 FKRP Zornitza Stark Phenotypes for gene: FKRP were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5, 613153 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 (MIM#613153); Muscular dystrophy-dystroglycanopathy (congenital with or without intellectual development), type B, 5 (MIM#606612); Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 (MIM#607155)
Prepair 500+ v1.402 FKRP Zornitza Stark Publications for gene: FKRP were set to
Prepair 500+ v1.401 FKBP10 Zornitza Stark Marked gene: FKBP10 as ready
Prepair 500+ v1.401 FKBP10 Zornitza Stark Gene: fkbp10 has been classified as Green List (High Evidence).
Prepair 500+ v1.401 FKBP10 Zornitza Stark Phenotypes for gene: FKBP10 were changed from Bruck syndrome 1, 259450 (3) to Bruck syndrome 1, MIM#259450; osteogenesis imperfecta, type XI, MIM#610968
Prepair 500+ v1.400 FKBP10 Zornitza Stark Publications for gene: FKBP10 were set to
Prepair 500+ v1.399 FHL1 Zornitza Stark Marked gene: FHL1 as ready
Prepair 500+ v1.399 FHL1 Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.399 FHL1 Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680
Prepair 500+ v1.398 FHL1 Zornitza Stark Publications for gene: FHL1 were set to
Prepair 500+ v1.397 FH Zornitza Stark Marked gene: FH as ready
Prepair 500+ v1.397 FH Zornitza Stark Gene: fh has been classified as Green List (High Evidence).
Prepair 500+ v1.397 FH Zornitza Stark Phenotypes for gene: FH were changed from Fumarase deficiency, 606812 (3) to Fumarase deficiency, MIM# 606812
Prepair 500+ v1.396 FH Zornitza Stark Publications for gene: FH were set to
Prepair 500+ v1.395 FBXO7 Zornitza Stark Marked gene: FBXO7 as ready
Prepair 500+ v1.395 FBXO7 Zornitza Stark Gene: fbxo7 has been classified as Green List (High Evidence).
Prepair 500+ v1.395 FBXO7 Zornitza Stark Phenotypes for gene: FBXO7 were changed from Parkinson disease 15, autosomal recessive, 260300 (3) to Parkinson disease 15, autosomal recessive, MIM#260300
Prepair 500+ v1.394 FBXO7 Zornitza Stark Publications for gene: FBXO7 were set to
Prepair 500+ v1.393 FBP1 Zornitza Stark Marked gene: FBP1 as ready
Prepair 500+ v1.393 FBP1 Zornitza Stark Gene: fbp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.393 FBP1 Zornitza Stark Phenotypes for gene: FBP1 were changed from Fructose-1,6-bisphosphatase deficiency, 229700 (3) to Fructose-1,6-bisphosphatase deficiency, MIM#229700
Prepair 500+ v1.392 FAT4 Zornitza Stark Marked gene: FAT4 as ready
Prepair 500+ v1.392 FAT4 Zornitza Stark Gene: fat4 has been classified as Green List (High Evidence).
Prepair 500+ v1.392 FAT4 Zornitza Stark Phenotypes for gene: FAT4 were changed from Hennekam lymphangiectasia-lymphedema syndrome 2, 616006 (3) to Hennekam lymphangiectasia-lymphedema syndrome 2 MIM#616006; Van Maldergem syndrome 2 MIM#615546
Prepair 500+ v1.391 FAT4 Zornitza Stark Publications for gene: FAT4 were set to
Prepair 500+ v1.390 FANCL Zornitza Stark Marked gene: FANCL as ready
Prepair 500+ v1.390 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Prepair 500+ v1.390 FANCL Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083
Prepair 500+ v1.389 FANCL Zornitza Stark Publications for gene: FANCL were set to
Prepair 500+ v1.388 FANCI Zornitza Stark Marked gene: FANCI as ready
Prepair 500+ v1.388 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Prepair 500+ v1.388 FANCI Zornitza Stark Phenotypes for gene: FANCI were changed from Fanconi anemia, complementation group I, 609053 (3) to Fanconi anaemia, complementation group I, MIM#609053
Prepair 500+ v1.387 FANCI Zornitza Stark Publications for gene: FANCI were set to
Prepair 500+ v1.386 FANCG Zornitza Stark Marked gene: FANCG as ready
Prepair 500+ v1.386 FANCG Zornitza Stark Gene: fancg has been classified as Green List (High Evidence).
Prepair 500+ v1.386 FANCG Zornitza Stark Phenotypes for gene: FANCG were changed from Fanconi anemia, complementation group G, 614082 (3) to Fanconi anaemia, complementation group G, MIM#614082
Prepair 500+ v1.385 FANCG Zornitza Stark Publications for gene: FANCG were set to
Prepair 500+ v1.384 FANCF Zornitza Stark Marked gene: FANCF as ready
Prepair 500+ v1.384 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Prepair 500+ v1.384 FANCF Zornitza Stark Phenotypes for gene: FANCF were changed from Fanconi anemia, complementation group F, 603467 (3) to Fanconi anaemia, complementation group F, MIM#603467
Prepair 500+ v1.383 FANCF Zornitza Stark Publications for gene: FANCF were set to
Prepair 500+ v1.382 FANCE Zornitza Stark Marked gene: FANCE as ready
Prepair 500+ v1.382 FANCE Zornitza Stark Gene: fance has been classified as Green List (High Evidence).
Prepair 500+ v1.382 FANCE Zornitza Stark Phenotypes for gene: FANCE were changed from Fanconi anemia, complementation group E, 600901 (3) to Fanconi anaemia, complementation group E, MIM#600901
Prepair 500+ v1.381 FANCE Zornitza Stark Publications for gene: FANCE were set to
Prepair 500+ v1.380 FANCD2 Zornitza Stark Marked gene: FANCD2 as ready
Prepair 500+ v1.380 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Prepair 500+ v1.380 FANCD2 Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2, MIM#227646
Prepair 500+ v1.379 FANCD2 Zornitza Stark Publications for gene: FANCD2 were set to
Prepair 500+ v1.378 FANCC Zornitza Stark Marked gene: FANCC as ready
Prepair 500+ v1.378 FANCC Zornitza Stark Gene: fancc has been classified as Green List (High Evidence).
Prepair 500+ v1.378 FANCC Zornitza Stark Phenotypes for gene: FANCC were changed from Fanconi anemia, complementation group C, 227645 (3) to Fanconi anaemia, complementation group C, MIM#227645
Prepair 500+ v1.377 FANCC Zornitza Stark Publications for gene: FANCC were set to
Prepair 500+ v1.376 FANCB Zornitza Stark Marked gene: FANCB as ready
Prepair 500+ v1.376 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Prepair 500+ v1.376 FANCB Zornitza Stark Phenotypes for gene: FANCB were changed from Fanconi anemia, complementation group B, 300514 (3) to Fanconi anaemia, complementation group B, MIM#300514
Prepair 500+ v1.375 FANCA Zornitza Stark Marked gene: FANCA as ready
Prepair 500+ v1.375 FANCA Zornitza Stark Gene: fanca has been classified as Green List (High Evidence).
Prepair 500+ v1.375 FANCA Zornitza Stark Phenotypes for gene: FANCA were changed from Fanconi anemia, complementation group A, 227650 (3) to Fanconi anaemia, complementation group A, MIM# 227650; MONDO:0009215
Prepair 500+ v1.374 FAM126A Zornitza Stark Marked gene: FAM126A as ready
Prepair 500+ v1.374 FAM126A Zornitza Stark Gene: fam126a has been classified as Green List (High Evidence).
Prepair 500+ v1.374 FAM126A Zornitza Stark Phenotypes for gene: FAM126A were changed from Leukodystrophy, hypomyelinating, 5, 610532 (3) to Leukodystrophy, hypomyelinating, 5 MIM#610532
Prepair 500+ v1.373 FAM126A Zornitza Stark Publications for gene: FAM126A were set to
Prepair 500+ v1.372 FAH Zornitza Stark Marked gene: FAH as ready
Prepair 500+ v1.372 FAH Zornitza Stark Gene: fah has been classified as Green List (High Evidence).
Prepair 500+ v1.372 FAH Zornitza Stark Phenotypes for gene: FAH were changed from Tyrosinemia, type I, 276700 (3) to Tyrosinaemia, type I, MIM# 276700
Prepair 500+ v1.371 FAH Zornitza Stark Publications for gene: FAH were set to
Prepair 500+ v1.370 F2 Zornitza Stark Marked gene: F2 as ready
Prepair 500+ v1.370 F2 Zornitza Stark Gene: f2 has been classified as Green List (High Evidence).
Prepair 500+ v1.370 F2 Zornitza Stark Phenotypes for gene: F2 were changed from Hypoprothrombinaemia (MIM#613679); Dysprothrombinaemia, 613679 to Hypoprothrombinaemia (MIM#613679)
Prepair 500+ v1.369 F2 Zornitza Stark Publications for gene: F2 were set to
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Marked gene: EXOSC8 as ready
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Gene: exosc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Phenotypes for gene: EXOSC8 were changed from Pontocerebellar hypoplasia, type 1C, 616081 (3) to Pontocerebellar hypoplasia, type 1C, MIM#616081
Prepair 500+ v1.367 EXOSC8 Zornitza Stark Publications for gene: EXOSC8 were set to
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Marked gene: EXOSC3 as ready
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Gene: exosc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Phenotypes for gene: EXOSC3 were changed from Pontocerebellar hypoplasia, type 1B, 614678 (3) to Pontocerebellar hypoplasia, type 1B, MIM# 614678
Prepair 500+ v1.365 EXOSC3 Zornitza Stark Publications for gene: EXOSC3 were set to
Prepair 500+ v1.364 EVC2 Zornitza Stark Marked gene: EVC2 as ready
Prepair 500+ v1.364 EVC2 Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.364 EVC2 Zornitza Stark Phenotypes for gene: EVC2 were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome MIM#225500
Prepair 500+ v1.363 EVC2 Zornitza Stark Publications for gene: EVC2 were set to
Prepair 500+ v1.362 EVC Zornitza Stark Marked gene: EVC as ready
Prepair 500+ v1.362 EVC Zornitza Stark Gene: evc has been classified as Green List (High Evidence).
Prepair 500+ v1.362 EVC Zornitza Stark Phenotypes for gene: EVC were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome, MIM# 225500
Prepair 500+ v1.361 EVC Zornitza Stark Publications for gene: EVC were set to
Prepair 500+ v1.360 ETHE1 Zornitza Stark Marked gene: ETHE1 as ready
Prepair 500+ v1.360 ETHE1 Zornitza Stark Gene: ethe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.360 ETHE1 Zornitza Stark Phenotypes for gene: ETHE1 were changed from Ethylmalonic encephalopathy, 602473 (3) to Ethylmalonic encephalopathy, MIM#602473
Prepair 500+ v1.359 ETHE1 Zornitza Stark Publications for gene: ETHE1 were set to
Prepair 500+ v1.358 ETFDH Zornitza Stark Marked gene: ETFDH as ready
Prepair 500+ v1.358 ETFDH Zornitza Stark Gene: etfdh has been classified as Green List (High Evidence).
Prepair 500+ v1.358 ETFDH Zornitza Stark Phenotypes for gene: ETFDH were changed from Glutaric acidemia IIC, 231680 (3) to Glutaric acidemia IIC, MIM# 231680
Prepair 500+ v1.357 ETFDH Zornitza Stark Publications for gene: ETFDH were set to
Prepair 500+ v1.356 ETFB Zornitza Stark Marked gene: ETFB as ready
Prepair 500+ v1.356 ETFB Zornitza Stark Gene: etfb has been classified as Green List (High Evidence).
Prepair 500+ v1.356 ETFB Zornitza Stark Phenotypes for gene: ETFB were changed from Glutaric acidemia IIB, 231680 (3) to Glutaric acidemia IIB, MIM# 231680
Prepair 500+ v1.355 ETFB Zornitza Stark Publications for gene: ETFB were set to
Prepair 500+ v1.354 ETFA Zornitza Stark Marked gene: ETFA as ready
Prepair 500+ v1.354 ETFA Zornitza Stark Gene: etfa has been classified as Green List (High Evidence).
Prepair 500+ v1.354 ETFA Zornitza Stark Phenotypes for gene: ETFA were changed from Glutaric acidemia IIA, 231680 (3) to Glutaric acidemia IIA, MIM# 231680
Prepair 500+ v1.353 ETFA Zornitza Stark Publications for gene: ETFA were set to
Prepair 500+ v1.352 ESCO2 Zornitza Stark Marked gene: ESCO2 as ready
Prepair 500+ v1.352 ESCO2 Zornitza Stark Gene: esco2 has been classified as Green List (High Evidence).
Prepair 500+ v1.352 ESCO2 Zornitza Stark Phenotypes for gene: ESCO2 were changed from SC phocomelia syndrome, 269000 (3) to Roberts-SC phocomelia syndrome (MIM#268300)
Prepair 500+ v1.351 ESCO2 Zornitza Stark Publications for gene: ESCO2 were set to
Prepair 500+ v1.350 ERCC8 Zornitza Stark Marked gene: ERCC8 as ready
Prepair 500+ v1.350 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.350 ERCC8 Zornitza Stark Phenotypes for gene: ERCC8 were changed from Cockayne syndrome, type A, 216400 (3) to Cockayne syndrome, type A, MIM#216400
Prepair 500+ v1.349 ERCC6 Zornitza Stark Marked gene: ERCC6 as ready
Prepair 500+ v1.349 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Prepair 500+ v1.349 ERCC6 Zornitza Stark Phenotypes for gene: ERCC6 were changed from Cockayne syndrome, type B, 133540 (3) to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506
Prepair 500+ v1.348 ERCC6 Zornitza Stark Publications for gene: ERCC6 were set to
Prepair 500+ v1.347 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Prepair 500+ v1.347 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Prepair 500+ v1.347 ERCC5 Zornitza Stark Phenotypes for gene: ERCC5 were changed from Xeroderma pigmentosum, group G, 278780 (3) to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Prepair 500+ v1.346 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to
Prepair 500+ v1.345 ERCC4 Zornitza Stark Marked gene: ERCC4 as ready
Prepair 500+ v1.345 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Prepair 500+ v1.345 ERCC4 Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590
Prepair 500+ v1.344 ERCC2 Zornitza Stark Marked gene: ERCC2 as ready
Prepair 500+ v1.344 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.344 ERCC2 Zornitza Stark Phenotypes for gene: ERCC2 were changed from Cerebrooculofacioskeletal syndrome 2, 610756 (3) to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675; Xeroderma pigmentosum, group D, MIM# 278730
Prepair 500+ v1.343 ERCC2 Zornitza Stark Publications for gene: ERCC2 were set to
Prepair 500+ v1.342 EPG5 Zornitza Stark Marked gene: EPG5 as ready
Prepair 500+ v1.342 EPG5 Zornitza Stark Gene: epg5 has been classified as Green List (High Evidence).
Prepair 500+ v1.342 EPG5 Zornitza Stark Phenotypes for gene: EPG5 were changed from Vici syndrome, 242840 (3) to Vici syndrome MIM# 242840
Prepair 500+ v1.341 EPG5 Zornitza Stark Publications for gene: EPG5 were set to
Prepair 500+ v1.340 ENPP1 Zornitza Stark Marked gene: ENPP1 as ready
Prepair 500+ v1.340 ENPP1 Zornitza Stark Gene: enpp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.340 ENPP1 Zornitza Stark Phenotypes for gene: ENPP1 were changed from Hypophosphatemic rickets, autosomal recessive, 2, 613312 (3) to Arterial calcification, generalized, of infancy, 1 MIM#208000; Hypophosphatemic rickets, autosomal recessive, 2 MIM#613312
Prepair 500+ v1.339 ENPP1 Zornitza Stark Publications for gene: ENPP1 were set to
Prepair 500+ v1.338 EMD Zornitza Stark Marked gene: EMD as ready
Prepair 500+ v1.338 EMD Zornitza Stark Gene: emd has been classified as Green List (High Evidence).
Prepair 500+ v1.338 EMD Zornitza Stark Phenotypes for gene: EMD were changed from Emery-Dreifuss muscular dystrophy 1, X-linked, 310300 (3) to Emery-Dreifuss muscular dystrophy 1, X-linked, MIM# 310300
Prepair 500+ v1.337 EMD Zornitza Stark Publications for gene: EMD were set to
Prepair 500+ v1.336 ELP1 Zornitza Stark Marked gene: ELP1 as ready
Prepair 500+ v1.336 ELP1 Zornitza Stark Gene: elp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.336 ELP1 Zornitza Stark Phenotypes for gene: ELP1 were changed from Dysautonomia, familial, 223900 (3) to Dysautonomia, familial MIM#223900
Prepair 500+ v1.335 ELP1 Zornitza Stark Publications for gene: ELP1 were set to
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Marked gene: EIF2B5 as ready
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Gene: eif2b5 has been classified as Green List (High Evidence).
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Phenotypes for gene: EIF2B5 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 5, with or without ovarian failure (MIM#620315)
Prepair 500+ v1.333 EIF2B5 Zornitza Stark Publications for gene: EIF2B5 were set to
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Marked gene: EIF2B4 as ready
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Gene: eif2b4 has been classified as Green List (High Evidence).
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Phenotypes for gene: EIF2B4 were changed from Leukoencephaly with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 4, with or without ovarian failure MIM#620314
Prepair 500+ v1.331 EIF2B4 Zornitza Stark Publications for gene: EIF2B4 were set to
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Marked gene: EIF2B3 as ready
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence).
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313
Prepair 500+ v1.329 EIF2B3 Zornitza Stark Publications for gene: EIF2B3 were set to
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Marked gene: EIF2B2 as ready
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Gene: eif2b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Phenotypes for gene: EIF2B2 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 2, with or without ovarian failure, MIM #620312
Prepair 500+ v1.327 EIF2B2 Zornitza Stark Publications for gene: EIF2B2 were set to
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Marked gene: EIF2B1 as ready
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Gene: eif2b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Phenotypes for gene: EIF2B1 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 1, with or without ovarian failure MIM#603896
Prepair 500+ v1.325 EIF2B1 Zornitza Stark Publications for gene: EIF2B1 were set to
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Marked gene: EIF2AK3 as ready
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Gene: eif2ak3 has been classified as Green List (High Evidence).
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Phenotypes for gene: EIF2AK3 were changed from Wolcott-Rallison syndrome, 226980 (3) to Wolcott-Rallison syndrome MIM#226980
Prepair 500+ v1.323 EIF2AK3 Zornitza Stark Publications for gene: EIF2AK3 were set to
Prepair 500+ v1.322 EDA Zornitza Stark Marked gene: EDA as ready
Prepair 500+ v1.322 EDA Zornitza Stark Gene: eda has been classified as Green List (High Evidence).
Prepair 500+ v1.322 EDA Zornitza Stark Phenotypes for gene: EDA were changed from Ectodermal dysplasia 1, hypohidrotic, X-linked, 305100 (3) to Ectodermal dysplasia 1, hypohidrotic, X-linked MIM#305100; Tooth agenesis, selective, X-linked 1 MIM#313500
Prepair 500+ v1.321 EDA Zornitza Stark Publications for gene: EDA were set to
Prepair 500+ v1.320 ECHS1 Zornitza Stark Marked gene: ECHS1 as ready
Prepair 500+ v1.320 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.320 ECHS1 Zornitza Stark Phenotypes for gene: ECHS1 were changed from Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, 616277 (3) to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277
Prepair 500+ v1.319 ECHS1 Zornitza Stark Publications for gene: ECHS1 were set to
Prepair 500+ v1.318 DYSF Zornitza Stark Marked gene: DYSF as ready
Prepair 500+ v1.318 DYSF Zornitza Stark Gene: dysf has been classified as Green List (High Evidence).
Prepair 500+ v1.318 DYSF Zornitza Stark Phenotypes for gene: DYSF were changed from Muscular dystrophy, limb-girdle, type 2B, 253601 (3) to Miyoshi muscular dystrophy 1 MIM#254130; MONDO:0024545; Muscular dystrophy, limb-girdle, autosomal recessive 2 MIM#253601; MONDO:0009676; Myopathy, distal, with anterior tibial onset MIM#606768; MONDO:0011721
Prepair 500+ v1.317 DYSF Zornitza Stark Publications for gene: DYSF were set to
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Marked gene: DYNC2H1 as ready
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Gene: dync2h1 has been classified as Green List (High Evidence).
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Phenotypes for gene: DYNC2H1 were changed from Short-rib thoracic dysplasia 3 with or without polydactyly, 613091 (3) to Short-rib thoracic dysplasia 3 with or without polydactyly, MIM#613091
Prepair 500+ v1.315 DYNC2H1 Zornitza Stark Publications for gene: DYNC2H1 were set to
Prepair 500+ v1.314 DYM Zornitza Stark Marked gene: DYM as ready
Prepair 500+ v1.314 DYM Zornitza Stark Gene: dym has been classified as Green List (High Evidence).
Prepair 500+ v1.314 DYM Zornitza Stark Phenotypes for gene: DYM were changed from Dyggve-Melchior-Clausen disease, 223800 (3) to Dyggve-Melchior-Clausen disease MIM#223800; Smith-McCort dysplasia MIM#607326
Prepair 500+ v1.313 DYM Zornitza Stark Publications for gene: DYM were set to
Prepair 500+ v1.312 DOK7 Zornitza Stark Marked gene: DOK7 as ready
Prepair 500+ v1.312 DOK7 Zornitza Stark Gene: dok7 has been classified as Green List (High Evidence).
Prepair 500+ v1.312 DOK7 Zornitza Stark Phenotypes for gene: DOK7 were changed from Myasthenic syndrome, congenital, 10, 254300 (3) to Myasthenic syndrome, congenital, 10, MIM# 254300; Fetal akinesia deformation sequence 3, MIM# 618389
Prepair 500+ v1.311 DOK7 Zornitza Stark Publications for gene: DOK7 were set to
Prepair 500+ v1.310 DOCK6 Zornitza Stark Marked gene: DOCK6 as ready
Prepair 500+ v1.310 DOCK6 Zornitza Stark Gene: dock6 has been classified as Green List (High Evidence).
Prepair 500+ v1.310 DOCK6 Zornitza Stark Phenotypes for gene: DOCK6 were changed from Adams-Oliver syndrome 2, 614219 (3) to Adams-Oliver syndrome 2, MIM# 614219
Prepair 500+ v1.309 DOCK6 Zornitza Stark Publications for gene: DOCK6 were set to
Prepair 500+ v1.308 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Prepair 500+ v1.308 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Prepair 500+ v1.308 DNMT3B Zornitza Stark Phenotypes for gene: DNMT3B were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 242860 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 1 (MIM#242860)
Prepair 500+ v1.307 DNAI2 Zornitza Stark Marked gene: DNAI2 as ready
Prepair 500+ v1.307 DNAI2 Zornitza Stark Gene: dnai2 has been classified as Green List (High Evidence).
Prepair 500+ v1.307 DNAI2 Zornitza Stark Phenotypes for gene: DNAI2 were changed from Ciliary dyskinesia, primary, 9, with or without situs inversus, 612444 (3) to Ciliary dyskinesia, primary, 9, with or without situs inversus, MIM# 612444
Prepair 500+ v1.306 DNAI2 Zornitza Stark Publications for gene: DNAI2 were set to
Prepair 500+ v1.305 DNAI1 Zornitza Stark Marked gene: DNAI1 as ready
Prepair 500+ v1.305 DNAI1 Zornitza Stark Gene: dnai1 has been classified as Green List (High Evidence).
Prepair 500+ v1.305 DNAI1 Zornitza Stark Phenotypes for gene: DNAI1 were changed from Ciliary dyskinesia, primary, 1, with or without situs inversus, 244400 (3) to Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400
Prepair 500+ v1.304 DNAI1 Zornitza Stark Publications for gene: DNAI1 were set to
Prepair 500+ v1.303 DNAH5 Zornitza Stark Marked gene: DNAH5 as ready
Prepair 500+ v1.303 DNAH5 Zornitza Stark Gene: dnah5 has been classified as Green List (High Evidence).
Prepair 500+ v1.303 DNAH5 Zornitza Stark Phenotypes for gene: DNAH5 were changed from Ciliary dyskinesia, primary, 3, with or without situs inversus, 608644 (3) to Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644
Prepair 500+ v1.302 DNAH5 Zornitza Stark Publications for gene: DNAH5 were set to
Prepair 500+ v1.301 DNAH11 Zornitza Stark Marked gene: DNAH11 as ready
Prepair 500+ v1.301 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Prepair 500+ v1.301 DNAH11 Zornitza Stark Phenotypes for gene: DNAH11 were changed from Ciliary dyskinesia, primary, 7, with or without situs inversus, 611884 (3) to Ciliary dyskinesia, primary, 7, with or without situs inversus, MIM#611884
Prepair 500+ v1.300 DNAH11 Zornitza Stark Publications for gene: DNAH11 were set to
Prepair 500+ v1.299 DMD Zornitza Stark Marked gene: DMD as ready
Prepair 500+ v1.299 DMD Zornitza Stark Gene: dmd has been classified as Green List (High Evidence).
Prepair 500+ v1.299 DMD Zornitza Stark Phenotypes for gene: DMD were changed from Duchenne muscular dystrophy, 310200 (3) to Duchenne muscular dystrophy MIM#310200
Prepair 500+ v1.298 DMD Zornitza Stark Publications for gene: DMD were set to
Prepair 500+ v1.297 DLL3 Zornitza Stark Marked gene: DLL3 as ready
Prepair 500+ v1.297 DLL3 Zornitza Stark Gene: dll3 has been classified as Green List (High Evidence).
Prepair 500+ v1.297 DLL3 Zornitza Stark Phenotypes for gene: DLL3 were changed from Spondylocostal dysostosis 1, autosomal recessive, 277300 (3) to Spondylocostal dysostosis 1, autosomal recessive, MIM# 277300; MONDO:0020692
Prepair 500+ v1.296 DLL3 Zornitza Stark Publications for gene: DLL3 were set to
Prepair 500+ v1.295 DLG3 Zornitza Stark Marked gene: DLG3 as ready
Prepair 500+ v1.295 DLG3 Zornitza Stark Gene: dlg3 has been classified as Green List (High Evidence).
Prepair 500+ v1.295 DLG3 Zornitza Stark Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, 300850 (3) to Intellectual developmental disorder, X-linked 90 MIM#300850
Prepair 500+ v1.294 DLG3 Zornitza Stark Publications for gene: DLG3 were set to
Prepair 500+ v1.293 DLD Zornitza Stark Marked gene: DLD as ready
Prepair 500+ v1.293 DLD Zornitza Stark Gene: dld has been classified as Green List (High Evidence).
Prepair 500+ v1.293 DLD Zornitza Stark Phenotypes for gene: DLD were changed from Dihydrolipoamide dehydrogenase deficiency, 246900 (3) to Dihydrolipoamide dehydrogenase deficiency (MIM#246900)
Prepair 500+ v1.292 DLD Zornitza Stark Publications for gene: DLD were set to
Prepair 500+ v1.291 DKC1 Zornitza Stark Marked gene: DKC1 as ready
Prepair 500+ v1.291 DKC1 Zornitza Stark Gene: dkc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.291 DKC1 Zornitza Stark Phenotypes for gene: DKC1 were changed from Dyskeratosis congenita, X-linked, 305000 (3) to Dyskeratosis congenita, X-linked MIM#305000
Prepair 500+ v1.290 DKC1 Zornitza Stark Publications for gene: DKC1 were set to
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Marked gene: DIS3L2 as ready
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence).
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Phenotypes for gene: DIS3L2 were changed from Perlman syndrome, 267000 (3) to Perlman syndrome MIM# 267000
Prepair 500+ v1.288 DIS3L2 Zornitza Stark Publications for gene: DIS3L2 were set to
Prepair 500+ v1.287 DHDDS Zornitza Stark Marked gene: DHDDS as ready
Prepair 500+ v1.287 DHDDS Zornitza Stark Gene: dhdds has been classified as Green List (High Evidence).
Prepair 500+ v1.287 DHDDS Zornitza Stark Phenotypes for gene: DHDDS were changed from Retinitis pigmentosa 59, 613861 (3) to Retinitis pigmentosa 59, MIM#613861; Congenital disorder of glycosylation, type 1bb, MIM# 613861
Prepair 500+ v1.286 DHDDS Zornitza Stark Publications for gene: DHDDS were set to
Prepair 500+ v1.285 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Prepair 500+ v1.285 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Prepair 500+ v1.285 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith-Lemli-Opitz syndrome, 270400 (3) to Smith-Lemli-Opitz syndrome (MIM#270400)
Prepair 500+ v1.284 DHCR7 Zornitza Stark Publications for gene: DHCR7 were set to
Prepair 500+ v1.283 DHCR24 Zornitza Stark Marked gene: DHCR24 as ready
Prepair 500+ v1.283 DHCR24 Zornitza Stark Gene: dhcr24 has been classified as Green List (High Evidence).
Prepair 500+ v1.283 DHCR24 Zornitza Stark Phenotypes for gene: DHCR24 were changed from Desmosterolosis, 602398 (3) to Desmosterolosis, MIM#602398
Prepair 500+ v1.282 DHCR24 Zornitza Stark Publications for gene: DHCR24 were set to
Prepair 500+ v1.281 DGUOK Zornitza Stark Marked gene: DGUOK as ready
Prepair 500+ v1.281 DGUOK Zornitza Stark Gene: dguok has been classified as Green List (High Evidence).
Prepair 500+ v1.281 DGUOK Zornitza Stark Phenotypes for gene: DGUOK were changed from Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), 251880 (3) to Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880; Portal hypertension, noncirrhotic, 1, MIM# 617068; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070
Prepair 500+ v1.280 DGUOK Zornitza Stark Publications for gene: DGUOK were set to
Prepair 500+ v1.279 DGAT1 Zornitza Stark Marked gene: DGAT1 as ready
Prepair 500+ v1.279 DGAT1 Zornitza Stark Gene: dgat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.279 DGAT1 Zornitza Stark Phenotypes for gene: DGAT1 were changed from ?Diarrhea 7, protein-losing enteropathy type to Diarrhoea 7, protein-losing enteropathy type, MIM# 615863; congenital diarrhea 7 with exudative enteropathy MONDO:0014375
Prepair 500+ v1.278 DGAT1 Zornitza Stark Publications for gene: DGAT1 were set to
Prepair 500+ v1.277 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Prepair 500+ v1.277 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Prepair 500+ v1.277 DDX11 Zornitza Stark Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, 613398 (3) to Warsaw breakage syndrome MIM#613398
Prepair 500+ v1.276 DDX11 Zornitza Stark Publications for gene: DDX11 were set to
Prepair 500+ v1.275 DDC Zornitza Stark Marked gene: DDC as ready
Prepair 500+ v1.275 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Prepair 500+ v1.275 DDC Zornitza Stark Phenotypes for gene: DDC were changed from Aromatic L-amino acid decarboxylase deficiency, 608643 (3) to Aromatic L-amino acid decarboxylase deficiency MIM#608643; Aromatic L-amino acid decarboxylase deficiency (MIM#608643)
Prepair 500+ v1.274 DCX Zornitza Stark Marked gene: DCX as ready
Prepair 500+ v1.274 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Prepair 500+ v1.274 DCX Zornitza Stark Phenotypes for gene: DCX were changed from Lissencephaly, X-linked, 300067 (3) to Lissencephaly, X-linked MIM#300067; Subcortical laminal heterotopia, X-linked MIM#300067
Prepair 500+ v1.273 DCX Zornitza Stark Publications for gene: DCX were set to
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Marked gene: DCLRE1C as ready
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence).
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Phenotypes for gene: DCLRE1C were changed from Severe combined immunodeficiency, Athabascan type, 602450 (3) to Severe combined immunodeficiency, Athabascan type, MIM# 602450; Omenn syndrome, MIM# 603554
Prepair 500+ v1.271 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to
Prepair 500+ v1.270 DCAF17 Zornitza Stark Marked gene: DCAF17 as ready
Prepair 500+ v1.270 DCAF17 Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence).
Prepair 500+ v1.270 DCAF17 Zornitza Stark Phenotypes for gene: DCAF17 were changed from Woodhouse-Sakati syndrome, 241080 (3) to Woodhouse-Sakati syndrome MIM#241080
Prepair 500+ v1.269 DCAF17 Zornitza Stark Publications for gene: DCAF17 were set to
Prepair 500+ v1.268 DBT Zornitza Stark Marked gene: DBT as ready
Prepair 500+ v1.268 DBT Zornitza Stark Gene: dbt has been classified as Green List (High Evidence).
Prepair 500+ v1.268 DBT Zornitza Stark Phenotypes for gene: DBT were changed from Maple syrup urine disease, type II, 248600 (3) to Maple syrup urine disease, type II, MIM#248600
Prepair 500+ v1.267 D2HGDH Zornitza Stark Marked gene: D2HGDH as ready
Prepair 500+ v1.267 D2HGDH Zornitza Stark Gene: d2hgdh has been classified as Green List (High Evidence).
Prepair 500+ v1.267 D2HGDH Zornitza Stark Phenotypes for gene: D2HGDH were changed from D-2-hydroxyglutaric aciduria, 600721 (3) to D-2-hydroxyglutaric aciduria, MIM#600721
Prepair 500+ v1.266 D2HGDH Zornitza Stark Publications for gene: D2HGDH were set to
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Marked gene: CYP7B1 as ready
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Phenotypes for gene: CYP7B1 were changed from Bile acid synthesis defect, congenital, 3, 613812 (3) to Bile acid synthesis defect, congenital, 3, MIM#613812; Spastic paraplegia 5A, MIM#270800
Prepair 500+ v1.264 CYP7B1 Zornitza Stark Publications for gene: CYP7B1 were set to
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Marked gene: CYP27A1 as ready
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cerebrotendinous xanthomatosis, 213700 (3) to Cerebrotendinous xanthomatosis, MIM#213700
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Marked gene: CYP1B1 as ready
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Gene: cyp1b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Phenotypes for gene: CYP1B1 were changed from Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, 231300 (3) to Anterior segment dysgenesis 6, multiple subtypes, MIM#617315
Prepair 500+ v1.261 CYP1B1 Zornitza Stark Publications for gene: CYP1B1 were set to
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Marked gene: CYP17A1 as ready
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Gene: cyp17a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Phenotypes for gene: CYP17A1 were changed from 17,20-lyase deficiency, isolated, 202110 (3) to 17-alpha-hydroxylase/17,20-lyase deficiency MIM#202110
Prepair 500+ v1.259 CYP17A1 Zornitza Stark Publications for gene: CYP17A1 were set to
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Marked gene: CYP11B2 as ready
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Gene: cyp11b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Phenotypes for gene: CYP11B2 were changed from Hypoaldosteronism, congenital, due to CMO I deficiency, 203400 (3) to Hypoaldosteronism, congenital, due to CMO I deficiency MIM#203400; Hypoaldosteronism, congenital, due to CMO II deficiency MIM#610600
Prepair 500+ v1.257 CYP11B2 Zornitza Stark Publications for gene: CYP11B2 were set to
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Marked gene: CYP11A1 as ready
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Gene: cyp11a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Phenotypes for gene: CYP11A1 were changed from Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete, 613743 (3) to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete MIM#613743
Prepair 500+ v1.255 CYP11A1 Zornitza Stark Publications for gene: CYP11A1 were set to
Prepair 500+ v1.254 CYBB Zornitza Stark reviewed gene: CYBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chronic granulomatous disease, X-linked, MIM#306400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 500+ v1.254 CYBB Zornitza Stark Marked gene: CYBB as ready
Prepair 500+ v1.254 CYBB Zornitza Stark Gene: cybb has been classified as Green List (High Evidence).
Prepair 500+ v1.254 CYBB Zornitza Stark Phenotypes for gene: CYBB were changed from Chronic granulomatous disease, X-linked, 306400 (3) to Chronic granulomatous disease, X-linked, MIM#306400
Prepair 500+ v1.253 CYBB Zornitza Stark Publications for gene: CYBB were set to
Prepair 500+ v1.252 CYBA Zornitza Stark Marked gene: CYBA as ready
Prepair 500+ v1.252 CYBA Zornitza Stark Gene: cyba has been classified as Green List (High Evidence).
Prepair 500+ v1.252 CYBA Zornitza Stark Phenotypes for gene: CYBA were changed from Chronic granulomatous disease, autosomal, due to deficiency of CYBA, 233690 (3) to Chronic granulomatous disease 4 MIM#233690
Prepair 500+ v1.251 CYBA Zornitza Stark Publications for gene: CYBA were set to
Prepair 500+ v1.250 CUL4B Zornitza Stark Marked gene: CUL4B as ready
Prepair 500+ v1.250 CUL4B Zornitza Stark Gene: cul4b has been classified as Green List (High Evidence).
Prepair 500+ v1.250 CUL4B Zornitza Stark Phenotypes for gene: CUL4B were changed from Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354 (3) to Intellectual developmental disorder, X-linked syndromic, Cabezas type, MIM#300354
Prepair 500+ v1.249 CUL4B Zornitza Stark Publications for gene: CUL4B were set to
Prepair 500+ v1.248 CTSK Zornitza Stark Marked gene: CTSK as ready
Prepair 500+ v1.248 CTSK Zornitza Stark Gene: ctsk has been classified as Green List (High Evidence).
Prepair 500+ v1.248 CTSK Zornitza Stark Phenotypes for gene: CTSK were changed from Pycnodysostosis, 265800 (3) to Pycnodysostosis MIM#265800
Prepair 500+ v1.247 CTSK Zornitza Stark Publications for gene: CTSK were set to
Prepair 500+ v1.246 CTSD Zornitza Stark Marked gene: CTSD as ready
Prepair 500+ v1.246 CTSD Zornitza Stark Gene: ctsd has been classified as Green List (High Evidence).
Prepair 500+ v1.246 CTSD Zornitza Stark Phenotypes for gene: CTSD were changed from Ceroid lipofuscinosis, neuronal, 10, 610127 (3) to Ceroid lipofuscinosis, neuronal, 10, MIM# 610127
Prepair 500+ v1.245 CTSC Zornitza Stark Marked gene: CTSC as ready
Prepair 500+ v1.245 CTSC Zornitza Stark Gene: ctsc has been classified as Green List (High Evidence).
Prepair 500+ v1.245 CTSC Zornitza Stark Phenotypes for gene: CTSC were changed from Papillon-Lefevre syndrome, 245000 (3) to Haim-Munk syndrome MIM#245010; Papillon-Lefevre syndrome MIM#245000
Prepair 500+ v1.244 CTSA Zornitza Stark Marked gene: CTSA as ready
Prepair 500+ v1.244 CTSA Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence).
Prepair 500+ v1.244 CTSA Zornitza Stark Phenotypes for gene: CTSA were changed from Galactosialidosis, 256540 (3) to Galactosialidosis MIM#256540
Prepair 500+ v1.243 CTSA Zornitza Stark Publications for gene: CTSA were set to
Prepair 500+ v1.242 CTNS Zornitza Stark Marked gene: CTNS as ready
Prepair 500+ v1.242 CTNS Zornitza Stark Gene: ctns has been classified as Green List (High Evidence).
Prepair 500+ v1.242 CTNS Zornitza Stark Phenotypes for gene: CTNS were changed from Cystinosis, nephropathic, 219800 (3) to Cystinosis, nephropathic MIM#219800
Prepair 500+ v1.241 CTNS Zornitza Stark Publications for gene: CTNS were set to
Prepair 500+ v1.240 CSPP1 Zornitza Stark Marked gene: CSPP1 as ready
Prepair 500+ v1.240 CSPP1 Zornitza Stark Gene: cspp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.240 CSPP1 Zornitza Stark Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288
Prepair 500+ v1.239 CSPP1 Zornitza Stark Publications for gene: CSPP1 were set to
Prepair 500+ v1.238 CRTAP Zornitza Stark Marked gene: CRTAP as ready
Prepair 500+ v1.238 CRTAP Zornitza Stark Gene: crtap has been classified as Green List (High Evidence).
Prepair 500+ v1.238 CRTAP Zornitza Stark Phenotypes for gene: CRTAP were changed from Osteogenesis imperfecta, type VII, 610682 (3) to Osteogenesis imperfecta, type VII MIM#610682
Prepair 500+ v1.237 CRTAP Zornitza Stark Publications for gene: CRTAP were set to
Prepair 500+ v1.236 CRB1 Zornitza Stark Marked gene: CRB1 as ready
Prepair 500+ v1.236 CRB1 Zornitza Stark Gene: crb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.236 CRB1 Zornitza Stark Phenotypes for gene: CRB1 were changed from Leber congenital amaurosis 8, 613835 (3) to Leber congenital amaurosis 8, MIM#613835
Prepair 500+ v1.235 CRB1 Zornitza Stark Publications for gene: CRB1 were set to
Prepair 500+ v1.234 CPT2 Zornitza Stark Marked gene: CPT2 as ready
Prepair 500+ v1.234 CPT2 Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence).
Prepair 500+ v1.234 CPT2 Zornitza Stark Phenotypes for gene: CPT2 were changed from CPT II deficiency, lethal neonatal, 608836 (3) to CPT II deficiency, infantile MIM#600649; CPT II deficiency, lethal neonatal MIM#608836
Prepair 500+ v1.233 CPT2 Zornitza Stark Publications for gene: CPT2 were set to
Prepair 500+ v1.232 CPT1A Zornitza Stark Marked gene: CPT1A as ready
Prepair 500+ v1.232 CPT1A Zornitza Stark Gene: cpt1a has been classified as Green List (High Evidence).
Prepair 500+ v1.232 CPT1A Zornitza Stark Phenotypes for gene: CPT1A were changed from CPT deficiency, hepatic, type IA, 255120 (3) to CPT deficiency, hepatic, type IA, MIM#255120
Prepair 500+ v1.231 CPT1A Zornitza Stark Publications for gene: CPT1A were set to
Prepair 500+ v1.230 CPS1 Zornitza Stark Marked gene: CPS1 as ready
Prepair 500+ v1.230 CPS1 Zornitza Stark Gene: cps1 has been classified as Green List (High Evidence).
Prepair 500+ v1.230 CPS1 Zornitza Stark Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency, 237300 (3) to Carbamoylphosphate synthetase I deficiency MIM#237300
Prepair 500+ v1.229 CPS1 Zornitza Stark Publications for gene: CPS1 were set to
Prepair 500+ v1.228 COX15 Zornitza Stark Marked gene: COX15 as ready
Prepair 500+ v1.228 COX15 Zornitza Stark Gene: cox15 has been classified as Green List (High Evidence).
Prepair 500+ v1.228 COX15 Zornitza Stark Phenotypes for gene: COX15 were changed from Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 2, 615119 (3) to Mitochondrial complex IV deficiency, nuclear type 6, MIM #615119
Prepair 500+ v1.227 COX15 Zornitza Stark Publications for gene: COX15 were set to
Prepair 500+ v1.226 COLQ Zornitza Stark Marked gene: COLQ as ready
Prepair 500+ v1.226 COLQ Zornitza Stark Gene: colq has been classified as Green List (High Evidence).
Prepair 500+ v1.226 COLQ Zornitza Stark Phenotypes for gene: COLQ were changed from Myasthenic syndrome, congenital, 5, 603034 (3) to Myasthenic syndrome, congenital, 5 MIM#603034; MONDO:0011281
Prepair 500+ v1.225 COLQ Zornitza Stark Publications for gene: COLQ were set to
Prepair 500+ v1.224 COLEC11 Zornitza Stark Marked gene: COLEC11 as ready
Prepair 500+ v1.224 COLEC11 Zornitza Stark Gene: colec11 has been classified as Green List (High Evidence).
Prepair 500+ v1.224 COLEC11 Zornitza Stark Phenotypes for gene: COLEC11 were changed from 3MC syndrome 2, 265050 (3) to 3MC syndrome 2, MIM# 265050; MONDO:0009927
Prepair 500+ v1.223 COLEC11 Zornitza Stark Publications for gene: COLEC11 were set to
Prepair 500+ v1.222 COL7A1 Zornitza Stark Marked gene: COL7A1 as ready
Prepair 500+ v1.222 COL7A1 Zornitza Stark Gene: col7a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.222 COL7A1 Zornitza Stark Phenotypes for gene: COL7A1 were changed from Epidermolysis bullosa dystrophica, AR, 226600 (3) to Epidermolysis bullosa dystrophica inversa MIM#226600; Epidermolysis bullosa dystrophica, autosomal recessive MIM#226600; Epidermolysis bullosa dystrophica, localisata variant MIM#226600; Epidermolysis bullosa pruriginosa MIM#604129
Prepair 500+ v1.221 COL7A1 Zornitza Stark Publications for gene: COL7A1 were set to
Prepair 500+ v1.220 COL6A1 Zornitza Stark Marked gene: COL6A1 as ready
Prepair 500+ v1.220 COL6A1 Zornitza Stark Gene: col6a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.220 COL6A1 Zornitza Stark Phenotypes for gene: COL6A1 were changed from Ullrich congenital muscular dystrophy 1, 254090 (3) to Ullrich congenital muscular dystrophy 1A MIM#254090
Prepair 500+ v1.219 COL6A1 Zornitza Stark Publications for gene: COL6A1 were set to
Prepair 500+ v1.218 COL4A5 Zornitza Stark Marked gene: COL4A5 as ready
Prepair 500+ v1.218 COL4A5 Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence).
Prepair 500+ v1.218 COL4A5 Zornitza Stark Phenotypes for gene: COL4A5 were changed from Alport syndrome 1, X-linked to Alport syndrome 1, X-linked, MIM#301050
Prepair 500+ v1.217 COL4A5 Zornitza Stark Publications for gene: COL4A5 were set to
Prepair 500+ v1.216 COL4A4 Zornitza Stark Marked gene: COL4A4 as ready
Prepair 500+ v1.216 COL4A4 Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence).
Prepair 500+ v1.216 COL4A4 Zornitza Stark Phenotypes for gene: COL4A4 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 2, autosomal recessive MIM# 203780
Prepair 500+ v1.215 COL4A4 Zornitza Stark Publications for gene: COL4A4 were set to
Prepair 500+ v1.214 COL4A3 Zornitza Stark Marked gene: COL4A3 as ready
Prepair 500+ v1.214 COL4A3 Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence).
Prepair 500+ v1.214 COL4A3 Zornitza Stark Phenotypes for gene: COL4A3 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 3b, autosomal recessive MIM#620536; MONDO:0957811
Prepair 500+ v1.213 COL4A3 Zornitza Stark Publications for gene: COL4A3 were set to
Prepair 500+ v1.212 COL27A1 Zornitza Stark Marked gene: COL27A1 as ready
Prepair 500+ v1.212 COL27A1 Zornitza Stark Gene: col27a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.212 COL27A1 Zornitza Stark Phenotypes for gene: COL27A1 were changed from Steel Syndrome to Steel syndrome (MIM#615155)
Prepair 500+ v1.211 COL27A1 Zornitza Stark Publications for gene: COL27A1 were set to
Prepair 500+ v1.210 COL18A1 Zornitza Stark Marked gene: COL18A1 as ready
Prepair 500+ v1.210 COL18A1 Zornitza Stark Gene: col18a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.210 COL18A1 Zornitza Stark Phenotypes for gene: COL18A1 were changed from Knobloch syndrome, type 1, 267750 (3) to Knobloch syndrome, type 1 MIM#267750
Prepair 500+ v1.209 COL18A1 Zornitza Stark Publications for gene: COL18A1 were set to
Prepair 500+ v1.208 COL17A1 Zornitza Stark Marked gene: COL17A1 as ready
Prepair 500+ v1.208 COL17A1 Zornitza Stark Gene: col17a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.208 COL17A1 Zornitza Stark Phenotypes for gene: COL17A1 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (3) to Epidermolysis bullosa, junctional 4, intermediate, MIM# 619787
Prepair 500+ v1.207 COL17A1 Zornitza Stark Publications for gene: COL17A1 were set to
Prepair 500+ v1.206 COL11A2 Zornitza Stark Marked gene: COL11A2 as ready
Prepair 500+ v1.206 COL11A2 Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence).
Prepair 500+ v1.206 COL11A2 Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Deafness, autosomal recessive 53 MIM#609706; Fibrochondrogenesis 2 MIM#614524; Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150
Prepair 500+ v1.205 COL11A2 Zornitza Stark Publications for gene: COL11A2 were set to
Prepair 500+ v1.204 CNGB3 Zornitza Stark Marked gene: CNGB3 as ready
Prepair 500+ v1.204 CNGB3 Zornitza Stark Gene: cngb3 has been classified as Green List (High Evidence).
Prepair 500+ v1.204 CNGB3 Zornitza Stark Phenotypes for gene: CNGB3 were changed from Macular degeneration, juvenile, 248200 (3) to Achromatopsia 3 MIM#262300
Prepair 500+ v1.203 CNGB3 Zornitza Stark Publications for gene: CNGB3 were set to
Prepair 500+ v1.202 CLRN1 Zornitza Stark Marked gene: CLRN1 as ready
Prepair 500+ v1.202 CLRN1 Zornitza Stark Gene: clrn1 has been classified as Green List (High Evidence).
Prepair 500+ v1.202 CLRN1 Zornitza Stark Phenotypes for gene: CLRN1 were changed from Usher syndrome, type 3A, 276902 (3) to Usher syndrome, type 3A, MIM#276902
Prepair 500+ v1.201 CLRN1 Zornitza Stark Publications for gene: CLRN1 were set to
Prepair 500+ v1.200 CLPB Zornitza Stark Marked gene: CLPB as ready
Prepair 500+ v1.200 CLPB Zornitza Stark Gene: clpb has been classified as Green List (High Evidence).
Prepair 500+ v1.200 CLPB Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropenia, 616271 (3) to 3-methylglutaconic aciduria, type VIIB, autosomal recessive (MIM#616271)
Prepair 500+ v1.199 CLPB Zornitza Stark Publications for gene: CLPB were set to
Prepair 500+ v1.198 CLP1 Zornitza Stark Marked gene: CLP1 as ready
Prepair 500+ v1.198 CLP1 Zornitza Stark Gene: clp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.198 CLP1 Zornitza Stark Phenotypes for gene: CLP1 were changed from Pontocerebellar hypoplasia, type 10, 615803 (3) to Pontocerebellar hypoplasia, type 10 MIM#615803
Prepair 500+ v1.197 CLP1 Zornitza Stark Publications for gene: CLP1 were set to
Prepair 500+ v1.196 CLN8 Zornitza Stark Marked gene: CLN8 as ready
Prepair 500+ v1.196 CLN8 Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence).
Prepair 500+ v1.196 CLN8 Zornitza Stark Phenotypes for gene: CLN8 were changed from Ceroid lipofuscinosis, neuronal, 8, 600143 (3) to Ceroid lipofuscinosis, neuronal, 8, MIM# 600143
Prepair 500+ v1.195 CLN6 Zornitza Stark Marked gene: CLN6 as ready
Prepair 500+ v1.195 CLN6 Zornitza Stark Gene: cln6 has been classified as Green List (High Evidence).
Prepair 500+ v1.195 CLN6 Zornitza Stark Phenotypes for gene: CLN6 were changed from Ceroid lipofuscinosis, neuronal 6, 601780 (3) to Ceroid lipofuscinosis, neuronal 6, MIM#601780
Prepair 500+ v1.194 CLN6 Zornitza Stark Publications for gene: CLN6 were set to
Prepair 500+ v1.193 CLN5 Zornitza Stark Marked gene: CLN5 as ready
Prepair 500+ v1.193 CLN5 Zornitza Stark Gene: cln5 has been classified as Green List (High Evidence).
Prepair 500+ v1.193 CLN5 Zornitza Stark Phenotypes for gene: CLN5 were changed from Ceroid lipofuscinosis, neuronal, 5, 256731 (3) to Ceroid lipofuscinosis, neuronal, 5, MIM# 256731; MONDO:0009745
Prepair 500+ v1.192 CLCN7 Zornitza Stark Marked gene: CLCN7 as ready
Prepair 500+ v1.192 CLCN7 Zornitza Stark Gene: clcn7 has been classified as Green List (High Evidence).
Prepair 500+ v1.192 CLCN7 Zornitza Stark Phenotypes for gene: CLCN7 were changed from Osteopetrosis, autosomal recessive 4, 611490 (3) to Osteopetrosis, autosomal recessive 4, MIM#611490
Prepair 500+ v1.191 CLCN7 Zornitza Stark Publications for gene: CLCN7 were set to
Prepair 500+ v1.190 CLCN5 Zornitza Stark Marked gene: CLCN5 as ready
Prepair 500+ v1.190 CLCN5 Zornitza Stark Gene: clcn5 has been classified as Green List (High Evidence).
Prepair 500+ v1.190 CLCN5 Zornitza Stark Phenotypes for gene: CLCN5 were changed from Dent disease, 300009 (3) to Dent disease, MIM#300009
Prepair 500+ v1.189 CKAP2L Zornitza Stark Marked gene: CKAP2L as ready
Prepair 500+ v1.189 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Prepair 500+ v1.189 CKAP2L Zornitza Stark Phenotypes for gene: CKAP2L were changed from Filippi syndrome, 272440 (3) to Filippi syndrome MIM#272440
Prepair 500+ v1.188 CKAP2L Zornitza Stark Publications for gene: CKAP2L were set to
Prepair 500+ v1.187 CIITA Zornitza Stark Marked gene: CIITA as ready
Prepair 500+ v1.187 CIITA Zornitza Stark Gene: ciita has been classified as Green List (High Evidence).
Prepair 500+ v1.187 CIITA Zornitza Stark Phenotypes for gene: CIITA were changed from Bare lymphocyte syndrome, type II, complementation group A, 209920 (3) to MHC class II deficiency 1 MIM#209920
Prepair 500+ v1.186 CIITA Zornitza Stark Publications for gene: CIITA were set to
Prepair 500+ v1.185 CHRNG Zornitza Stark Marked gene: CHRNG as ready
Prepair 500+ v1.185 CHRNG Zornitza Stark Gene: chrng has been classified as Green List (High Evidence).
Prepair 500+ v1.185 CHRNG Zornitza Stark Phenotypes for gene: CHRNG were changed from Escobar syndrome, 265000 (3) to Escobar syndrome (MIM# 265000); Multiple pterygium syndrome, lethal type, (MIM# 253290)
Prepair 500+ v1.184 CHRNG Zornitza Stark Publications for gene: CHRNG were set to
Prepair 500+ v1.183 CHRNE Zornitza Stark Marked gene: CHRNE as ready
Prepair 500+ v1.183 CHRNE Zornitza Stark Gene: chrne has been classified as Green List (High Evidence).
Prepair 500+ v1.183 CHRNE Zornitza Stark Phenotypes for gene: CHRNE were changed from Myasthenic syndrome, congenital, 4A, slow-channel, 605809 (3) to Myasthenic syndrome, congenital, 4A, slow-channel MIM#605809; Myasthenic syndrome, congenital, 4B, fast-channel MIM#616324; Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency MIM#608931
Prepair 500+ v1.182 CHRNE Zornitza Stark Publications for gene: CHRNE were set to
Prepair 500+ v1.181 CHAT Zornitza Stark Marked gene: CHAT as ready
Prepair 500+ v1.181 CHAT Zornitza Stark Gene: chat has been classified as Green List (High Evidence).
Prepair 500+ v1.181 CHAT Zornitza Stark Phenotypes for gene: CHAT were changed from Myasthenic syndrome, congenital, 6, presynaptic, 254210 (3) to Myasthenic syndrome, congenital, 6, presynaptic MIM#254210
Prepair 500+ v1.180 CHAT Zornitza Stark Publications for gene: CHAT were set to
Prepair 500+ v1.179 CFTR Zornitza Stark Marked gene: CFTR as ready
Prepair 500+ v1.179 CFTR Zornitza Stark Gene: cftr has been classified as Green List (High Evidence).
Prepair 500+ v1.179 CFTR Zornitza Stark Phenotypes for gene: CFTR were changed from Cystic fibrosis, 219700 (3) to Cystic fibrosis, MIM#219700; MONDO:0009061
Prepair 500+ v1.178 CFTR Zornitza Stark Publications for gene: CFTR were set to
Prepair 500+ v1.177 CEP41 Zornitza Stark Marked gene: CEP41 as ready
Prepair 500+ v1.177 CEP41 Zornitza Stark Gene: cep41 has been classified as Green List (High Evidence).
Prepair 500+ v1.177 CEP41 Zornitza Stark Phenotypes for gene: CEP41 were changed from Joubert syndrome 15, 614464 (3) to Joubert syndrome 15, MIM# 614464
Prepair 500+ v1.176 CEP41 Zornitza Stark Publications for gene: CEP41 were set to
Prepair 500+ v1.175 CEP290 Zornitza Stark Marked gene: CEP290 as ready
Prepair 500+ v1.175 CEP290 Zornitza Stark Gene: cep290 has been classified as Green List (High Evidence).
Prepair 500+ v1.175 CEP290 Zornitza Stark Phenotypes for gene: CEP290 were changed from Joubert syndrome 5, 610188 (3) to CEP290-related ciliopathy MONDO:0100451; Bardet-Biedl syndrome 14, MIM# 615991; Joubert syndrome 5 610188; Leber congenital amaurosis 10, MIM# 611755; Meckel syndrome 4, MIM# 611134; Senior-Loken syndrome 6, MIM# 610189
Prepair 500+ v1.174 CEP290 Zornitza Stark Publications for gene: CEP290 were set to
Prepair 500+ v1.173 CEP152 Zornitza Stark Marked gene: CEP152 as ready
Prepair 500+ v1.173 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Prepair 500+ v1.173 CEP152 Zornitza Stark Phenotypes for gene: CEP152 were changed from Seckel syndrome 5, 613823 (3) to Microcephaly 9, primary, autosomal recessive, MIM# 614852; MONDO:0013923; Seckel syndrome 5, MIM# 613823; MONDO:0013443
Prepair 500+ v1.172 CEP152 Zornitza Stark Publications for gene: CEP152 were set to
Prepair 500+ v1.171 CENPJ Zornitza Stark Marked gene: CENPJ as ready
Prepair 500+ v1.171 CENPJ Zornitza Stark Gene: cenpj has been classified as Green List (High Evidence).
Prepair 500+ v1.171 CENPJ Zornitza Stark Phenotypes for gene: CENPJ were changed from Microcephaly 6, primary, autosomal recessive, 608393 (3) to Microcephaly 6, primary MIM#608393; Seckel syndrome 4 MIM#613676
Prepair 500+ v1.170 CENPJ Zornitza Stark Publications for gene: CENPJ were set to
Prepair 500+ v1.169 CDH23 Zornitza Stark Marked gene: CDH23 as ready
Prepair 500+ v1.169 CDH23 Zornitza Stark Gene: cdh23 has been classified as Green List (High Evidence).
Prepair 500+ v1.169 CDH23 Zornitza Stark Phenotypes for gene: CDH23 were changed from Usher syndrome, type 1D, 601067 (3) to Usher syndrome, type 1D (MIM#601067)
Prepair 500+ v1.168 CDH23 Zornitza Stark Publications for gene: CDH23 were set to
Prepair 500+ v1.167 CD40LG Zornitza Stark Marked gene: CD40LG as ready
Prepair 500+ v1.167 CD40LG Zornitza Stark Gene: cd40lg has been classified as Green List (High Evidence).
Prepair 500+ v1.167 CD40LG Zornitza Stark Phenotypes for gene: CD40LG were changed from Immunodeficiency, X-linked, with hyper-IgM, 308230 (3) to Immunodeficiency, X-linked, with hyper-IgM MIM# 308230
Prepair 500+ v1.166 CD40LG Zornitza Stark Publications for gene: CD40LG were set to
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Marked gene: IFT57 as ready
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Polydactyly v0.283 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Polydactyly v0.283 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Ciliopathies v1.68 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Ciliopathies v1.68 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Ciliopathies v1.67 IFT57 Krithika Murali Marked gene: IFT57 as ready
Ciliopathies v1.67 IFT57 Krithika Murali Gene: ift57 has been classified as Red List (Low Evidence).
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Marked gene: IFT57 as ready
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2519 IFT57 Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Mendeliome v1.2518 IFT57 Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Mendeliome v1.2517 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Mendeliome v1.2517 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Genetic Epilepsy v1.146 UGGT1 Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v1.146 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Genetic Epilepsy v1.146 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.305 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Microcephaly v1.305 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Microcephaly v1.304 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Microcephaly v1.304 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Mendeliome v1.2516 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Mendeliome v1.2516 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Mendeliome v1.2516 UGGT1 Krithika Murali Phenotypes for gene: UGGT1 were changed from to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Mendeliome v1.2515 UGGT1 Krithika Murali Publications for gene: UGGT1 were set to
Mendeliome v1.2514 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2513 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Mendeliome v1.2513 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Autism v0.207 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Autism v0.207 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.442 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Heart Defect v0.442 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.441 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Heart Defect v0.441 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.440 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Congenital Heart Defect v0.440 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Differences of Sex Development v1.11 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Differences of Sex Development v1.11 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Differences of Sex Development v1.10 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.10 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.10 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.9 UGGT1 Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Differences of Sex Development v1.9 UGGT1 Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Differences of Sex Development v1.9 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Differences of Sex Development. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Congenital Heart Defect v0.440 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Renal Macrocystic Disease v0.84 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Renal Macrocystic Disease. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to AMBER
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants and CDG/multisystem disorder with clinical features including GDD/ID,
microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).Supportive functional evidence also provided.

Of note, two individuals reported with cystic renal dysplasia and hepatobiliary anomalies that were similar in apperaance to ARPKD.
Sources: Literature
Autism v0.206 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Autism. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Microcephaly v1.304 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Congenital Disorders of Glycosylation v1.65 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Mendeliome v1.2512 UGGT1 Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2512 IFT57 Krithika Murali reviewed gene: IFT57: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:40273360; Phenotypes: Bardet-Bield syndrome, ciliopathy - MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ciliopathies v1.67 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Ciliopathies. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Learning difficulties
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Polydactyly v0.282 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Polydactyly. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Learning difficulties
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Cone-rod Dystrophy v0.55 IFT57 Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Learning difficulties
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Bardet Biedl syndrome v1.11 IFT57 Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Learning difficulties
- Obesity and type 2 diabetes

- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Cone-rod Dystrophy v0.55 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Cone-rod Dystrophy. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Bardet Biedl syndrome v1.11 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Bardet Biedl syndrome. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Familial hypercholesterolaemia v1.0 APOB Zornitza Stark Marked gene: APOB as ready
Familial hypercholesterolaemia v1.0 APOB Zornitza Stark Gene: apob has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.118 DLG3 Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850
Mendeliome v1.2512 DLG3 Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850
Prepair 500+ v1.165 CD40 Zornitza Stark Marked gene: CD40 as ready
Prepair 500+ v1.165 CD40 Zornitza Stark Gene: cd40 has been classified as Green List (High Evidence).
Prepair 500+ v1.165 CD40 Zornitza Stark Phenotypes for gene: CD40 were changed from Immunodeficiency with hyper-IgM, type 3, 606843 (3) to Immunodeficiency with hyper-IgM, type 3, MIM# 606843
Prepair 500+ v1.164 CD3D Zornitza Stark Marked gene: CD3D as ready
Prepair 500+ v1.164 CD3D Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence).
Prepair 500+ v1.164 CD3D Zornitza Stark Phenotypes for gene: CD3D were changed from Immunodeficiency 19, 615617 (3) to Immunodeficiency 19, severe combined MIM# 615617
Prepair 500+ v1.163 CCDC88C Zornitza Stark Marked gene: CCDC88C as ready
Prepair 500+ v1.163 CCDC88C Zornitza Stark Gene: ccdc88c has been classified as Green List (High Evidence).
Prepair 500+ v1.163 CCDC88C Zornitza Stark Phenotypes for gene: CCDC88C were changed from Hydrocephalus, nonsyndromic, autosomal recessive, 236600 (3) to Hydrocephalus, congenital, 1 MIM#236600
Prepair 500+ v1.162 CCDC88C Zornitza Stark Publications for gene: CCDC88C were set to
Prepair 500+ v1.161 CCDC39 Zornitza Stark Marked gene: CCDC39 as ready
Prepair 500+ v1.161 CCDC39 Zornitza Stark Gene: ccdc39 has been classified as Green List (High Evidence).
Prepair 500+ v1.161 CCDC39 Zornitza Stark Phenotypes for gene: CCDC39 were changed from Ciliary dyskinesia, primary, 14, 613807 (3) to Ciliary dyskinesia, primary, 14 MIM#613807
Prepair 500+ v1.160 CCDC39 Zornitza Stark Publications for gene: CCDC39 were set to
Prepair 500+ v1.159 CCDC103 Zornitza Stark Marked gene: CCDC103 as ready
Prepair 500+ v1.159 CCDC103 Zornitza Stark Gene: ccdc103 has been classified as Green List (High Evidence).
Prepair 500+ v1.159 CCDC103 Zornitza Stark Phenotypes for gene: CCDC103 were changed from Ciliary dyskinesia, primary, 17, 614679 (3) to Primary ciliary dyskinesia-17, MIM # 614679
Prepair 500+ v1.158 CCDC103 Zornitza Stark Publications for gene: CCDC103 were set to
Prepair 500+ v1.157 CCBE1 Zornitza Stark Marked gene: CCBE1 as ready
Prepair 500+ v1.157 CCBE1 Zornitza Stark Gene: ccbe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.157 CCBE1 Zornitza Stark Phenotypes for gene: CCBE1 were changed from Hennekam lymphangiectasia-lymphedema syndrome 1, 235510 (3) to Hennekam lymphangiectasia-lymphoedema syndrome 1 MIM#235510
Prepair 500+ v1.156 CCBE1 Zornitza Stark Publications for gene: CCBE1 were set to
Prepair 500+ v1.155 CC2D2A Zornitza Stark Marked gene: CC2D2A as ready
Prepair 500+ v1.155 CC2D2A Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence).
Prepair 500+ v1.155 CC2D2A Zornitza Stark Phenotypes for gene: CC2D2A were changed from Joubert syndrome 9, 612285 (3) to COACH syndrome, MIM#216360; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284; Retinitis pigmentosa 93, MIM# 619845
Prepair 500+ v1.154 CC2D2A Zornitza Stark Publications for gene: CC2D2A were set to
Prepair 500+ v1.153 CC2D1A Zornitza Stark Marked gene: CC2D1A as ready
Prepair 500+ v1.153 CC2D1A Zornitza Stark Gene: cc2d1a has been classified as Green List (High Evidence).
Prepair 500+ v1.153 CC2D1A Zornitza Stark Phenotypes for gene: CC2D1A were changed from Mental retardation, autosomal recessive 3, 608443 (3) to Intellectual developmental disorder, autosomal recessive 3, MIM# 608443
Prepair 500+ v1.152 CC2D1A Zornitza Stark Publications for gene: CC2D1A were set to
Prepair 500+ v1.151 CASQ2 Zornitza Stark Marked gene: CASQ2 as ready
Prepair 500+ v1.151 CASQ2 Zornitza Stark Gene: casq2 has been classified as Green List (High Evidence).
Prepair 500+ v1.151 CASQ2 Zornitza Stark Phenotypes for gene: CASQ2 were changed from Ventricular tachycardia, catecholaminergic polymorphic, 2, 611938 (3) to Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938)
Prepair 500+ v1.150 CASK Zornitza Stark Marked gene: CASK as ready
Prepair 500+ v1.150 CASK Zornitza Stark Gene: cask has been classified as Green List (High Evidence).
Prepair 500+ v1.150 CASK Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119
Prepair 500+ v1.149 CASK Zornitza Stark Publications for gene: CASK were set to
Prepair 500+ v1.148 GNE Zornitza Stark Marked gene: GNE as ready
Prepair 500+ v1.148 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.148 GNE Zornitza Stark Phenotypes for gene: GNE were changed from Inclusion body myopathy, autosomal recessive, 600737 (3) to Nonaka myopathy MIM#605820; Thrombocytopenia 12 with or without myopathy MIM#620757
Prepair 500+ v1.147 GNE Zornitza Stark Publications for gene: GNE were set to
Prepair 500+ v1.146 GNE Zornitza Stark Classified gene: GNE as Red List (low evidence)
Prepair 500+ v1.146 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Prepair 500+ v1.145 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Phenotypes for gene: CLN3 were changed from Ceroid lipofuscinosis, neuronal, 3, 204200 (3) to Ceroid lipofuscinosis, neuronal, 3, MIM# 204200; MONDO:0008767
Prepair 500+ v1.144 CLN3 Zornitza Stark Publications for gene: CLN3 were set to
Prepair 500+ v1.143 CLN3 Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence)
Prepair 500+ v1.143 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v2.7 GPR143 Zornitza Stark Tag for review tag was added to gene: GPR143.
Mendeliome v1.2511 NUDT2 Sangavi Sivagnanasundram reviewed gene: NUDT2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder with or without peripheral neuropathy, MONDO:0859240; Mode of inheritance: None
Mendeliome v1.2511 NLRP2 Sangavi Sivagnanasundram reviewed gene: NLRP2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte/zygote/embryo maturation arrest 18, MONDO:0957230; Mode of inheritance: None
Mendeliome v1.2511 NKAP Sangavi Sivagnanasundram reviewed gene: NKAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2511 NDUFAF8 Sangavi Sivagnanasundram reviewed gene: NDUFAF8: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Leigh Syndrome MONDO:0009723; Mode of inheritance: None
Mendeliome v1.2511 NDUFAF7 Sangavi Sivagnanasundram reviewed gene: NDUFAF7: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Pathological Myopia MONDO:0001383; Mode of inheritance: None
Repeat Disorders v0.256 THAP11_SCA51_CAG Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Marked STR: RAPGEF2_FAME7_TTTCA as ready
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Classified STR: RAPGEF2_FAME7_TTTCA as Amber List (moderate evidence)
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.144 RAPGEF2_FAME7_TTTCA Bryony Thompson STR: RAPGEF2_FAME7_TTTCA was added
STR: RAPGEF2_FAME7_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: RAPGEF2_FAME7_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: RAPGEF2_FAME7_TTTCA were set to 29507423; 30351492; 33791773
Phenotypes for STR: RAPGEF2_FAME7_TTTCA were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: RAPGEF2_FAME7_TTTCA was set to AMBER
Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported.
The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.117 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Mendeliome v1.2511 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Hereditary Neuropathy - complex v1.27 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Mendeliome v1.2510 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.63 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Skeletal dysplasia v0.308 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Skeletal dysplasia. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Corneal Dystrophy v1.12 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Marked STR: TBP_SCA17_CAG as ready
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.34 TBP_SCA17_CAG Bryony Thompson STR: TBP_SCA17_CAG was added
STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409
Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: TBP_SCA17_CAG was set to GREEN
STR: TBP_SCA17_CAG was marked as clinically relevant
STR: TBP_SCA17_CAG was marked as current diagnostic
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Regression v0.577 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Mendeliome v1.2509 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Early-onset Dementia v1.39 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Dystonia - isolated/combined v1.40 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Early-onset Parkinson disease v2.33 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Genetic Epilepsy v1.143 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Mendeliome v1.2508 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Classified STR: SAMD12_FAME1_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Str: samd12_fame1_tttca has been classified as Green List (High Evidence).
Mendeliome v1.2507 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Genetic Epilepsy v1.141 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Mendeliome v1.2506 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.58 RILPL1_OPDM4_CGG Bryony Thompson OPDM4_RILPL1_CGG was changed to RILPL1_OPDM4_CGG
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.31 ATXN8OS_SCA8_CTG Bryony Thompson STR: ATXN8OS_SCA8_CTG was added
STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387
Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: ATXN8OS_SCA8_CTG was set to GREEN
STR: ATXN8OS_SCA8_CTG was marked as clinically relevant
STR: ATXN8OS_SCA8_CTG was marked as current diagnostic
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Literature
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.29 PPP2R2B_SCA12_CAG Bryony Thompson STR: PPP2R2B_SCA12_CAG was added
STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021
Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: PPP2R2B_SCA12_CAG was set to GREEN
STR: PPP2R2B_SCA12_CAG was marked as clinically relevant
STR: PPP2R2B_SCA12_CAG was marked as current diagnostic
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Literature
Mendeliome v1.2505 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Mendeliome v1.2504 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV_PLIN4 was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.57 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Classified STR: PABPN1_OPMD_GCN as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.55 PABPN1_OPMD_GCN Bryony Thompson STR: PABPN1_OPMD_GCN was added
STR: PABPN1_OPMD_GCN was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: PABPN1_OPMD_GCN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for STR: PABPN1_OPMD_GCN were set to 9462747; 20301305
Phenotypes for STR: PABPN1_OPMD_GCN were set to Oculopharyngeal muscular dystrophy MIM#164300
Review for STR: PABPN1_OPMD_GCN was set to GREEN
STR: PABPN1_OPMD_GCN was marked as clinically relevant
STR: PABPN1_OPMD_GCN was marked as current diagnostic
Added comment: NM_004643.3:c.4_6[X]
Expected gain of function mechanism of disease
Normal allele: (GCN)10 / Ala10
Autosomal recessive: (GCN)11/Ala11
Autosomal dominant: (GCN)12-17
Sources: Expert list
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Marked STR: NUTM2B-AS1_OPDM_CCG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPDM_CCG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.53 NUTM2B-AS1_OPDM_CCG Bryony Thompson STR: NUTM2B-AS1_OPDM_CCG was added
STR: NUTM2B-AS1_OPDM_CCG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Literature
Mode of inheritance for STR: NUTM2B-AS1_OPDM_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NUTM2B-AS1_OPDM_CCG were set to 31332380; 37923380; 39308795; 38159879
Phenotypes for STR: NUTM2B-AS1_OPDM_CCG were set to Oculopharyngodistal myopathy MONDO:0025193
Review for STR: NUTM2B-AS1_OPDM_CCG was set to GREEN
STR: NUTM2B-AS1_OPDM_CCG was marked as clinically relevant
Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.
NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence).
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Early-onset Parkinson disease v2.28 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Mendeliome v1.2503 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Regression v0.576 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Leukodystrophy - adult onset v0.147 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Hereditary Neuropathy - complex v1.26 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.52 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Regression v0.575 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Mendeliome v1.2502 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Marked STR: MARCH6_FAME3_TTTCA as ready
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Classified STR: MARCH6_FAME3_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.139 MARCH6_FAME3_TTTCA Bryony Thompson STR: MARCH6_FAME3_TTTCA was added
STR: MARCH6_FAME3_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: MARCH6_FAME3_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MARCH6_FAME3_TTTCA were set to 31664039
Phenotypes for STR: MARCH6_FAME3_TTTCA were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: MARCH6_FAME3_TTTCA was set to GREEN
STR: MARCH6_FAME3_TTTCA was marked as clinically relevant
STR: MARCH6_FAME3_TTTCA was marked as current diagnostic
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.51 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Motor Neurone Disease v1.33 LRP12_ALS_CGG Bryony Thompson LRP12-ALS_CGG was changed to LRP12_ALS_CGG
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson STR: JPH3_HDL2_CTG was added
STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701
Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438
Review for STR: JPH3_HDL2_CTG was set to GREEN
STR: JPH3_HDL2_CTG was marked as clinically relevant
STR: JPH3_HDL2_CTG was marked as current diagnostic
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature
Early-onset Dementia v1.37 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Mendeliome v1.2501 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Early-onset Parkinson disease v2.25 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Incidentalome v0.316 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.137 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.134 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Miscellaneous Metabolic Disorders v1.49 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Mendeliome v1.2500 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.50 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Hereditary Neuropathy - complex v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.24 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Mitochondrial disease v0.972 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Ataxia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Ataxia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Ataxia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Ataxia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Hereditary Neuropathy - complex v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.2 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.346 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Marked STR: FMR1_FXS_CGG as ready
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.24 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Marked STR: FMR1_FXPOI_CGG as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.48 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Clefting disorders v0.263 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Mandibulofacial Acrofacial dysostosis v1.13 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Prepair 500+ v1.142 CAPN3 Zornitza Stark Marked gene: CAPN3 as ready
Prepair 500+ v1.142 CAPN3 Zornitza Stark Gene: capn3 has been classified as Green List (High Evidence).
Prepair 500+ v1.142 CAPN3 Zornitza Stark Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600
Prepair 500+ v1.141 CAPN3 Zornitza Stark Publications for gene: CAPN3 were set to
Prepair 500+ v1.140 CANT1 Zornitza Stark Marked gene: CANT1 as ready
Prepair 500+ v1.140 CANT1 Zornitza Stark Gene: cant1 has been classified as Green List (High Evidence).
Prepair 500+ v1.140 CANT1 Zornitza Stark Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719
Prepair 500+ v1.139 CANT1 Zornitza Stark Publications for gene: CANT1 were set to
Prepair 500+ v1.138 C5orf42 Zornitza Stark Marked gene: C5orf42 as ready
Prepair 500+ v1.138 C5orf42 Zornitza Stark Gene: c5orf42 has been classified as Green List (High Evidence).
Prepair 500+ v1.138 C5orf42 Zornitza Stark Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170
Prepair 500+ v1.137 C5orf42 Zornitza Stark Publications for gene: C5orf42 were set to
Infertility and Recurrent Pregnancy Loss v0.77 MEIOB Jasmine Chew gene: MEIOB was added
gene: MEIOB was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MEIOB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MEIOB were set to 28206990; 34392356; 35991565; 37715646; 31000419; 39545410; 30838384
Phenotypes for gene: MEIOB were set to Premature ovarian failure 23, MIM# 620686; Spermatogenic failure 22, MIM# 617706
Review for gene: MEIOB was set to GREEN
Added comment: Literature in OMIM- PMID: 28206990; 34392356; 35991565; 37715646; 31000419- multiple unrelated infertile males due to spermatogenic failure and females due to premature ovarian failure carrying biallelic variants, supported by functional evidence.

New papers:
i) PMID: 39545410- previously reported homozygous nonsense p.(Arg272*) in proband 2136 (Egyptian), with a history of 6 early miscarriages, 3 failed intracytoplasmic sperm injection cycles, 1 HM, and low anti-Müllerian hormone (AMH) (2 times ≤0.2 ng/mL).

ii) PMID: 30838384- A novel homozygous frameshift variant in two brothers of Arab ethnicity. This frame-shift is predicted to result in a truncated MEIOB protein, which lacks the conserved C-terminal DNA binding domain.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 SYCP2 Jasmine Chew changed review comment from: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for Hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature; to: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 SYCP2 Jasmine Chew gene: SYCP2 was added
gene: SYCP2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: SYCP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYCP2 were set to 31866047; 39202451; 38511217; 37337432; 39545410
Phenotypes for gene: SYCP2 were set to Spermatogenic failure 1, MIM# 258150; Hydatidiform mole
Review for gene: SYCP2 was set to GREEN
Added comment: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for Hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410- Compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew gene: CCDC155 was added
gene: CCDC155 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CCDC155 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC155 were set to 29790874; 35674372; 36864840; 35708642; 39545410
Phenotypes for gene: CCDC155 were set to Premature ovarian failure 22, MIM# 620548; Spermatogenic failure 88, MIM# 620547
Review for gene: CCDC155 was set to GREEN
Added comment: Note- HGNC Approved Gene Symbol: KASH5

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 C11orf80 Jasmine Chew edited their review of gene: C11orf80: Changed publications: 30388401, 36732965
Infertility and Recurrent Pregnancy Loss v0.77 MAJIN Jasmine Chew gene: MAJIN was added
gene: MAJIN was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MAJIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAJIN were set to 39545410; 33211200
Phenotypes for gene: MAJIN were set to Recurrent hydatidiform mole, non-obstructive azoospermia
Review for gene: MAJIN was set to AMBER
Added comment: New papers (biallelic variant for HM/male infertility):
i) PMID: 39545410- Novel homozygous splice donor site variant c.349+1G>T in patient 1824 (Italian) with 2 HMs followed by secondary infertility and substantially reduced bilateral ovarian volumes. MAJIN codes for a junction protein that forms a complex with TERB1 and TERB2, which together bind to telomeres and anchor them to the inner nuclear membrane components KASH5 and SUN1. This attachment of chromosomes to the nuclear envelope is essential for homologous chromosome movement and synapsis. In mice, both male and female null mutants Majin are infertile (PMID: 26548954). In humans, biallelic mutations in MAJIN have been reported in infertile males.

ii) PMID: 33211200- A homozygous p.Arg53His in NOA-affected male (Individual 4- M1646) with high CADD scores and low gnomad freq. Mice disrupted for either Majin or Terb2 display impaired synapsis, zygotene arrest, a lack of postmeiotic cells and infertility (Shibuya et al. 2015; Zhang et al. 2017).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 C11orf80 Jasmine Chew gene: C11orf80 was added
gene: C11orf80 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: C11orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C11orf80 were set to Recurrent hydatidiform mole 4, MIM # 618432
Review for gene: C11orf80 was set to AMBER
Added comment: Note: HGNC Approved Gene Symbol- TOP6BL

Literature in OMIM- PubMed: 30388401- Two unrelated females with RHMs carrying a homozygous p.Glu262∗ and p.Ser501Pro, respectively.

New paper (biallelic variants for OZEMA/NOA)
i) PMID: 36732965- A homozygous LOF p.E162* in four infertile siblings born to a consanguineous marriage, with three brothers suffering from non-obstructive azoospermia and one sister suffering from unexplained infertility. Mouse models carrying similar mutations to that in patients recapitulated the spermatogenic abnormalities of the patient.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 DNAAF4 Jasmine Chew gene: DNAAF4 was added
gene: DNAAF4 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: DNAAF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAAF4 were set to 23872636; 37674365; 37147940; 36583018; 35903363
Phenotypes for gene: DNAAF4 were set to Primary ciliary dyskinesia 25, MIM# 615482
Review for gene: DNAAF4 was set to GREEN
Added comment: Literature in OMIM- PMID: 23872636- biallelic variants reported for PCD, and reduced fertility was observed.

New papers (biallelic variants reported for PCD/ infertility):
i) PMID: 37674365- A novel homozygous splice acceptor site variant in DNAAF4 in two brother with asthenozoospermia. Functional assay revealed the absence of any exon 7-containing DNAAF4 transcripts in the sperm from P1, unlike in a normal control sample, consistent with the dysfunction or loss of DNAAF4 protein expression that may explain the abnormal sperm phenotypes in this patient.

ii) PMID: 37147940- Novel compound heterozygous splice site c.784-1G>A and 20.1 Kb deletion in a male with PCD and asthenoteratozoospermia, resulting in a truncated and functionless DNAAF4 protein. mmunofluorescence analysis indicated that the inner dynein arm was not present in the sperm flagellum, and sperm morphological analysis revealed small sperm with twisted and curved flagella or lacking flagella.

iii) PMID: 36583018- A novel homozygous p. G373E variant in a female patient with PCD who was born in a consanguineous family. Functional assays showed that the variant lead to PCD by reducing the stability of DNAAF4 protein.

iv) PMID: 35903363- Two homozygous variants, Arg330Trp and p.Arg245*, identified in two unrelated male and female with PCD. The affected male had asthenoteratozoospermia while female with primary infertility.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 TBPL2 Jasmine Chew gene: TBPL2 was added
gene: TBPL2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TBPL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBPL2 were set to 37804378; 33966269; 33893736; 33541821
Phenotypes for gene: TBPL2 were set to Oocyte maturation arrest
Review for gene: TBPL2 was set to GREEN
Added comment: New papers reporting biallelic variants in infertile women:
i) PMID: 37804378- Compound heterozygous novel p.Arg268Ter and recurrent p.Arg233Ter in a female with impaired ovarian folliculogenesis. Structure prediction by molecular modeling demonstrated that three-dimensional structure of TBPL2 was destabilized in mutant proteins.

ii) PMID: 33966269- Homozygous missense mutation p.C299R in two infertile sisters with oocyte maturation arrest and degeneration from a consanguineous family. Functional assays showed that the transcriptional level of ZP3 was not completely blocked but severely reduced by the regulation of the mutant TBPL2, while the transcriptional level of H2Bc was significantly reduced but to a less severe extent compared with that of ZP3, suggesting that the missense had a damage to the transcription initiation function of TBPL2 and its downstream targeted genes got involved in different degrees. The mutant protein also has less stability, which contributes to the lower activity of transcription initiation in the mutant form.

iii) PMID: 33893736- Homozygous splicing variant (c.788 + 3A>G) in two unrelated families characterized by oocyte maturation defects. Functional assays showed that the variant disrupted the integrity of TBPL2 mRNA and affected oocytes showed that vital genes for oocyte maturation and fertilization were widely and markedly downregulated, suggesting that a mutation in TBPL2, led to global gene alterations in oocytes; the same variant reported before in PMID: 33541821 in three affected females with diminished ovarian reserve from 3 independent families.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew changed review comment from: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others- PMID: 32741963, PMID: 36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature; to: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others: PMID: 32741963;36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew edited their review of gene: MEI1: Changed publications: 30388401, 38416203, 34037756, 36759719, 32741963, 36017582
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew gene: MEI1 was added
gene: MEI1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MEI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MEI1 were set to 30388401
Phenotypes for gene: MEI1 were set to Recurrent hydatidiform mole 3, MIM# 618431; Non-obstructive azoospermia
Review for gene: MEI1 was set to GREEN
Added comment: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others- PMID: 32741963, PMID: 36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 FOXL2 Jasmine Chew gene: FOXL2 was added
gene: FOXL2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FOXL2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: FOXL2 were set to 12149404; 19429596; 38558253; 36793102; 39545410
Phenotypes for gene: FOXL2 were set to Premature ovarian failure 3, #MIM 608996
Added comment: Literature in OMIM- PubMed: 12149404; 19429596- multiple patients with isolated POF carrying monoallelic variants

New papers (monoallelic variants for POI):
i) PMID: 38558253- One in-frame deletion and 13 missense variants, including two recurrent ones (p.(Pro212Ala) and p.(Arg349Gly) in 14 patients with POI/DOR. Two variants, (p.(Gly187Asp) and p.(Arg349Gly) have been previously identified in patients with non-syndromic POI (PMID: 19429596 and PMID: 36793102).

ii) PMID: 36793102- Sixteen POI patients carrying four different heterozygous variants, including the recurrent p.(Arg349Gly). Functional assay on the recurrent variant showed that the mutant FOXL2 did not present with the transcriptional repressive effect on CYP17A1 expression as shown by wild-type protein.

New paper (biallelic variants for HM):
i) PMID: 39545410- A novel homozygous missense p.(Phe167Ser) in patient 1690 (South Asian) with 5 CHMs, 3 miscarriages, 1 stillbirth, and 1 live birth. FOXL2 is essential for granulosa cell differentiation and proliferation, as well as ovarian maintenance and function.Therefore, its impairment may affect indirectly the meiotic maturation of oocytes, and may consequently lead to molar pregnancies.
Sources: Literature
Mendeliome v1.2499 KEL Achchuthan Shanmugasundram reviewed gene: KEL: Rating: AMBER; Mode of pathogenicity: None; Publications: 30578106, 37978175; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v1.2499 NOS3 Achchuthan Shanmugasundram reviewed gene: NOS3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36941667, 37383439; Phenotypes: Moyamoya disease, MONDO:0016820; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Marked gene: NLRP7 as ready
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Classified gene: NLRP7 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Marked gene: MOS as ready
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Gene: mos has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Classified gene: MOS as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Gene: mos has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Marked gene: MUSK as ready
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Added comment: Comment when marking as ready: Severe fetal anomalies can lead to pregnancy loss; however, this is more in scope for the Fetal Anomalies panel.
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Classified gene: MUSK as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Marked gene: DNAH11 as ready
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Classified gene: DNAH11 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Marked gene: LHCGR as ready
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Classified gene: LHCGR as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Added comment: Comment when marking as ready: Severe fetal abnormalities can cause pregnancy loss. However, this is more in scope for Fetal anomalies panel.
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Classified gene: FRAS1 as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Added comment: Comment when marking as ready: Mechanism of pregnancy loss unclear, could be chance observation.
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Classified gene: GBE1 as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.136 BTK Zornitza Stark Marked gene: BTK as ready
Prepair 500+ v1.136 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Prepair 500+ v1.136 BTK Zornitza Stark Phenotypes for gene: BTK were changed from Agammaglobulinemia and isolated hormone deficiency, 307200 (3) to Agammaglobulinemia, X-linked 1 MIM#300755; Bruton-type agammaglobulinemia MONDO:0010421; Isolated growth hormone deficiency, type III, with agammaglobulinemia MIM#307200 MONDO:0010615
Prepair 500+ v1.135 BTK Zornitza Stark Publications for gene: BTK were set to
Prepair 500+ v1.134 BSND Zornitza Stark Marked gene: BSND as ready
Prepair 500+ v1.134 BSND Zornitza Stark Gene: bsnd has been classified as Green List (High Evidence).
Prepair 500+ v1.134 BSND Zornitza Stark Phenotypes for gene: BSND were changed from Bartter syndrome, type 4a, 602522 (3) to Bartter syndrome, type 4a MIM#602522
Prepair 500+ v1.133 BSND Zornitza Stark Publications for gene: BSND were set to
Prepair 500+ v1.132 BRWD3 Zornitza Stark Marked gene: BRWD3 as ready
Prepair 500+ v1.132 BRWD3 Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence).
Prepair 500+ v1.132 BRWD3 Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659
Prepair 500+ v1.131 BRWD3 Zornitza Stark Publications for gene: BRWD3 were set to
Prepair 500+ v1.130 BRAT1 Zornitza Stark Marked gene: BRAT1 as ready
Prepair 500+ v1.130 BRAT1 Zornitza Stark Gene: brat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.130 BRAT1 Zornitza Stark Phenotypes for gene: BRAT1 were changed from Rigidity and multifocal seizure syndrome, lethal neonatal, 614498 (3) to Rigidity and multifocal seizure syndrome, lethal neonatal, MIM#614498; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056
Prepair 500+ v1.129 BRAT1 Zornitza Stark Publications for gene: BRAT1 were set to
Prepair 500+ v1.128 BLM Zornitza Stark Marked gene: BLM as ready
Prepair 500+ v1.128 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Prepair 500+ v1.128 BLM Zornitza Stark Phenotypes for gene: BLM were changed from Bloom syndrome, 210900 (3) to Bloom Syndrome MIM# 210900
Prepair 500+ v1.127 BLM Zornitza Stark Publications for gene: BLM were set to
Prepair 500+ v1.126 BCS1L Zornitza Stark Marked gene: BCS1L as ready
Prepair 500+ v1.126 BCS1L Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence).
Prepair 500+ v1.126 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, 603358 (3) to GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type 1, MIM#124000
Prepair 500+ v1.125 BCS1L Zornitza Stark Publications for gene: BCS1L were set to
Prepair 500+ v1.124 BCKDHB Zornitza Stark Marked gene: BCKDHB as ready
Prepair 500+ v1.124 BCKDHB Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence).
Prepair 500+ v1.124 BCKDHB Zornitza Stark Phenotypes for gene: BCKDHB were changed from Maple syrup urine disease, type Ib, 248600 (3) to Maple syrup urine disease, type Ib 620698
Prepair 500+ v1.123 BCKDHB Zornitza Stark Publications for gene: BCKDHB were set to
Prepair 500+ v1.122 BCKDHA Zornitza Stark Marked gene: BCKDHA as ready
Prepair 500+ v1.122 BCKDHA Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence).
Prepair 500+ v1.122 BCKDHA Zornitza Stark Phenotypes for gene: BCKDHA were changed from Maple syrup urine disease, type Ia, 248600 (3) to Maple syrup urine disease, type Ia, MIM# 248600
Prepair 500+ v1.121 BCKDHA Zornitza Stark Publications for gene: BCKDHA were set to
Prepair 500+ v1.120 BBS9 Zornitza Stark Marked gene: BBS9 as ready
Prepair 500+ v1.120 BBS9 Zornitza Stark Gene: bbs9 has been classified as Green List (High Evidence).
Prepair 500+ v1.120 BBS9 Zornitza Stark Phenotypes for gene: BBS9 were changed from Bardet-Biedl syndrome 9, 615986 (3) to Bardet-Biedl syndrome 9 MIM#615986
Prepair 500+ v1.119 BBS9 Zornitza Stark Publications for gene: BBS9 were set to
Prepair 500+ v1.118 BBS7 Zornitza Stark Marked gene: BBS7 as ready
Prepair 500+ v1.118 BBS7 Zornitza Stark Gene: bbs7 has been classified as Green List (High Evidence).
Prepair 500+ v1.118 BBS7 Zornitza Stark Phenotypes for gene: BBS7 were changed from Bardet-Biedl syndrome 7, 615984 (3) to Bardet-Biedl syndrome 7, MIM# 615984; MONDO:0014435
Prepair 500+ v1.117 BBS7 Zornitza Stark Publications for gene: BBS7 were set to
Prepair 500+ v1.116 BBS5 Zornitza Stark Marked gene: BBS5 as ready
Prepair 500+ v1.116 BBS5 Zornitza Stark Gene: bbs5 has been classified as Green List (High Evidence).
Prepair 500+ v1.116 BBS5 Zornitza Stark Phenotypes for gene: BBS5 were changed from Bardet-Biedl syndrome 5, 615983 (3) to Bardet-Biedl syndrome 5, MIM#615983; MONDO:0014434
Prepair 500+ v1.115 BBS5 Zornitza Stark Publications for gene: BBS5 were set to
Prepair 500+ v1.114 BBS4 Zornitza Stark Marked gene: BBS4 as ready
Prepair 500+ v1.114 BBS4 Zornitza Stark Gene: bbs4 has been classified as Green List (High Evidence).
Prepair 500+ v1.114 BBS4 Zornitza Stark Phenotypes for gene: BBS4 were changed from Bardet-Biedl syndrome 4, 615982 (3) to Bardet-Biedl syndrome 4, MIM#615982
Prepair 500+ v1.113 BBS2 Zornitza Stark Marked gene: BBS2 as ready
Prepair 500+ v1.113 BBS2 Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.113 BBS2 Zornitza Stark Phenotypes for gene: BBS2 were changed from Bardet-Biedl syndrome 2, 615981 (3) to Bardet-Biedl syndrome 2, MIM#615981
Prepair 500+ v1.112 BBS12 Zornitza Stark Marked gene: BBS12 as ready
Prepair 500+ v1.112 BBS12 Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence).
Prepair 500+ v1.112 BBS12 Zornitza Stark Phenotypes for gene: BBS12 were changed from Bardet-Biedl syndrome 12, 615989 (3) to Bardet-Biedl syndrome 12, MIM#615989
Prepair 500+ v1.111 BBS10 Zornitza Stark Marked gene: BBS10 as ready
Prepair 500+ v1.111 BBS10 Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence).
Prepair 500+ v1.111 BBS10 Zornitza Stark Phenotypes for gene: BBS10 were changed from Bardet-Biedl syndrome 10, 615987 (3) to Bardet-Biedl syndrome 10 (MIM#615987)
Prepair 500+ v1.110 BBS10 Zornitza Stark Publications for gene: BBS10 were set to
Prepair 500+ v1.109 BBS1 Zornitza Stark Marked gene: BBS1 as ready
Prepair 500+ v1.109 BBS1 Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.109 BBS1 Zornitza Stark Phenotypes for gene: BBS1 were changed from Bardet-Biedl syndrome 1, 209900 (3) to Bardet-Biedl syndrome 1, MIM# 209900
Prepair 500+ v1.108 BBS1 Zornitza Stark Publications for gene: BBS1 were set to
Prepair 500+ v1.107 B3GLCT Zornitza Stark Marked gene: B3GLCT as ready
Prepair 500+ v1.107 B3GLCT Zornitza Stark Gene: b3glct has been classified as Green List (High Evidence).
Prepair 500+ v1.107 B3GLCT Zornitza Stark Phenotypes for gene: B3GLCT were changed from Peters-plus syndrome, 261540 (3) to Peters-plus syndrome (MIM#261540)
Prepair 500+ v1.106 B3GLCT Zornitza Stark Publications for gene: B3GLCT were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.49 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Intellectual disability syndromic and non-syndromic v1.108 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2499 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2498 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence).
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.20 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Progressive Myoclonic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Genetic Epilepsy v1.135 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Marked STR: CNBP_DM2_CCTG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Classified STR: CNBP_DM2_CCTG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.47 CNBP_DM2_CCTG Bryony Thompson STR: CNBP_DM2_CCTG was added
STR: CNBP_DM2_CCTG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: CNBP_DM2_CCTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CNBP_DM2_CCTG were set to 20301639; 11486088
Phenotypes for STR: CNBP_DM2_CCTG were set to Myotonic dystrophy 2 MIM#602668
Review for STR: CNBP_DM2_CCTG was set to GREEN
STR: CNBP_DM2_CCTG was marked as clinically relevant
STR: CNBP_DM2_CCTG was marked as current diagnostic
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Mendeliome v1.2497 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Marked STR: C9orf72_FTDALS_GGGGCC as ready
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson Str: c9orf72_ftdals_ggggcc has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.146 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Dystonia - complex v0.280 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Incidentalome v0.315 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Parkinson disease v2.23 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Motor Neurone Disease v1.32 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Dementia v1.36 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Mendeliome v1.2496 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Mendeliome v1.2495 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Syndromic Retinopathy v0.223 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.21 ATXN3_SCA3_CAG Bryony Thompson STR: ATXN3_SCA3_CAG was added
STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606
Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: ATXN3_SCA3_CAG was set to GREEN
STR: ATXN3_SCA3_CAG was marked as clinically relevant
STR: ATXN3_SCA3_CAG was marked as current diagnostic
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Literature
Mendeliome v1.2494 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.19 ATXN2_SCA2_CAG Bryony Thompson STR: ATXN2_SCA2_CAG was added
STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452
Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: ATXN2_SCA2_CAG was set to GREEN
STR: ATXN2_SCA2_CAG was marked as clinically relevant
STR: ATXN2_SCA2_CAG was marked as current diagnostic
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Literature
Motor Neurone Disease v1.31 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Mendeliome v1.2493 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Mendeliome v1.2492 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Early-onset Parkinson disease v2.18 ATXN1_SCA1_CAG Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG
Mendeliome v1.2491 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Callosome v0.541 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Classified gene: ATXN10 as Red List (low evidence)
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Added comment: Comment on list classification: Only a single family reported
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence).
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Classified STR: ATN1_DRPLA_CAG as Green List (high evidence)
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.133 ATN1_DRPLA_CAG Bryony Thompson STR: ATN1_DRPLA_CAG was added
STR: ATN1_DRPLA_CAG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ATN1_DRPLA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATN1_DRPLA_CAG were set to 8136840; 8136826; 29325606; 20301664
Phenotypes for STR: ATN1_DRPLA_CAG were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: ATN1_DRPLA_CAG was set to GREEN
STR: ATN1_DRPLA_CAG was marked as clinically relevant
STR: ATN1_DRPLA_CAG was marked as current diagnostic
Added comment: NM_001007026​.1:c.1462_1464CAG[X]
Toxic gain of function mechanism of disease
Benign: ≤35 repeats
Mutable normal: 20-35 repeats
Pathogenic: ≥48 repeats
Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Early-onset Dementia v1.35 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Dystonia - complex v0.279 NACC1 Bryony Thompson Marked gene: NACC1 as ready
Dystonia - complex v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia - complex v0.279 NACC1 Bryony Thompson Classified gene: NACC1 as Green List (high evidence)
Dystonia - complex v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia - complex v0.278 NAA15 Bryony Thompson Marked gene: NAA15 as ready
Dystonia - complex v0.278 NAA15 Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence).
Dystonia - complex v0.278 NAA15 Bryony Thompson Classified gene: NAA15 as Green List (high evidence)
Dystonia - complex v0.278 NAA15 Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence).
Dystonia - complex v0.277 PAH Bryony Thompson Marked gene: PAH as ready
Dystonia - complex v0.277 PAH Bryony Thompson Gene: pah has been classified as Green List (High Evidence).
Dystonia - complex v0.277 PAH Bryony Thompson Classified gene: PAH as Green List (high evidence)
Dystonia - complex v0.277 PAH Bryony Thompson Gene: pah has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.107 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Genetic Epilepsy v1.132 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence)
Dystonia - complex v0.276 ARX_EIEE1_GCN2 Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.106 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Genetic Epilepsy v1.131 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Dystonia - complex v0.275 ARX_EIEE1_GCN2 Bryony Thompson STR: ARX_EIEE1_GCN2 was added
STR: ARX_EIEE1_GCN2 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN2 was set to GREEN
STR: ARX_EIEE1_GCN2 was marked as clinically relevant
STR: ARX_EIEE1_GCN2 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.429GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 2 of 2 polyAla tracts associated with disease
Normal repeat number: 12
Pathogenic repeat number: 20
Sources: Expert list
Genetic Epilepsy v1.130 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Genetic Epilepsy v1.130 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.105 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.129 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Genetic Epilepsy v1.129 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Red List (Low Evidence).
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)
Dystonia - complex v0.274 ARX_EIEE1_GCN1 Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.104 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Genetic Epilepsy v1.128 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert list
Dystonia - complex v0.273 ARX_EIEE1_GCN1 Bryony Thompson STR: ARX_EIEE1_GCN1 was added
STR: ARX_EIEE1_GCN1 was added to Dystonia - complex. Sources: Expert Review
Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808
Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510
Review for STR: ARX_EIEE1_GCN1 was set to GREEN
STR: ARX_EIEE1_GCN1 was marked as clinically relevant
STR: ARX_EIEE1_GCN1 was marked as current diagnostic
Added comment: NM_139058.3(ARX):c.306GGC[X]
Mechanism of disease is polyAlanine tract associated with dominant-negative effect
PolyAla tract 1 of 2 polyAla tracts associated with disease
Normal repeat number: 16
Pathogenic repeat number: 23
Sources: Expert Review
Dystonia - complex v0.272 ARX Bryony Thompson Tag STR tag was added to gene: ARX.
Motor Neurone Disease v1.30 AR_SBMA_CAG Bryony Thompson SBMA was changed to AR_SBMA_CAG
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Marked STR: AFF2_FRAXE_GCC as ready
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Classified STR: AFF2_FRAXE_GCC as Green List (high evidence)
Mendeliome v1.2490 AFF2_FRAXE_GCC Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).
Mendeliome v1.2489 AFF2_FRAXE_GCC Bryony Thompson STR: AFF2_FRAXE_GCC was added
STR: AFF2_FRAXE_GCC was added to Mendeliome. Sources: Expert list
Mode of inheritance for STR: AFF2_FRAXE_GCC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: AFF2_FRAXE_GCC were set to 8334699; 8673085; 11388762
Phenotypes for STR: AFF2_FRAXE_GCC were set to Intellectual developmental disorder, X-linked 109 MIM#309548
Review for STR: AFF2_FRAXE_GCC was set to GREEN
STR: AFF2_FRAXE_GCC was marked as clinically relevant
STR: AFF2_FRAXE_GCC was marked as current diagnostic
Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)
Loss of function through methylation silencing is the mechanism of disease
Normal - 5-44 repeats
Inconclusive - 45-54 repeats
Premutation - 55-200 repeats
Abnormal - >200 or >230 repeats
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.103 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Mendeliome v1.2488 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.46 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Leukodystrophy - adult onset v0.145 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Leukodystrophy - adult onset v0.144 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Leukodystrophy - adult onset. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)
Early-onset Parkinson disease v2.16 PRNP_CJD_octapeptide Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.15 PRNP_CJD_octapeptide Bryony Thompson STR: PRNP_CJD_octapeptide was added
STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407
Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP_CJD_octapeptide was set to GREEN
STR: PRNP_CJD_octapeptide was marked as clinically relevant
STR: PRNP_CJD_octapeptide was marked as current diagnostic
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Literature
Early-onset Dementia v1.33 PRNP_CJD_octapeptide Bryony Thompson CJD was changed to PRNP_CJD_octapeptide
Repeat Disorders v0.255 ZIC3_VACTERLX_GCC Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC
Repeat Disorders v0.254 NUTM2B-AS1_OPDM_CCG Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence)
Repeat Disorders v0.253 NUTM2B-AS1_OPML1_CCG Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence).
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes
Repeat Disorders v0.252 NUTM2B-AS1_OPML1_CCG Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG
Repeat Disorders v0.251 NIPA1_ALS_GCG Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG
Repeat Disorders v0.250 TMEM185A_FRAXF_GCC Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC
Repeat Disorders v0.249 CBL_FRA11B_CCG Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG
Repeat Disorders v0.248 C11orf80_FRA11A_CGG Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG
Repeat Disorders v0.247 TNRC6A_FAME6_TTTCA Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA
Repeat Disorders v0.246 YEATS2_FAME4_TTTCA Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA
Repeat Disorders v0.245 SAMD12_FAME1_TTTGA Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA
Repeat Disorders v0.244 THAP11_SCA_CAG Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG
Repeat Disorders v0.243 ZNF713_FRA7A_CGG Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG
Repeat Disorders v0.242 AFF3_FRA2A_CGG Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG
Repeat Disorders v0.241 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Repeat Disorders v0.240 RAPGEF2_FAME7_TTTCA Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA
Repeat Disorders v0.239 DMD_DMD_GAA Bryony Thompson DMD was changed to DMD_DMD_GAA
Repeat Disorders v0.238 RUNX2_CCD_GCN Bryony Thompson CCD was changed to RUNX2_CCD_GCN
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)
Early-onset Parkinson disease v2.14 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.13 RFC1_CANVAS_ANNGN Bryony Thompson STR: RFC1_CANVAS_ANNGN was added
STR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364
Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180
Review for STR: RFC1_CANVAS_ANNGN was set to GREEN
STR: RFC1_CANVAS_ANNGN was marked as clinically relevant
STR: RFC1_CANVAS_ANNGN was marked as current diagnostic
Added comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy.
Sources: Literature
Mendeliome v1.2487 Bryony Thompson removed STR:CANVAS_ACAGG from the panel
Mendeliome v1.2486 CANVAS_ACAGG Bryony Thompson Classified STR: CANVAS_ACAGG as No list
Mendeliome v1.2486 CANVAS_ACAGG Bryony Thompson Str: canvas_acagg has been removed from the panel.
Hereditary Neuropathy - complex v1.22 Bryony Thompson removed STR:CANVAS_ACAGG from the panel
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)
Hereditary Neuropathy_CMT - isolated v1.54 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy_CMT - isolated v1.53 RFC1_CANVAS_ANNGN Bryony Thompson STR: RFC1_CANVAS_ANNGN was added
STR: RFC1_CANVAS_ANNGN was added to Hereditary Neuropathy_CMT - isolated. Sources: Literature
Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: RFC1_CANVAS_ANNGN were set to 36061987
Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Cerebellar ataxia with neuropathy and bilateral vestibular areflexia syndrome MONDO:0044720
Review for STR: RFC1_CANVAS_ANNGN was set to GREEN
STR: RFC1_CANVAS_ANNGN was marked as clinically relevant
STR: RFC1_CANVAS_ANNGN was marked as current diagnostic
Added comment: Cases present with HSAN without ataxia and biallelic expansions.
Sources: Literature
Hereditary Neuropathy - complex v1.21 RFC1_CANVAS_ANNGN Bryony Thompson Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).
Hereditary Neuropathy - complex v1.20 RFC1_CANVAS_ANNGN Bryony Thompson CANVAS was changed to RFC1_CANVAS_ANNGN
Repeat Disorders v0.237 Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no
Repeat Disorders v0.236 RFC1_CANVAS_ANNGN Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion
Repeat Disorders v0.235 RFC1_CANVAS_ANNGN Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN
Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.
Repeat Disorders v0.234 RFC1_CANVAS_AAGGG Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722
Mendeliome v1.2485 RFC1_CANVAS_ANNGN Bryony Thompson RFC1_CANVAS_ANNGG was changed to RFC1_CANVAS_ANNGN
Repeated Sequence for RFC1_CANVAS_ANNGN was changed from ANNGG to ANNGN.
Publications for STR: RFC1_CANVAS_ANNGN were changed from 33237689; 32694621; 33103729; 35355059 to 33237689; 32694621; 33103729; 35355059; 37450567
Mendeliome v1.2484 RFC1_CANVAS_ANNGG Bryony Thompson RFC1_CANVAS_AMRGG was changed to RFC1_CANVAS_ANNGG
Mendeliome v1.2483 RFC1_CANVAS_AMRGG Bryony Thompson CANVAS was changed to RFC1_CANVAS_AMRGG
Repeated Sequence for RFC1_CANVAS_AMRGG was changed from AAGGG to ANNGG.
Publications for STR: RFC1_CANVAS_AMRGG were changed from 30926972; 32851396 to 33237689; 32694621; 33103729; 35355059
Repeat Disorders v0.233 RFC1_CANVAS_ACAGG Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence)
Repeat Disorders v0.232 RFC1_CANVAS_ACAGG Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence).
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059
Repeat Disorders v0.231 RFC1_CANVAS_ACAGG Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG
Repeat Disorders v0.230 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Repeat Disorders v0.229 TBX1_TOF_GCN Bryony Thompson TOF was changed to TBX1_TOF_GCN
Repeat Disorders v0.228 HOXD13_SPD1_GCG Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG
Repeat Disorders v0.227 ATXN8OS_SCA8_CTG Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG
Repeat Disorders v0.226 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Repeat Disorders v0.225 CACNA1A_SCA6_CAG Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG
Repeat Disorders v0.224 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Repeat Disorders v0.223 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Repeat Disorders v0.222 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Repeat Disorders v0.221 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Repeat Disorders v0.220 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Repeat Disorders v0.219 FGF14_SCA27B_GAA Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA
Repeat Disorders v0.218 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Repeat Disorders v0.217 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Repeat Disorders v0.216 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Repeat Disorders v0.215 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Repeat Disorders v0.214 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Repeat Disorders v0.213 AR_SBMA_CAG Bryony Thompson SBMA was changed to AR_SBMA_CAG
Repeat Disorders v0.212 EIF4A3_RCPS_complex Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex
Repeat Disorders v0.211 SOX3_PHPX_GCN Bryony Thompson PHPX was changed to SOX3_PHPX_GCN
Repeat Disorders v0.210 ABCD3_OPDM_GCC Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC
Repeat Disorders v0.209 PABPN1_OPMD_GCN Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN
Repeat Disorders v0.208 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Repeat Disorders v0.207 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Repeat Disorders v0.206 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Repeat Disorders v0.205 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Repeat Disorders v0.204 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Repeat Disorders v0.203 RFC1_CANVAS_AAGGG Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG
Repeat Disorders v0.202 COMP_MEDPSACH_GAC Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC
Repeat Disorders v0.201 PRDM12_HSAN8_GCC Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC
Repeat Disorders v0.200 ZIC2_HPE5_GCN Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN
Repeat Disorders v0.199 VWA1_HMNMYO_GCGCGGAGCG Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG
Repeat Disorders v0.198 HOXA13_HFGS_GCN3 Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3
Repeat Disorders v0.197 HOXA13_HFGS_GCN2 Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2
Repeat Disorders v0.196 HOXA13_HFGS_GCN1 Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1
Repeat Disorders v0.195 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Repeat Disorders v0.194 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Repeat Disorders v0.193 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Repeat Disorders v0.192 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Repeat Disorders v0.191 FMR1_FXS_CGG Bryony Thompson FXS was changed to FMR1_FXS_CGG
Repeat Disorders v0.190 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Repeat Disorders v0.189 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Repeat Disorders v0.188 FXN_FRDA_GAA Bryony Thompson FRDA was changed to FXN_FRDA_GAA
Repeat Disorders v0.187 AFF2_FRAXE_GCC Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC
Repeat Disorders v0.186 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Repeat Disorders v0.185 MARCH6_FAME3_TTTCA Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA
Repeat Disorders v0.184 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Repeat Disorders v0.183 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Repeat Disorders v0.182 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.181 CSTB_EPM1_dodecamer Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer
Repeat Disorders v0.180 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG
Repeat Disorders v0.179 ARX_EIEE1_GCN2 Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2
Repeat Disorders v0.178 ARX_EIEE1_GCN1 Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1
Repeat Disorders v0.177 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Repeat Disorders v0.176 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Repeat Disorders v0.175 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Repeat Disorders v0.174 XYLT1_DBQD2_GGC Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC
Repeat Disorders v0.173 PRNP_CJD_octapeptide Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide
Repeat Disorders v0.172 PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT
Repeat Disorders v0.171 PHOX2B_CCHS_GCN Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN
Prepair 500+ v1.105 AUH Zornitza Stark Marked gene: AUH as ready
Prepair 500+ v1.105 AUH Zornitza Stark Gene: auh has been classified as Green List (High Evidence).
Prepair 500+ v1.105 AUH Zornitza Stark Phenotypes for gene: AUH were changed from 3-methylglutaconic aciduria, type I, 250950 (3) to 3-methylglutaconic aciduria, type I, MIM# 250950; MONDO:0009610
Prepair 500+ v1.104 AUH Zornitza Stark Publications for gene: AUH were set to
Prepair 500+ v1.103 ATRX Zornitza Stark Marked gene: ATRX as ready
Prepair 500+ v1.103 ATRX Zornitza Stark Gene: atrx has been classified as Green List (High Evidence).
Prepair 500+ v1.103 ATRX Zornitza Stark Phenotypes for gene: ATRX were changed from Mental retardation-hypotonic facies syndrome, X-linked, 309580 (3) to Alpha thalassemia X-linked intellectual disability syndrome MONDO:0010519
Prepair 500+ v1.102 ATRX Zornitza Stark Publications for gene: ATRX were set to
Prepair 500+ v1.101 ATR Zornitza Stark Marked gene: ATR as ready
Prepair 500+ v1.101 ATR Zornitza Stark Gene: atr has been classified as Green List (High Evidence).
Prepair 500+ v1.101 ATR Zornitza Stark Phenotypes for gene: ATR were changed from Seckel syndrome 1, 210600 (3) to Seckel syndrome 1(MIM#210600)
Prepair 500+ v1.100 ATR Zornitza Stark Publications for gene: ATR were set to
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Marked gene: ATP8B1 as ready
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Gene: atp8b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.99 ATP8B1 Zornitza Stark Phenotypes for gene: ATP8B1 were changed from Cholestasis, progressive familial intrahepatic 1, 211600 (3) to Cholestasis, progressive familial intrahepatic 1, MIM#211600
Prepair 500+ v1.98 ATP7B Zornitza Stark Marked gene: ATP7B as ready
Prepair 500+ v1.98 ATP7B Zornitza Stark Gene: atp7b has been classified as Green List (High Evidence).
Prepair 500+ v1.98 ATP7B Zornitza Stark Phenotypes for gene: ATP7B were changed from Wilson disease, 277900 (3) to Wilson disease (MIM#277900)
Prepair 500+ v1.97 ATP7B Zornitza Stark Publications for gene: ATP7B were set to 28433102
Prepair 500+ v1.96 ATP7A Zornitza Stark Marked gene: ATP7A as ready
Prepair 500+ v1.96 ATP7A Zornitza Stark Gene: atp7a has been classified as Green List (High Evidence).
Prepair 500+ v1.96 ATP7A Zornitza Stark Phenotypes for gene: ATP7A were changed from Menkes disease, 309400 (3) to Menkes disease(MIM#309400); Occipital horn syndrome(MIM#304150)
Prepair 500+ v1.95 ATP7A Zornitza Stark Publications for gene: ATP7A were set to
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Marked gene: ATP6V1B1 as ready
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Gene: atp6v1b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.94 ATP6V1B1 Zornitza Stark Phenotypes for gene: ATP6V1B1 were changed from Renal tubular acidosis with deafness, 267300 (3) to Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM# 267300
Prepair 500+ v1.93 ATM Zornitza Stark Marked gene: ATM as ready
Prepair 500+ v1.93 ATM Zornitza Stark Gene: atm has been classified as Green List (High Evidence).
Prepair 500+ v1.93 ATM Zornitza Stark Phenotypes for gene: ATM were changed from Ataxia-telangiectasia, 208900 (3) to Ataxia-telangiectasia, MIM# 208900
Prepair 500+ v1.92 ATM Zornitza Stark Publications for gene: ATM were set to
Prepair 500+ v1.91 ASS1 Zornitza Stark Marked gene: ASS1 as ready
Prepair 500+ v1.91 ASS1 Zornitza Stark Gene: ass1 has been classified as Green List (High Evidence).
Prepair 500+ v1.91 ASS1 Zornitza Stark Phenotypes for gene: ASS1 were changed from Citrullinemia, 215700 (3) to Citrullinaemia (MIM# 215700)
Prepair 500+ v1.90 ASS1 Zornitza Stark Publications for gene: ASS1 were set to
Prepair 500+ v1.89 ASPM Zornitza Stark Marked gene: ASPM as ready
Prepair 500+ v1.89 ASPM Zornitza Stark Gene: aspm has been classified as Green List (High Evidence).
Prepair 500+ v1.89 ASPM Zornitza Stark Phenotypes for gene: ASPM were changed from Microcephaly 5, primary, autosomal recessive, 608716 (3) to Microcephaly 5, primary, autosomal recessive (MIM#608716)
Prepair 500+ v1.88 ASPM Zornitza Stark Publications for gene: ASPM were set to
Prepair 500+ v1.87 ASPA Zornitza Stark Marked gene: ASPA as ready
Prepair 500+ v1.87 ASPA Zornitza Stark Gene: aspa has been classified as Green List (High Evidence).
Prepair 500+ v1.87 ASPA Zornitza Stark Phenotypes for gene: ASPA were changed from Canavan disease, 271900 (3) to Canavan disease MIM#271900
Prepair 500+ v1.86 ASPA Zornitza Stark Publications for gene: ASPA were set to
Prepair 500+ v1.85 ASNS Zornitza Stark Marked gene: ASNS as ready
Prepair 500+ v1.85 ASNS Zornitza Stark Gene: asns has been classified as Green List (High Evidence).
Prepair 500+ v1.85 ASNS Zornitza Stark Phenotypes for gene: ASNS were changed from Asparagine synthetase deficiency, 615574 (3) to Asparagine synthetase deficiency, MIM#615574
Prepair 500+ v1.84 ASNS Zornitza Stark Publications for gene: ASNS were set to
Prepair 500+ v1.83 ASL Zornitza Stark Marked gene: ASL as ready
Prepair 500+ v1.83 ASL Zornitza Stark Gene: asl has been classified as Green List (High Evidence).
Prepair 500+ v1.83 ASL Zornitza Stark Phenotypes for gene: ASL were changed from Argininosuccinic aciduria, 207900 (3) to Argininosuccinic aciduria MIM#207900
Prepair 500+ v1.82 ASL Zornitza Stark Publications for gene: ASL were set to
Prepair 500+ v1.81 ARX Zornitza Stark Marked gene: ARX as ready
Prepair 500+ v1.81 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Prepair 500+ v1.81 ARX Zornitza Stark Phenotypes for gene: ARX were changed from Hydranencephaly with abnormal genitalia, 300215 (3) to Epileptic encephalopathy, early infantile, 1 MIM#308350; Hydranencephaly with abnormal genitalia MIM#300215; Lissencephaly, X-linked 2 MIM#300215; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510; Proud syndrome MIM#300004
Prepair 500+ v1.80 ARX Zornitza Stark Publications for gene: ARX were set to
Prepair 500+ v1.79 ARSB Zornitza Stark Marked gene: ARSB as ready
Prepair 500+ v1.79 ARSB Zornitza Stark Gene: arsb has been classified as Green List (High Evidence).
Prepair 500+ v1.79 ARSB Zornitza Stark Phenotypes for gene: ARSB were changed from Mucopolysaccharidosis type VI (Maroteaux-Lamy), 253200 (3) to Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200
Prepair 500+ v1.78 ARSB Zornitza Stark Publications for gene: ARSB were set to
Prepair 500+ v1.77 ARSA Zornitza Stark Marked gene: ARSA as ready
Prepair 500+ v1.77 ARSA Zornitza Stark Gene: arsa has been classified as Green List (High Evidence).
Prepair 500+ v1.77 ARSA Zornitza Stark Phenotypes for gene: ARSA were changed from Metachromatic leukodystrophy, 250100 (3) to Metachromatic leukodystrophy, MIM# 250100
Prepair 500+ v1.76 ARSA Zornitza Stark Publications for gene: ARSA were set to
Prepair 500+ v1.75 ARL6 Zornitza Stark Marked gene: ARL6 as ready
Prepair 500+ v1.75 ARL6 Zornitza Stark Gene: arl6 has been classified as Green List (High Evidence).
Prepair 500+ v1.75 ARL6 Zornitza Stark Phenotypes for gene: ARL6 were changed from Bardet-Biedl syndrome 3, 600151 (3) to Bardet-Biedl syndrome 3, MIM# 600151
Prepair 500+ v1.74 ARL6 Zornitza Stark Publications for gene: ARL6 were set to
Prepair 500+ v1.73 ARL13B Zornitza Stark Marked gene: ARL13B as ready
Prepair 500+ v1.73 ARL13B Zornitza Stark Gene: arl13b has been classified as Green List (High Evidence).
Prepair 500+ v1.73 ARL13B Zornitza Stark Phenotypes for gene: ARL13B were changed from Joubert syndrome 8, 612291 (3) to Joubert syndrome 8, MIM# 612291
Prepair 500+ v1.72 ARL13B Zornitza Stark Publications for gene: ARL13B were set to
Prepair 500+ v1.71 ARG1 Zornitza Stark Marked gene: ARG1 as ready
Prepair 500+ v1.71 ARG1 Zornitza Stark Gene: arg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.71 ARG1 Zornitza Stark Phenotypes for gene: ARG1 were changed from Argininemia, 207800 (3) to Argininemia MIM# 207800
Prepair 500+ v1.70 ARG1 Zornitza Stark Publications for gene: ARG1 were set to
Prepair 500+ v1.69 AQP2 Zornitza Stark Marked gene: AQP2 as ready
Prepair 500+ v1.69 AQP2 Zornitza Stark Gene: aqp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.69 AQP2 Zornitza Stark Phenotypes for gene: AQP2 were changed from Diabetes insipidus, nephrogenic, 125800 (3) to Diabetes insipidus, nephrogenic, type 2 MIM# 125800
Prepair 500+ v1.68 AQP2 Zornitza Stark Publications for gene: AQP2 were set to
Prepair 500+ v1.67 AP1S2 Zornitza Stark Marked gene: AP1S2 as ready
Prepair 500+ v1.67 AP1S2 Zornitza Stark Gene: ap1s2 has been classified as Green List (High Evidence).
Prepair 500+ v1.67 AP1S2 Zornitza Stark Publications for gene: AP1S2 were set to
Infertility and Recurrent Pregnancy Loss v0.70 FOXP3 Zornitza Stark Marked gene: FOXP3 as ready
Infertility and Recurrent Pregnancy Loss v0.70 FOXP3 Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.70 FOXP3 Zornitza Stark Classified gene: FOXP3 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.70 FOXP3 Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.69 FGA Zornitza Stark Marked gene: FGA as ready
Infertility and Recurrent Pregnancy Loss v0.69 FGA Zornitza Stark Added comment: Comment when marking as ready: Variants are missense/indels with limited other supporting information, hence Amber rating.
Infertility and Recurrent Pregnancy Loss v0.69 FGA Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.69 FGA Zornitza Stark Classified gene: FGA as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.69 FGA Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.68 KPNA7 Zornitza Stark Marked gene: KPNA7 as ready
Infertility and Recurrent Pregnancy Loss v0.68 KPNA7 Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.68 KPNA7 Zornitza Stark Classified gene: KPNA7 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.68 KPNA7 Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.67 CHEK1 Zornitza Stark Marked gene: CHEK1 as ready
Infertility and Recurrent Pregnancy Loss v0.67 CHEK1 Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.67 CHEK1 Zornitza Stark Classified gene: CHEK1 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.67 CHEK1 Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.66 BTG4 Zornitza Stark Marked gene: BTG4 as ready
Infertility and Recurrent Pregnancy Loss v0.66 BTG4 Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.66 BTG4 Zornitza Stark Classified gene: BTG4 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.66 BTG4 Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.65 ASTL Zornitza Stark Marked gene: ASTL as ready
Infertility and Recurrent Pregnancy Loss v0.65 ASTL Zornitza Stark Gene: astl has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.65 ASTL Zornitza Stark Classified gene: ASTL as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.65 ASTL Zornitza Stark Gene: astl has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.64 AIRE Zornitza Stark Marked gene: AIRE as ready
Infertility and Recurrent Pregnancy Loss v0.64 AIRE Zornitza Stark Gene: aire has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.64 AIRE Zornitza Stark Classified gene: AIRE as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.64 AIRE Zornitza Stark Gene: aire has been classified as Green List (High Evidence).
Prepair 500+ v1.66 AMT Zornitza Stark Marked gene: AMT as ready
Prepair 500+ v1.66 AMT Zornitza Stark Gene: amt has been classified as Green List (High Evidence).
Prepair 500+ v1.66 AMT Zornitza Stark Phenotypes for gene: AMT were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy MIM#620398
Prepair 500+ v1.65 AMT Zornitza Stark Publications for gene: AMT were set to
Prepair 500+ v1.64 AMPD2 Zornitza Stark Marked gene: AMPD2 as ready
Prepair 500+ v1.64 AMPD2 Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence).
Prepair 500+ v1.64 AMPD2 Zornitza Stark Phenotypes for gene: AMPD2 were changed from Pontocerebellar hypoplasia, type 9, 615809 (3) to Pontocerebellar hypoplasia, type 9, MIM#615809
Prepair 500+ v1.63 AMPD2 Zornitza Stark Publications for gene: AMPD2 were set to
Prepair 500+ v1.62 ALPL Zornitza Stark Marked gene: ALPL as ready
Prepair 500+ v1.62 ALPL Zornitza Stark Gene: alpl has been classified as Green List (High Evidence).
Prepair 500+ v1.62 ALPL Zornitza Stark Phenotypes for gene: ALPL were changed from Hypophosphatasia, infantile, 241500 (3) to Hypophosphatasia, childhood (MIM#241510); Hypophosphatasia, infantile (MIM#241500)
Prepair 500+ v1.61 ALPL Zornitza Stark Publications for gene: ALPL were set to
Prepair 500+ v1.60 ALMS1 Zornitza Stark Marked gene: ALMS1 as ready
Prepair 500+ v1.60 ALMS1 Zornitza Stark Gene: alms1 has been classified as Green List (High Evidence).
Prepair 500+ v1.60 ALMS1 Zornitza Stark Phenotypes for gene: ALMS1 were changed from Alstrom syndrome, 203800 (3) to Alstrom syndrome, MIM# 203800
Prepair 500+ v1.59 ALG6 Zornitza Stark Marked gene: ALG6 as ready
Prepair 500+ v1.59 ALG6 Zornitza Stark Gene: alg6 has been classified as Green List (High Evidence).
Prepair 500+ v1.59 ALG6 Zornitza Stark Phenotypes for gene: ALG6 were changed from Congenital disorder of glycosylation, type Ic, 603147 (3) to Congenital disorder of glycosylation, type Ic, MIM#603147
Prepair 500+ v1.58 ALG6 Zornitza Stark Publications for gene: ALG6 were set to
Prepair 500+ v1.57 ALG3 Zornitza Stark Marked gene: ALG3 as ready
Prepair 500+ v1.57 ALG3 Zornitza Stark Gene: alg3 has been classified as Green List (High Evidence).
Prepair 500+ v1.57 ALG3 Zornitza Stark Phenotypes for gene: ALG3 were changed from Congenital disorder of glycosylation, type Id, 601110 (3) to Congenital disorder of glycosylation, type Id, MIM#601110
Prepair 500+ v1.56 ALG3 Zornitza Stark Publications for gene: ALG3 were set to
Prepair 500+ v1.55 ALG1 Zornitza Stark Marked gene: ALG1 as ready
Prepair 500+ v1.55 ALG1 Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.55 ALG1 Zornitza Stark Phenotypes for gene: ALG1 were changed from Congenital disorder of glycosylation, type Ik, 608540 (3) to Congenital disorder of glycosylation, type Ik, MIM# 608540
Prepair 500+ v1.54 ALG1 Zornitza Stark Publications for gene: ALG1 were set to
Prepair 500+ v1.53 ALDOB Zornitza Stark Marked gene: ALDOB as ready
Prepair 500+ v1.53 ALDOB Zornitza Stark Gene: aldob has been classified as Green List (High Evidence).
Prepair 500+ v1.53 ALDOB Zornitza Stark Phenotypes for gene: ALDOB were changed from Fructose intolerance, 229600 (3) to Fructose intolerance, hereditary, MIM# 229600
Prepair 500+ v1.52 ALDOB Zornitza Stark Publications for gene: ALDOB were set to
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Marked gene: ALDH7A1 as ready
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Gene: aldh7a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.51 ALDH7A1 Zornitza Stark Phenotypes for gene: ALDH7A1 were changed from Epilepsy, pyridoxine-dependent, 266100 (3) to Epilepsy, early-onset, 4, vitamin B6-dependent MIM #266100
Prepair 500+ v1.50 ALDH7A1 Zornitza Stark Publications for gene: ALDH7A1 were set to
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Marked gene: ALDH5A1 as ready
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Gene: aldh5a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.49 ALDH5A1 Zornitza Stark Phenotypes for gene: ALDH5A1 were changed from Succinic semialdehyde dehydrogenase deficiency, 271980 (3) to Succinic semialdehyde dehydrogenase deficiency, MIM# 271980
Prepair 500+ v1.48 ALDH5A1 Zornitza Stark Publications for gene: ALDH5A1 were set to
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Marked gene: ALDH3A2 as ready
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence).
Prepair 500+ v1.47 ALDH3A2 Zornitza Stark Phenotypes for gene: ALDH3A2 were changed from Sjogren-Larsson syndrome, 270200 (3) to Sjogren-Larsson syndrome (MIM#270200)
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Marked gene: ALDH18A1 as ready
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Gene: aldh18a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.46 ALDH18A1 Zornitza Stark Phenotypes for gene: ALDH18A1 were changed from Spastic paraplegia 9B, autosomal recessive, 616586 (3) to Cutis laxa, autosomal recessive, type IIIA (MIM#219150); Spastic paraplegia 9B, autosomal recessive (MIM#616586)
Prepair 500+ v1.45 ALDH18A1 Zornitza Stark Publications for gene: ALDH18A1 were set to
Prepair 500+ v1.44 AK2 Zornitza Stark Marked gene: AK2 as ready
Prepair 500+ v1.44 AK2 Zornitza Stark Gene: ak2 has been classified as Green List (High Evidence).
Prepair 500+ v1.44 AK2 Zornitza Stark Phenotypes for gene: AK2 were changed from Reticular dysgenesis, 267500 (3) to Reticular dysgenesis MIM# 267500
Prepair 500+ v1.43 AK2 Zornitza Stark Publications for gene: AK2 were set to
Prepair 500+ v1.42 AIPL1 Zornitza Stark Marked gene: AIPL1 as ready
Prepair 500+ v1.42 AIPL1 Zornitza Stark Gene: aipl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.42 AIPL1 Zornitza Stark Phenotypes for gene: AIPL1 were changed from Cone-rod dystrophy, 604393 (3) to Leber congenital amaurosis 4, 604393; Cone-rod dystrophy, 604393; Retinitis pigmentosa, juvenile, 604393
Prepair 500+ v1.41 AIPL1 Zornitza Stark Publications for gene: AIPL1 were set to
Prepair 500+ v1.40 AIFM1 Zornitza Stark Marked gene: AIFM1 as ready
Prepair 500+ v1.40 AIFM1 Zornitza Stark Gene: aifm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.40 AIFM1 Zornitza Stark Phenotypes for gene: AIFM1 were changed from Cowchock syndrome, 310490 (3) to Combined oxidative phosphorylation deficiency 6, 300816; Cowchock syndrome, 310490; Deafness, X-linked 5, 300614; Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232
Prepair 500+ v1.39 AIFM1 Zornitza Stark Publications for gene: AIFM1 were set to
Prepair 500+ v1.38 AHI1 Zornitza Stark Marked gene: AHI1 as ready
Prepair 500+ v1.38 AHI1 Zornitza Stark Gene: ahi1 has been classified as Green List (High Evidence).
Prepair 500+ v1.38 AHI1 Zornitza Stark Phenotypes for gene: AHI1 were changed from Joubert syndrome-3, 608629 (3) to Joubert syndrome 3 MIM#608629
Prepair 500+ v1.37 AHI1 Zornitza Stark Publications for gene: AHI1 were set to
Prepair 500+ v1.36 AGXT Zornitza Stark Marked gene: AGXT as ready
Prepair 500+ v1.36 AGXT Zornitza Stark Gene: agxt has been classified as Green List (High Evidence).
Prepair 500+ v1.36 AGXT Zornitza Stark Phenotypes for gene: AGXT were changed from Hyperoxaluria, primary, type 1, 259900 (3) to Hyperoxaluria, primary, type 1 MIM #259900
Prepair 500+ v1.35 AGXT Zornitza Stark Publications for gene: AGXT were set to
Prepair 500+ v1.34 AGPS Zornitza Stark Marked gene: AGPS as ready
Prepair 500+ v1.34 AGPS Zornitza Stark Gene: agps has been classified as Green List (High Evidence).
Prepair 500+ v1.34 AGPS Zornitza Stark Phenotypes for gene: AGPS were changed from Chondrodysplasia punctata, rhizomelic, type 3, 600121 (3) to Rhizomelic chondrodysplasia punctata, type 3, MIM# 600121
Prepair 500+ v1.33 AGPS Zornitza Stark Publications for gene: AGPS were set to
Prepair 500+ v1.32 AGL Zornitza Stark Marked gene: AGL as ready
Prepair 500+ v1.32 AGL Zornitza Stark Gene: agl has been classified as Green List (High Evidence).
Prepair 500+ v1.32 AGL Zornitza Stark Phenotypes for gene: AGL were changed from Glycogen storage disease IIIa, 232400 (3) to Glycogen storage disease IIIa and IIIb, MIM#232400
Prepair 500+ v1.31 AGL Zornitza Stark Publications for gene: AGL were set to
Prepair 500+ v1.30 AGK Zornitza Stark Marked gene: AGK as ready
Prepair 500+ v1.30 AGK Zornitza Stark Gene: agk has been classified as Green List (High Evidence).
Prepair 500+ v1.30 AGK Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350
Prepair 500+ v1.29 AGA Zornitza Stark Marked gene: AGA as ready
Prepair 500+ v1.29 AGA Zornitza Stark Gene: aga has been classified as Green List (High Evidence).
Prepair 500+ v1.29 AGA Zornitza Stark Phenotypes for gene: AGA were changed from Aspartylglucosaminuria, 208400 (3) to Aspartylglucosaminuria, MIM# 208400, MONDO:0008830
Prepair 500+ v1.28 AGA Zornitza Stark Publications for gene: AGA were set to
Prepair 500+ v1.27 ADSL Zornitza Stark Marked gene: ADSL as ready
Prepair 500+ v1.27 ADSL Zornitza Stark Gene: adsl has been classified as Green List (High Evidence).
Prepair 500+ v1.27 ADSL Zornitza Stark Phenotypes for gene: ADSL were changed from Adenylosuccinase deficiency, 103050 (3) to Adenylosuccinase deficiency MIM#103050
Prepair 500+ v1.26 ADSL Zornitza Stark Publications for gene: ADSL were set to
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Marked gene: ADGRV1 as ready
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Gene: adgrv1 has been classified as Green List (High Evidence).
Prepair 500+ v1.25 ADGRV1 Zornitza Stark Phenotypes for gene: ADGRV1 were changed from Usher syndrome, type 2C, 605472 (3) to Usher syndrome, type 2C, MIM# 605472
Prepair 500+ v1.24 ADGRV1 Zornitza Stark Publications for gene: ADGRV1 were set to
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Marked gene: ADGRG1 as ready
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Gene: adgrg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.23 ADGRG1 Zornitza Stark Phenotypes for gene: ADGRG1 were changed from Polymicrogyria, bilateral frontoparietal, 606854 (3) to Polymicrogyria, bilateral frontoparietal, MIM#606854
Prepair 500+ v1.22 ADGRG1 Zornitza Stark Publications for gene: ADGRG1 were set to
Prepair 500+ v1.21 ADAR Zornitza Stark Marked gene: ADAR as ready
Prepair 500+ v1.21 ADAR Zornitza Stark Gene: adar has been classified as Green List (High Evidence).
Prepair 500+ v1.21 ADAR Zornitza Stark Phenotypes for gene: ADAR were changed from Aicardi-Goutieres syndrome 6, 615010 (3) to Aicardi-Goutieres syndrome 6, MIM#615010
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Marked gene: ADAMTS2 as ready
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Gene: adamts2 has been classified as Green List (High Evidence).
Prepair 500+ v1.20 ADAMTS2 Zornitza Stark Phenotypes for gene: ADAMTS2 were changed from Ehlers-Danlos syndrome, type VIIC, 225410 (3) to Ehlers-Danlos syndrome, dermatosparaxis type (MIM# 225410)
Prepair 500+ v1.19 ADAMTS2 Zornitza Stark Publications for gene: ADAMTS2 were set to
Prepair 500+ v1.18 ADA Zornitza Stark Marked gene: ADA as ready
Prepair 500+ v1.18 ADA Zornitza Stark Gene: ada has been classified as Green List (High Evidence).
Prepair 500+ v1.18 ADA Zornitza Stark Phenotypes for gene: ADA were changed from Adenosine deaminase deficiency, partial, 102700 (3) to Severe combined immunodeficiency due to ADA deficiency MIM#102700; Adenosine deaminase deficiency, partial MIM#102700
Prepair 500+ v1.17 ADA Zornitza Stark Publications for gene: ADA were set to
Prepair 500+ v1.16 ACOX1 Zornitza Stark Marked gene: ACOX1 as ready
Prepair 500+ v1.16 ACOX1 Zornitza Stark Gene: acox1 has been classified as Green List (High Evidence).
Prepair 500+ v1.16 ACOX1 Zornitza Stark Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, 264470 (3) to Peroxisomal acyl-CoA oxidase deficiency, MIM#264470
Prepair 500+ v1.15 ACOX1 Zornitza Stark Publications for gene: ACOX1 were set to
Prepair 500+ v1.14 ACAT1 Zornitza Stark Marked gene: ACAT1 as ready
Prepair 500+ v1.14 ACAT1 Zornitza Stark Gene: acat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.14 ACAT1 Zornitza Stark Phenotypes for gene: ACAT1 were changed from Alpha-methylacetoacetic aciduria, 203750 (3) to Alpha-methylacetoacetic aciduria, MIM#203750
Prepair 500+ v1.13 ACAT1 Zornitza Stark Publications for gene: ACAT1 were set to
Prepair 500+ v1.12 ACADVL Zornitza Stark Marked gene: ACADVL as ready
Prepair 500+ v1.12 ACADVL Zornitza Stark Gene: acadvl has been classified as Green List (High Evidence).
Prepair 500+ v1.12 ACADVL Zornitza Stark Phenotypes for gene: ACADVL were changed from VLCAD deficiency, 201475 (3) to VLCAD deficiency (MIM#201475)
Prepair 500+ v1.11 ACADM Zornitza Stark Marked gene: ACADM as ready
Prepair 500+ v1.11 ACADM Zornitza Stark Gene: acadm has been classified as Green List (High Evidence).
Prepair 500+ v1.11 ACADM Zornitza Stark Publications for gene: ACADM were set to
Prepair 500+ v1.10 ACAD9 Zornitza Stark Marked gene: ACAD9 as ready
Prepair 500+ v1.10 ACAD9 Zornitza Stark Gene: acad9 has been classified as Green List (High Evidence).
Prepair 500+ v1.10 ACAD9 Zornitza Stark Phenotypes for gene: ACAD9 were changed from Mitochondrial complex I deficiency due to ACAD9 deficiency, 611126 (3) to Mitochondrial complex I deficiency, nuclear type 20 (MIM#611126)
Prepair 500+ v1.9 ACAD9 Zornitza Stark Publications for gene: ACAD9 were set to
Prepair 500+ v1.8 ABCD1 Zornitza Stark Marked gene: ABCD1 as ready
Prepair 500+ v1.8 ABCD1 Zornitza Stark Gene: abcd1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.127 USP25 Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence)
Genetic Epilepsy v1.127 USP25 Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2482 USP25 Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence)
Mendeliome v1.2482 USP25 Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.8 ABCC8 Zornitza Stark Marked gene: ABCC8 as ready
Prepair 500+ v1.8 ABCC8 Zornitza Stark Gene: abcc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCB4 Zornitza Stark Marked gene: ABCB4 as ready
Prepair 500+ v1.8 ABCB4 Zornitza Stark Gene: abcb4 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCB11 Zornitza Stark Marked gene: ABCB11 as ready
Prepair 500+ v1.8 ABCB11 Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCA3 Zornitza Stark Marked gene: ABCA3 as ready
Prepair 500+ v1.8 ABCA3 Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 ABCA12 Zornitza Stark Marked gene: ABCA12 as ready
Prepair 500+ v1.8 ABCA12 Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 AARS2 Zornitza Stark Marked gene: AARS2 as ready
Prepair 500+ v1.8 AARS2 Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence).
Prepair 500+ v1.8 AAAS Zornitza Stark Marked gene: AAAS as ready
Prepair 500+ v1.8 AAAS Zornitza Stark Gene: aaas has been classified as Green List (High Evidence).
Prepair 1000+ v2.7 ZNF469 Zornitza Stark Tag for review tag was added to gene: ZNF469.
Prepair 1000+ v2.7 TRAPPC12 Zornitza Stark Tag for review tag was added to gene: TRAPPC12.
Prepair 1000+ v2.7 PUS7 Zornitza Stark Tag for review tag was added to gene: PUS7.
Prepair 1000+ v2.7 PTPN23 Zornitza Stark Tag for review tag was added to gene: PTPN23.
Prepair 1000+ v2.7 RARB Zornitza Stark Marked gene: RARB as ready
Prepair 1000+ v2.7 RARB Zornitza Stark Gene: rarb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v2.7 RARB Zornitza Stark Phenotypes for gene: RARB were changed from Microphthalmia, syndromic 12, 615524 (3), Autosomal recessive to Microphthalmia, syndromic 12 MIM#615524
Prepair 1000+ v2.6 RARB Zornitza Stark Publications for gene: RARB were set to
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Marked gene: TMEM94 as ready
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Gene: tmem94 has been classified as Green List (High Evidence).
Prepair 1000+ v2.5 TMEM94 Zornitza Stark Publications for gene: TMEM94 were set to 30526868
Prepair 1000+ v2.4 FAM20C Zornitza Stark Marked gene: FAM20C as ready
Prepair 1000+ v2.4 FAM20C Zornitza Stark Gene: fam20c has been classified as Green List (High Evidence).
Prepair 1000+ v2.4 FAM20C Zornitza Stark Phenotypes for gene: FAM20C were changed from Raine syndrome, 259775 (3) to Raine syndrome MIM#259775
Prepair 1000+ v2.3 FAM20C Zornitza Stark Publications for gene: FAM20C were set to
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Marked gene: EIF2B3 as ready
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence).
Prepair 1000+ v2.2 EIF2B3 Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313
Prepair 1000+ v2.1 EIF2B3 Zornitza Stark Publications for gene: EIF2B3 were set to
Prepair 1000+ v2.0 CLN8 Zornitza Stark Marked gene: CLN8 as ready
Prepair 1000+ v2.0 CLN8 Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence).
Prepair 1000+ v2.0 CLN8 Zornitza Stark reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 8, MIM# 600143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v2.0 Zornitza Stark promoted panel to version 2.0
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Marked gene: SCN1B as ready
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Classified gene: SCN1B as Green List (high evidence)
Prepair 1000+ v1.2159 SCN1B Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Marked gene: POLR1D as ready
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2158 POLR1D Zornitza Stark Mode of inheritance for gene: POLR1D was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2157 POLR1D Zornitza Stark Classified gene: POLR1D as Red List (low evidence)
Prepair 1000+ v1.2157 POLR1D Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2156 POLR1D Zornitza Stark reviewed gene: POLR1D: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Treacher Collins syndrome 2 MIM#613717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2156 POLE Zornitza Stark Marked gene: POLE as ready
Prepair 1000+ v1.2156 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Prepair 1000+ v1.2156 POLE Zornitza Stark Classified gene: POLE as Green List (high evidence)
Prepair 1000+ v1.2156 POLE Zornitza Stark Gene: pole has been classified as Green List (High Evidence).
Prepair 1000+ v1.2155 OXCT1 Zornitza Stark Classified gene: OXCT1 as Green List (high evidence)
Prepair 1000+ v1.2155 OXCT1 Zornitza Stark Gene: oxct1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2154 HPDL Zornitza Stark Marked gene: HPDL as ready
Prepair 1000+ v1.2154 HPDL Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2154 HPDL Zornitza Stark Phenotypes for gene: HPDL were changed from to Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities MIM#619026; Spastic paraplegia 83, autosomal recessive MIM#619027; Leigh syndrome MONDO:0009723
Prepair 1000+ v1.2153 HPDL Zornitza Stark Classified gene: HPDL as Green List (high evidence)
Prepair 1000+ v1.2153 HPDL Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2152 DLAT Zornitza Stark Classified gene: DLAT as Green List (high evidence)
Prepair 1000+ v1.2152 DLAT Zornitza Stark Gene: dlat has been classified as Green List (High Evidence).
Prepair 1000+ v1.2151 DBR1 Zornitza Stark Phenotypes for gene: DBR1 were changed from to Xerosis and growth failure with immune and pulmonary dysfunction syndrome MIM#620510
Prepair 1000+ v1.2150 DBR1 Zornitza Stark Publications for gene: DBR1 were set to
Prepair 1000+ v1.2149 DBR1 Zornitza Stark Classified gene: DBR1 as Green List (high evidence)
Prepair 1000+ v1.2149 DBR1 Zornitza Stark Gene: dbr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2148 BRIP1 Zornitza Stark Phenotypes for gene: BRIP1 were changed from Fanconi Anaemia to Fanconi Anaemia, complementation group J, MIM# 609054
Prepair 1000+ v1.2147 BRIP1 Zornitza Stark Classified gene: BRIP1 as Red List (low evidence)
Prepair 1000+ v1.2147 BRIP1 Zornitza Stark Gene: brip1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2146 BRIP1 Zornitza Stark edited their review of gene: BRIP1: Added comment: Consider for inclusion in V3 together with all FA genes.; Changed rating: RED; Changed phenotypes: Fanconi Anaemia, complementation group J, MIM# 609054; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2146 MBTPS1 Zornitza Stark Tag for review was removed from gene: MBTPS1.
Repeat Disorders v0.170 RFC1_CANVAS_ AAGGG Bryony Thompson CANVAS was changed to RFC1_CANVAS_ AAGGG
Repeat Disorders v0.169 FOXL2_BPES_GCN Bryony Thompson BPES was changed to FOXL2_BPES_GCN
Infertility and Recurrent Pregnancy Loss v0.63 CYP19A1 Jasmine Chew gene: CYP19A1 was added
gene: CYP19A1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CYP19A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CYP19A1 were set to 32318648
Phenotypes for gene: CYP19A1 were set to Aromatase deficiency, MIM# 613546
Review for gene: CYP19A1 was set to GREEN
Added comment: Primary amenorrhea (feature of POI) and hypergonadotropic hypogonadism are observed in the presence of aromatase deficiency.

New papers:
i) PMID: 32318648- Novel biallelic CYP19A1 variants in 4 girls manifesting either at birth with atypical genitalia or puberty with poor breast development, clitoromegaly, abnormal menstrual bleeding, polycystic ovaries, and ovarian torsion. All variants except one missense showed a LOF. Protein structure and dynamics studies were in line with functional assays. The 2 female patients with delins variants manifested with ambiguous genitalia at birth. Histologic investigation revealed normal ovarian tissue on one side and a streak gonad on the other. Two female patients presented with abnormal pubertal development and polycystic ovaries.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 CYP17A1 Jasmine Chew changed review comment from: Primary amenorrhea is a feature of POI/POF- Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation.

New papers reported female with primary infertility (PI):
i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic.

ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys.
Sources: Literature; to: Primary amenorrhea is a feature of POI/POF, which is present in 17-alpha-hydroxylase/17,20-lyase deficiency.

Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation.

New papers reported female with primary infertility (PI):
i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic.

ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 CYP17A1 Jasmine Chew gene: CYP17A1 was added
gene: CYP17A1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CYP17A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP17A1 were set to 17-alpha-hydroxylase/17,20-lyase deficiency, MIM# 202110
Review for gene: CYP17A1 was set to GREEN
Added comment: Primary amenorrhea is a feature of POI/POF- Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation.

New papers reported female with primary infertility (PI):
i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic.

ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 AIRE Jasmine Chew gene: AIRE was added
gene: AIRE was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: AIRE was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: AIRE were set to 39318439; 38808199; 30150985
Phenotypes for gene: AIRE were set to Autoimmune polyendocrinopathy syndrome, type I, with or without reversible metaphyseal dysplasia, MIM# 240300
Review for gene: AIRE was set to GREEN
Added comment: Hypogonadism in both males and females

New papers reporting biallelic variants in affected females with POI as part of the clinical manifestation of Autoimmune Polyglandular Syndrome 1- PMID: 39318439; 38808199; 30150985
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 LHCGR Jasmine Chew edited their review of gene: LHCGR: Changed publications: 10714363, 8559204, 21683950, 39162678, 37462066, 32860205, 29912377, 30016538
Infertility and Recurrent Pregnancy Loss v0.63 LHCGR Jasmine Chew gene: LHCGR was added
gene: LHCGR was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: LHCGR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: LHCGR were set to 10714363, 8559204, 21683950; 39162678; 37462066; 32860205; 29912377; 30016538
Phenotypes for gene: LHCGR were set to Luteinizing hormone resistance, female/ Leydig cell hypoplasia with pseudohermaphroditism/ Leydig cell hypoplasia with hypergonadotropic hypogonadism, MIM# 238320
Review for gene: LHCGR was set to GREEN
Added comment: Literature in OMIM- PMID:10714363, 8559204, 21683950

New papers:
i) PMID: 39162678- most recent review paper on LHCGR inactivating variants and reported phenotypes for affected males and females- oligoazoospermia and infertility with arrested spermatogenesis observed in some male patients and oligo-amenorrhea, anovulatory infertility, and failure of oocyte retrieval with hCG treatment despite multi-follicular development on ovulation induction in almost all females

ii)PMID: 37462066, PMID: 32860205, PMID: 29912377- novel biallelic variants in affected females with with empty follicle syndrome

iii) PMID: 30016538- homozygous truncating variant associated with primary ovarian insufficiency

Note: strong evidence for Oocyte/zygote/embryo maturation arrest (OZEMA) and moderate evidence for POI in FeRGI database.
Sources: Literature
Prepair 1000+ v1.2146 ITGA3 Seb Lunke Tag for review was removed from gene: ITGA3.
Prepair 1000+ v1.2146 IGHM Seb Lunke Tag for review was removed from gene: IGHM.
Prepair 1000+ v1.2146 ERBB3 Seb Lunke Tag for review was removed from gene: ERBB3.
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Tag review was removed from gene: TSPYL1.
Prepair 1000+ v1.2146 TTN Seb Lunke Tag for review was removed from gene: TTN.
Prepair 1000+ v1.2146 CERKL Seb Lunke Tag for review was removed from gene: CERKL.
Prepair 1000+ v1.2146 CLN3 Seb Lunke Tag for review was removed from gene: CLN3.
Prepair 1000+ v1.2146 LRSAM1 Seb Lunke Tag for review was removed from gene: LRSAM1.
Prepair 1000+ v1.2146 NCF1 Seb Lunke Tag for review was removed from gene: NCF1.
Prepair 1000+ v1.2146 RARB Seb Lunke Tag for review was removed from gene: RARB.
Prepair 1000+ v1.2146 SLC9A3 Seb Lunke Tag for review was removed from gene: SLC9A3.
Prepair 1000+ v1.2146 FYCO1 Zornitza Stark Tag review was removed from gene: FYCO1.
Prepair 1000+ v1.2146 PRICKLE1 Seb Lunke Tag for review was removed from gene: PRICKLE1.
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Classified gene: TSPYL1 as Green List (high evidence)
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Added comment: Comment on list classification: Assessed, meets conditions as additional non-founder variants identified
Prepair 1000+ v1.2146 TSPYL1 Seb Lunke Gene: tspyl1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2145 B9D1 Zornitza Stark Tag for review was removed from gene: B9D1.
Prepair 1000+ v1.2145 ADPRHL2 Zornitza Stark Tag for review was removed from gene: ADPRHL2.
Prepair 1000+ v1.2145 ACY1 Zornitza Stark Tag for review was removed from gene: ACY1.
Prepair 1000+ v1.2145 PEX19 Lilian Downie Classified gene: PEX19 as Green List (high evidence)
Prepair 1000+ v1.2145 PEX19 Lilian Downie Gene: pex19 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2145 SCO1 Seb Lunke Classified gene: SCO1 as Green List (high evidence)
Prepair 1000+ v1.2145 SCO1 Seb Lunke Gene: sco1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Marked gene: PIEZO1 as ready
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2144 SCO1 Seb Lunke Tag for review was removed from gene: SCO1.
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Classified gene: PIEZO1 as Green List (high evidence)
Prepair 1000+ v1.2144 PIEZO1 Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2143 PIEZO1 Zornitza Stark Tag for review was removed from gene: PIEZO1.
Prepair 1000+ v1.2143 PDHX Zornitza Stark Classified gene: PDHX as Green List (high evidence)
Prepair 1000+ v1.2143 PDHX Zornitza Stark Gene: pdhx has been classified as Green List (High Evidence).
Prepair 1000+ v1.2143 OTULIN Seb Lunke Classified gene: OTULIN as Green List (high evidence)
Prepair 1000+ v1.2143 OTULIN Seb Lunke Gene: otulin has been classified as Green List (High Evidence).
Prepair 1000+ v1.2142 PDHX Zornitza Stark Tag for review was removed from gene: PDHX.
Prepair 1000+ v1.2142 OTULIN Seb Lunke Tag for review was removed from gene: OTULIN.
Prepair 1000+ v1.2142 MTPAP Zornitza Stark Classified gene: MTPAP as Green List (high evidence)
Prepair 1000+ v1.2142 MTPAP Zornitza Stark Gene: mtpap has been classified as Green List (High Evidence).
Prepair 1000+ v1.2142 CHMP1A Lilian Downie Classified gene: CHMP1A as Green List (high evidence)
Prepair 1000+ v1.2142 CHMP1A Lilian Downie Gene: chmp1a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2141 MTPAP Zornitza Stark Tag for review was removed from gene: MTPAP.
Prepair 1000+ v1.2141 CHMP1A Lilian Downie Tag for review was removed from gene: CHMP1A.
Prepair 1000+ v1.2141 APC2 Seb Lunke Classified gene: APC2 as Green List (high evidence)
Prepair 1000+ v1.2141 APC2 Seb Lunke Gene: apc2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2140 APC2 Seb Lunke Tag for review was removed from gene: APC2.
Prepair 1000+ v1.2140 AMN Zornitza Stark Marked gene: AMN as ready
Prepair 1000+ v1.2140 AMN Zornitza Stark Added comment: Comment when marking as ready: Treatable, relatively mild disorder, not suitable for inclusion on a reproductive carrier screen.
Prepair 1000+ v1.2140 AMN Zornitza Stark Gene: amn has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2140 AMN Zornitza Stark Classified gene: AMN as Red List (low evidence)
Prepair 1000+ v1.2140 AMN Zornitza Stark Gene: amn has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2139 AMN Zornitza Stark Tag for review was removed from gene: AMN.
Prepair 1000+ v1.2139 AGTR1 Zornitza Stark Classified gene: AGTR1 as Green List (high evidence)
Prepair 1000+ v1.2139 AGTR1 Zornitza Stark Gene: agtr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2138 YIF1B Seb Lunke Tag for review was removed from gene: YIF1B.
Prepair 1000+ v1.2138 YIF1B Seb Lunke Classified gene: YIF1B as Green List (high evidence)
Prepair 1000+ v1.2138 YIF1B Seb Lunke Gene: yif1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2137 AGTR1 Zornitza Stark Tag for review was removed from gene: AGTR1.
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Marked gene: UQCRC2 as ready
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Added comment: Comment when marking as ready: Borderline gene-disease association, keep Amber in the screening context.
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2137 UQCRC2 Zornitza Stark Publications for gene: UQCRC2 were set to
Prepair 1000+ v1.2136 UQCRC2 Zornitza Stark Classified gene: UQCRC2 as Amber List (moderate evidence)
Prepair 1000+ v1.2136 UQCRC2 Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2135 UQCRC2 Zornitza Stark Tag for review was removed from gene: UQCRC2.
Prepair 1000+ v1.2135 TRAPPC6B Seb Lunke Classified gene: TRAPPC6B as Green List (high evidence)
Prepair 1000+ v1.2135 TRAPPC6B Seb Lunke Gene: trappc6b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2134 TP53RK Lilian Downie Classified gene: TP53RK as Green List (high evidence)
Prepair 1000+ v1.2134 TP53RK Lilian Downie Gene: tp53rk has been classified as Green List (High Evidence).
Prepair 1000+ v1.2133 TRAPPC6B Seb Lunke Tag for review was removed from gene: TRAPPC6B.
Prepair 1000+ v1.2133 TP53RK Lilian Downie Tag for review was removed from gene: TP53RK.
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Marked gene: TPRKB as ready
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2133 TPRKB Zornitza Stark Publications for gene: TPRKB were set to 30053862; 28805828
Prepair 1000+ v1.2132 TPRKB Zornitza Stark Classified gene: TPRKB as Green List (high evidence)
Prepair 1000+ v1.2132 TPRKB Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2131 TPRKB Zornitza Stark Tag for review was removed from gene: TPRKB.
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Tag for review was removed from gene: TBC1D20.
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Marked gene: PKD1L1 as ready
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Gene: pkd1l1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2131 PKD1L1 Zornitza Stark Tag for review was removed from gene: PKD1L1.
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Classified gene: TBC1D20 as Green List (high evidence)
Prepair 1000+ v1.2131 TBC1D20 Lilian Downie Gene: tbc1d20 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2130 PKD1L1 Zornitza Stark reviewed gene: PKD1L1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Heterotaxy, visceral, 8, autosomal MIM#617205; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2130 MFRP Zornitza Stark Classified gene: MFRP as Green List (high evidence)
Prepair 1000+ v1.2130 MFRP Zornitza Stark Gene: mfrp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2129 MFRP Zornitza Stark Tag for review was removed from gene: MFRP.
Prepair 1000+ v1.2129 ITGA3 Lilian Downie Classified gene: ITGA3 as Green List (high evidence)
Prepair 1000+ v1.2129 ITGA3 Lilian Downie Gene: itga3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Marked gene: ISCA1 as ready
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Classified gene: ISCA1 as Green List (high evidence)
Prepair 1000+ v1.2128 ISCA1 Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2127 ISCA1 Zornitza Stark Tag for review was removed from gene: ISCA1.
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Marked gene: IMPG2 as ready
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2127 IMPG2 Zornitza Stark Publications for gene: IMPG2 were set to
Prepair 1000+ v1.2126 IMPG2 Zornitza Stark Classified gene: IMPG2 as Green List (high evidence)
Prepair 1000+ v1.2126 IMPG2 Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2125 IMPG2 Zornitza Stark Tag for review was removed from gene: IMPG2.
Prepair 1000+ v1.2125 HBA2 Seb Lunke Tag SV/CNV tag was added to gene: HBA2.
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Marked gene: HBA2 as ready
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy.
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Gene: hba2 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2125 HBA2 Zornitza Stark Tag for review was removed from gene: HBA2.
Prepair 1000+ v1.2125 HBA1 Seb Lunke Tag SV/CNV tag was added to gene: HBA1.
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Marked gene: HBA1 as ready
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy.
Prepair 1000+ v1.2125 HBA1 Zornitza Stark Gene: hba1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2125 GTPBP2 Lilian Downie Classified gene: GTPBP2 as Green List (high evidence)
Prepair 1000+ v1.2125 GTPBP2 Lilian Downie Gene: gtpbp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2124 HBA1 Zornitza Stark Tag for review was removed from gene: HBA1.
Prepair 1000+ v1.2124 GTPBP2 Lilian Downie Tag for review was removed from gene: GTPBP2.
Prepair 1000+ v1.2124 IGHM Seb Lunke Classified gene: IGHM as Green List (high evidence)
Prepair 1000+ v1.2124 IGHM Seb Lunke Added comment: Comment on list classification: Caution: Gene has annotation issues due to lack of refseq transcript annotation and maybe missed by some analysis pipelines. Checked ok for prepair+
Prepair 1000+ v1.2124 IGHM Seb Lunke Gene: ighm has been classified as Green List (High Evidence).
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Marked gene: FITM2 as ready
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Classified gene: FITM2 as Green List (high evidence)
Prepair 1000+ v1.2123 FITM2 Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2122 FITM2 Zornitza Stark Tag for review was removed from gene: FITM2.
Prepair 1000+ v1.2122 CSMD1 Lilian Downie Classified gene: CSMD1 as Green List (high evidence)
Prepair 1000+ v1.2122 CSMD1 Lilian Downie Gene: csmd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2121 CSMD1 Lilian Downie Tag for review was removed from gene: CSMD1.
Prepair 1000+ v1.2121 COG5 Zornitza Stark Classified gene: COG5 as Green List (high evidence)
Prepair 1000+ v1.2121 COG5 Zornitza Stark Gene: cog5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2120 COG5 Zornitza Stark Tag for review was removed from gene: COG5.
Prepair 1000+ v1.2120 CHM Zornitza Stark Marked gene: CHM as ready
Prepair 1000+ v1.2120 CHM Zornitza Stark Added comment: Comment when marking as ready: Not suitable for reproductive carrier screening.
Prepair 1000+ v1.2120 CHM Zornitza Stark Gene: chm has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2120 BCAP31 Lilian Downie Classified gene: BCAP31 as Green List (high evidence)
Prepair 1000+ v1.2120 BCAP31 Lilian Downie Gene: bcap31 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2119 BCAP31 Lilian Downie Tag for review was removed from gene: BCAP31.
Prepair 1000+ v1.2119 CHM Zornitza Stark Tag for review was removed from gene: CHM.
Prepair 1000+ v1.2119 ACY1 Zornitza Stark Classified gene: ACY1 as Green List (high evidence)
Prepair 1000+ v1.2119 ACY1 Zornitza Stark Gene: acy1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2118 TTN Zornitza Stark Phenotypes for gene: TTN were changed from Myopathy, early-onset, with fatal cardiomyopathy, 611705 (3) to TTN-related myopathy MONDO:0100175
Prepair 1000+ v1.2117 XPNPEP3 Lilian Downie Classified gene: XPNPEP3 as Green List (high evidence)
Prepair 1000+ v1.2117 XPNPEP3 Lilian Downie Gene: xpnpep3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2116 TTN Zornitza Stark Publications for gene: TTN were set to
Prepair 1000+ v1.2115 XPNPEP3 Lilian Downie Tag for review was removed from gene: XPNPEP3.
Prepair 1000+ v1.2115 TTN Zornitza Stark Classified gene: TTN as Green List (high evidence)
Prepair 1000+ v1.2115 TTN Zornitza Stark Gene: ttn has been classified as Green List (High Evidence).
Prepair 1000+ v1.2114 TTN Zornitza Stark reviewed gene: TTN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: TTN-related myopathy MONDO:0100175; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2114 TMEM94 Lilian Downie Classified gene: TMEM94 as Green List (high evidence)
Prepair 1000+ v1.2114 TMEM94 Lilian Downie Gene: tmem94 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2113 TMEM94 Lilian Downie Tag for review was removed from gene: TMEM94.
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Marked gene: POLA1 as ready
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Added comment: Comment when marking as ready: Inclusion assumes appropriate coverage by capture method (checked for Prepair+)
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Tag for review was removed from gene: POLA1.
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Classified gene: POLA1 as Green List (high evidence)
Prepair 1000+ v1.2113 POLA1 Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2112 NTNG2 Lilian Downie Classified gene: NTNG2 as Green List (high evidence)
Prepair 1000+ v1.2112 NTNG2 Lilian Downie Gene: ntng2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2111 NTNG2 Lilian Downie Tag for review was removed from gene: NTNG2.
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Marked gene: NCF1 as ready
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Added comment: Comment when marking as ready: Remains technically challenging, therefore exclude from V2.
Prepair 1000+ v1.2111 NCF1 Zornitza Stark Gene: ncf1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2111 MOGS Lilian Downie Classified gene: MOGS as Green List (high evidence)
Prepair 1000+ v1.2111 MOGS Lilian Downie Gene: mogs has been classified as Green List (High Evidence).
Prepair 1000+ v1.2110 MOGS Lilian Downie Tag for review was removed from gene: MOGS.
Prepair 1000+ v1.2110 MBTPS1 Zornitza Stark Phenotypes for gene: MBTPS1 were changed from ?Spondyloepiphyseal dysplasia, Kondo-Fu type, MIM #618392 to Spondyloepiphyseal dysplasia, Kondo-Fu type MIM#618392
Prepair 1000+ v1.2109 MBTPS1 Zornitza Stark Classified gene: MBTPS1 as Green List (high evidence)
Prepair 1000+ v1.2109 MBTPS1 Zornitza Stark Gene: mbtps1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2108 DYNC1I2 Seb Lunke Classified gene: DYNC1I2 as Green List (high evidence)
Prepair 1000+ v1.2108 DYNC1I2 Seb Lunke Gene: dync1i2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2107 DYNC1I2 Seb Lunke Tag for review was removed from gene: DYNC1I2.
Prepair 1000+ v1.2107 ERBB3 Zornitza Stark Phenotypes for gene: ERBB3 were changed from Visceral neuropathy, familial, 1, autosomal recessive MIM#243180 to Visceral neuropathy, familial, 1, autosomal recessive MIM#243180; Lethal congenital contractural syndrome 2 MIM#607598
Prepair 1000+ v1.2106 CSTB Seb Lunke Tag for review was removed from gene: CSTB.
Prepair 1000+ v1.2106 ERBB3 Zornitza Stark Classified gene: ERBB3 as Green List (high evidence)
Prepair 1000+ v1.2106 ERBB3 Zornitza Stark Gene: erbb3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2105 CERKL Lilian Downie commented on gene: CERKL
Prepair 1000+ v1.2105 B9D1 Zornitza Stark Classified gene: B9D1 as Green List (high evidence)
Prepair 1000+ v1.2105 B9D1 Zornitza Stark Gene: b9d1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2104 ADPRHL2 Seb Lunke Classified gene: ADPRHL2 as Green List (high evidence)
Prepair 1000+ v1.2104 ADPRHL2 Seb Lunke Gene: adprhl2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Marked gene: VKORC1 as ready
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Added comment: Comment when marking as ready: Treatable condition, vast majority receive Vitamin K at birth; not in scope for panel.
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2103 VKORC1 Zornitza Stark Phenotypes for gene: VKORC1 were changed from Vitamin K-dependent clotting factors, combined deficiency of, 2, 607473 (3) to Vitamin K-dependent clotting factors, combined deficiency of, 2, MIM#607473
Prepair 1000+ v1.2102 VKORC1 Zornitza Stark Publications for gene: VKORC1 were set to
Prepair 1000+ v1.2101 VKORC1 Zornitza Stark Classified gene: VKORC1 as Red List (low evidence)
Prepair 1000+ v1.2101 VKORC1 Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2100 RNU4ATAC Lilian Downie commented on gene: RNU4ATAC
Prepair 1000+ v1.2100 VKORC1 Zornitza Stark Tag for review was removed from gene: VKORC1.
Infertility and Recurrent Pregnancy Loss v0.63 PATL2 Jasmine Chew edited their review of gene: PATL2: Changed phenotypes: Oocyte/zygote/embryo maturation arrest 4, MIM# 617743
Prepair 1000+ v1.2100 RNU4ATAC Lilian Downie Tag for review was removed from gene: RNU4ATAC.
Prepair 1000+ v1.2100 SURF1 Zornitza Stark Tag for review was removed from gene: SURF1.
Prepair 1000+ v1.2100 SLC9A3 Seb Lunke Classified gene: SLC9A3 as Amber List (moderate evidence)
Prepair 1000+ v1.2100 SLC9A3 Seb Lunke Gene: slc9a3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Marked gene: RCBTB1 as ready
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Added comment: Comment when marking as ready: Currently, onset appears to mostly in adulthood. Demote and review in the future re new reports with earlier onset.
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2099 RCBTB1 Zornitza Stark Phenotypes for gene: RCBTB1 were changed from Retinal dystrophy with or without extraocular anomalies, 617175 (3), Autosomal recessive to Retinal dystrophy with or without extraocular anomalies (MIM#617175)
Prepair 1000+ v1.2098 RCBTB1 Zornitza Stark Publications for gene: RCBTB1 were set to
Prepair 1000+ v1.2097 RCBTB1 Zornitza Stark Classified gene: RCBTB1 as Amber List (moderate evidence)
Prepair 1000+ v1.2097 RCBTB1 Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2096 RCBTB1 Zornitza Stark Tag for review was removed from gene: RCBTB1.
Prepair 1000+ v1.2096 RARB Seb Lunke Classified gene: RARB as Amber List (moderate evidence)
Prepair 1000+ v1.2096 RARB Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive disease
Prepair 1000+ v1.2096 RARB Seb Lunke Gene: rarb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Marked gene: PRICKLE1 as ready
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2095 PRICKLE1 Zornitza Stark Phenotypes for gene: PRICKLE1 were changed from Epilepsy, progressive myoclonic 1B, 612437 (3) to Epilepsy, progressive myoclonic 1B, MIM# 612437
Prepair 1000+ v1.2094 PRICKLE1 Zornitza Stark Classified gene: PRICKLE1 as Red List (low evidence)
Prepair 1000+ v1.2094 PRICKLE1 Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Classified gene: LRSAM1 as Amber List (moderate evidence)
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive
Prepair 1000+ v1.2093 LRSAM1 Seb Lunke Gene: lrsam1 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2092 LIPC Zornitza Stark Marked gene: LIPC as ready
Prepair 1000+ v1.2092 LIPC Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2092 LIPC Zornitza Stark Phenotypes for gene: LIPC were changed from Hepatic lipase deficiency, 614025 (3) to Hepatic lipase deficiency, MIM# 614025
Prepair 1000+ v1.2091 LIPC Zornitza Stark Tag for review was removed from gene: LIPC.
Prepair 1000+ v1.2091 LIPC Zornitza Stark Classified gene: LIPC as Red List (low evidence)
Prepair 1000+ v1.2091 LIPC Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2090 LIPC Zornitza Stark edited their review of gene: LIPC: Changed rating: RED
Prepair 1000+ v1.2090 LCAT Lilian Downie Classified gene: LCAT as Red List (low evidence)
Prepair 1000+ v1.2090 LCAT Lilian Downie Added comment: Comment on list classification: Adult onset
Prepair 1000+ v1.2090 LCAT Lilian Downie Gene: lcat has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2089 LCAT Lilian Downie Tag for review was removed from gene: LCAT.
Prepair 1000+ v1.2089 HPD Zornitza Stark Tag for review was removed from gene: HPD.
Prepair 1000+ v1.2089 HBB Zornitza Stark Marked gene: HBB as ready
Prepair 1000+ v1.2089 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2089 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Thalassemias, beta-, 613985; Sickle cell anaemia, MIM# 603903
Prepair 1000+ v1.2088 CSTB Seb Lunke Tag STR tag was added to gene: CSTB.
Prepair 1000+ v1.2088 HBB Zornitza Stark Tag for review was removed from gene: HBB.
Prepair 1000+ v1.2088 GNE Lilian Downie Classified gene: GNE as Red List (low evidence)
Prepair 1000+ v1.2088 GNE Lilian Downie Added comment: Comment on list classification: Adult onset
Prepair 1000+ v1.2088 GNE Lilian Downie Gene: gne has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2087 GNE Lilian Downie Tag for review was removed from gene: GNE.
Prepair 1000+ v1.2087 CTSF Zornitza Stark Marked gene: CTSF as ready
Prepair 1000+ v1.2087 CTSF Zornitza Stark Added comment: Comment when marking as ready: Generally adult onset, out of scope for panel.
Prepair 1000+ v1.2087 CTSF Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2087 CSTB Seb Lunke Classified gene: CSTB as Amber List (moderate evidence)
Prepair 1000+ v1.2087 CSTB Seb Lunke Added comment: Comment on list classification: Common dodecamer repeat accounts for 90% of variants, not detectable
Prepair 1000+ v1.2087 CSTB Seb Lunke Gene: cstb has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2086 CTSF Zornitza Stark Tag for review was removed from gene: CTSF.
Prepair 1000+ v1.2086 CTSF Zornitza Stark Classified gene: CTSF as Red List (low evidence)
Prepair 1000+ v1.2086 CTSF Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Added comment: Comment when marking as ready: Downgrade to Amber until CNV analysis included.
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence)
Prepair 1000+ v1.2085 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v1.2084 CLCNKB Zornitza Stark Phenotypes for gene: CLCNKB were changed from Bartter syndrome, type 4b, digenic, 613090 (3) to Bartter syndrome, type 3 MIM#607364
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Marked gene: CLCNKB as ready
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Added comment: Comment when marking as ready: Digenic forms out of scope for this panel.
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Gene: clcnkb has been classified as Green List (High Evidence).
Prepair 1000+ v1.2083 CLCNKB Zornitza Stark Tag for review was removed from gene: CLCNKB.
Prepair 1000+ v1.2083 CCDC8 Zornitza Stark Tag for review was removed from gene: CCDC8.
Prepair 1000+ v1.2083 CHMP1A Zornitza Stark Tag for review tag was added to gene: CHMP1A.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Marked gene: BRIP1 as ready
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Added comment: Comment when marking as ready: Other FA genes not included in panel.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Gene: brip1 has been removed from the panel.
Prepair 1000+ v1.2083 BRIP1 Zornitza Stark Tag for review tag was added to gene: BRIP1.
Prepair 1000+ v1.2083 AMN Zornitza Stark Tag for review tag was added to gene: AMN.
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Marked gene: TRAPPC12 as ready
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2.
Prepair 1000+ v1.2083 TRAPPC12 Zornitza Stark Gene: trappc12 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Marked gene: TBC1D20 as ready
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2.
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Gene: tbc1d20 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 TBC1D20 Zornitza Stark Tag for review tag was added to gene: TBC1D20.
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Marked gene: OPN1LW as ready
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Gene: opn1lw has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2083 OPN1LW Zornitza Stark Publications for gene: OPN1LW were set to
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Marked gene: SLC39A4 as ready
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Gene: slc39a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2082 SLC39A4 Zornitza Stark Phenotypes for gene: SLC39A4 were changed from Acrodermatitis enteropathica, 201100 (3) to Acrodermatitis enteropathica, MIM# 201100
Prepair 1000+ v1.2081 SLC39A4 Zornitza Stark Publications for gene: SLC39A4 were set to
Prepair 1000+ v1.2080 SLC39A4 Zornitza Stark reviewed gene: SLC39A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 19370757; Phenotypes: Acrodermatitis enteropathica, MIM# 201100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Marked gene: SLC30A10 as ready
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Gene: slc30a10 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2080 SLC30A10 Zornitza Stark Phenotypes for gene: SLC30A10 were changed from Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 (3) to Hypermanganesemia with dystonia 1, MIM#613280
Prepair 1000+ v1.2079 SLC30A10 Zornitza Stark Publications for gene: SLC30A10 were set to
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Marked gene: SLC12A5 as ready
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Gene: slc12a5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2078 SLC12A5 Zornitza Stark Phenotypes for gene: SLC12A5 were changed from Epileptic encephalopathy, early infantile, 34, 616645 (3), Autosomal recessive to Developmental and epileptic encephalopathy 34 MIM#616645
Prepair 1000+ v1.2077 SLC12A5 Zornitza Stark Publications for gene: SLC12A5 were set to
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Marked gene: SEC23B as ready
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2076 SEC23B Zornitza Stark Phenotypes for gene: SEC23B were changed from Dyserythropoietic anemia, congenital, type II, 224100 (3) to Dyserythropoietic anaemia, congenital, type II MIM#224100
Prepair 1000+ v1.2075 SEC23B Zornitza Stark Publications for gene: SEC23B were set to
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Marked gene: SCNN1B as ready
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Gene: scnn1b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2074 SCNN1B Zornitza Stark Phenotypes for gene: SCNN1B were changed from Pseudohypoaldosteronism, type I, 264350 (3) to Pseudohypoaldosteronism, type IB2, autosomal recessive, MIM#620125
Prepair 1000+ v1.2073 SCNN1B Zornitza Stark Publications for gene: SCNN1B were set to
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Marked gene: SCN9A as ready
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Gene: scn9a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2072 SCN9A Zornitza Stark Phenotypes for gene: SCN9A were changed from Insensitivity to pain, congenital, 243000 (3) to Insensitivity to pain, congenital, MIM# 243000
Prepair 1000+ v1.2071 SCN9A Zornitza Stark Publications for gene: SCN9A were set to
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Marked gene: SAMHD1 as ready
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2070 SAMHD1 Zornitza Stark Phenotypes for gene: SAMHD1 were changed from Aicardi-Goutieres syndrome 5, 612952 (3) to Aicardi-Goutieres syndrome 5, MIM# 612952
Prepair 1000+ v1.2069 SAMHD1 Zornitza Stark reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Marked gene: RRM2B as ready
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Gene: rrm2b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2069 RRM2B Zornitza Stark Phenotypes for gene: RRM2B were changed from Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075 (3) to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075
Prepair 1000+ v1.2068 RRM2B Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.63 RNF212B Jasmine Chew edited their review of gene: RNF212B: Changed phenotypes: Female and male infertility with recurrent medically assisted reproduction (MAR) failures
Infertility and Recurrent Pregnancy Loss v0.63 RNF212B Jasmine Chew gene: RNF212B was added
gene: RNF212B was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: RNF212B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: RNF212B were set to 40259604; 37124137
Phenotypes for gene: RNF212B were set to Female and male infertility with recurrent medically assisted reproduction (MAR) failures.
Review for gene: RNF212B was set to AMBER
Added comment: Based on available evidence so far, it seems to be affecting Ashkenazi
Jewish population specifically:

i) PMID: 40259604- homozygous stop gained variant p.Arg150Ter in a young Ashkenazi Jewish female with a history of RPL underwent five in vitro fertilization cycles with nearly complete arrest of blastocyst development and ubiquitous aneuploidy of maternal origin in arrested embryos.

ii) PMID: 37124137- homozygous nonsense variant R150X in two brothers of Turkish Jewish descent and one unrelated Ashkenazi Jewish male with oligoasthenotheratozoospermia and infertility who had undergone numerous fertility treatments and failed IVF cycles. Single-cell RNA sequencing data analysis demonstrated expression of the pathogenic variant during various steps of spermatogenesis and consequent severe genomic instability in their sperm and embryos.
Sources: Literature
Pneumothorax v1.1 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Infertility and Recurrent Pregnancy Loss v0.63 PDCD2 Jasmine Chew gene: PDCD2 was added
gene: PDCD2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: PDCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDCD2 were set to 40208938
Phenotypes for gene: PDCD2 were set to Non-immune hydrops fetalis, MONDO:0009369; Recurrent pregnancy loss susceptibility, MONDO:0000144
Review for gene: PDCD2 was set to AMBER
Added comment: PMID: 40208938- Novel biallelic PDCD2 variants associated with hydrops fetalis and early pregnancy loss in two affected families. Family 1 with RPL had three fetuses with NIHF who were all homozygous for p.(Pro28Ser) in PDCD2, while Family 2 had p.(Pro28Ser) in trans with p.(Arg34Pro) in two fetuses with NIHF. Family 2 was additionally notable for having a healthy child who was homozygous for the reference allele, consistent with appropriate disease segregation with the PDCD2 variants. Functional studies using primary fetal fibroblasts and human cell lines for both variants showed reduced PDCD2 mRNA level in affected patients' fibroblasts, reduced cellular accumulation of mutant proteins with impaired ability to associate with the 40S subunit ribosomal protein uS5, and further depletion of PDCD2 in fibroblast cells severely impacted ribosome biogenesis. It is notable that formation of the PDCD2-uS5 complex was not completely abolished by the patient variants and that rRNA processing was only partially impaired, as indicated by levels of 40S pre-rRNAs. We thus suspect that the PDCD2 pathogenic variants p.(Pro28Ser) and p.(Arg34Pro) are hypomorphic alleles, with a low level of residual function allowing for cellular differentiation and growth to a certain extent.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 MUSK Jasmine Chew gene: MUSK was added
gene: MUSK was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MUSK was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MUSK were set to 25612909; 25537362; 31750350; 38566418
Phenotypes for gene: MUSK were set to Fetal akinesia deformation sequence 1, MIM# 208150
Review for gene: MUSK was set to AMBER
Added comment: i) PMID: 25612909- First to report homozygous frameshift variant p.Thr14Asnfs*9 in all affected fetuses with FADS in an affected family which also has two miscarriages. This variant leads to a complete loss of protein expression. Of note, incomplete loss of MuSK function will cause a CMS phenotype, whereas complete loss of function is lethal.

ii) PMID: 25537362- Homozygous missense variant p.Ile575Thr in the intracellular domain of MUSK in 11 out of 14 affected fetuses with lethal FADS (only 11 have DNA available) with a common ancestry from 11 families, suggesting founder effect.

iii) PMID: 31750350- Compound heterozygous variants in an affected fetus with lethal FADS (the mother also had previous abortion due to similarly affected fetus)

iv) Ding et al, 2020 (DOI: 10.22541/au.160097884.45196854)-novel compound heterozygous in a FADS affected fetus (mother also had two previous pregnancies with similarly affected fetuses, terminated)

v) PMID: 38566418- Reviewed previously reported MUSK pathogenic variants (46 patients in total with 29 unique disease-causing variants) appeared in four of the seven MuSK domains, including the Ig1, Frz-like, juxtamembrane, and kinase domains. Homozygous loss-of-function variants resulted in the most severe phenotype (FADS).

Note: Classified as amber since most of the reported cases were TOP rather than IUFD.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 CHRNA1 Jasmine Chew changed review comment from: Spontaneous abortion reported before.

New papers:
i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF.

ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L.
Sources: Literature; to: Spontaneous abortion reported before.

Other papers:
i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF.

ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 CHRNA1 Jasmine Chew gene: CHRNA1 was added
gene: CHRNA1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CHRNA1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHRNA1 were set to 23037934; 18252226
Phenotypes for gene: CHRNA1 were set to Multiple pterygium syndrome, lethal type, MIM# 253290
Added comment: Spontaneous abortion reported before.

New papers:
i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF.

ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 TTN Jasmine Chew changed review comment from: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester.
- Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing."

ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester.

iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, 3 were IUFD.
Sources: Literature; to: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester.
- Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing."

ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester.

iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, three members were IUFD.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 TTN Jasmine Chew gene: TTN was added
gene: TTN was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TTN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTN were set to 36977548; 38148006; 29575618
Phenotypes for gene: TTN were set to Lethal congenital contracture syndrome, MONDO:0017436
Review for gene: TTN was set to GREEN
Added comment: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester.
- Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing."

ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester.

iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, 3 were IUFD.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 STIL Jasmine Chew changed review comment from: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans.

ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development.
Sources: Literature; to: i) PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Functional study showed impairment of the normal regulation of centriole lengthening. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans.

ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development.
Sources: Literature
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Marked gene: ROR2 as ready
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2068 ROR2 Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow syndrome, autosomal recessive, 268310 (3) to Robinow syndrome, autosomal recessive MIM# 268310
Prepair 1000+ v1.2067 ROR2 Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.63 STIL Jasmine Chew changed review comment from: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans.

ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development
Sources: Literature; to: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans.

ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 STIL Jasmine Chew gene: STIL was added
gene: STIL was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: STIL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: STIL were set to 29230157; 33772059
Phenotypes for gene: STIL were set to Recurrent pregnancy loss susceptibility, MONDO:0000144; Primary microcephaly 7, autosomal recessive, MIM# 612703
Review for gene: STIL was set to AMBER
Added comment: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans.

ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development
Sources: Literature
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Marked gene: RNASET2 as ready
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2067 RNASET2 Zornitza Stark Phenotypes for gene: RNASET2 were changed from Leukoencephalopathy, cystic, without megalencephaly, 612951 (3) to Leukoencephalopathy, cystic, without megalencephaly MIM#612951
Prepair 1000+ v1.2066 RNASET2 Zornitza Stark Publications for gene: RNASET2 were set to
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Marked gene: RNASEH2A as ready
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence).
Prepair 1000+ v1.2065 RNASEH2A Zornitza Stark Phenotypes for gene: RNASEH2A were changed from Aicardi-Goutieres syndrome 4, 610333 (3) to Aicardi-Goutieres syndrome 4 MIM#610333; RNASEH2A-related type 1 interferonopathy MONDO:0700259
Prepair 1000+ v1.2064 RNASEH2A Zornitza Stark Publications for gene: RNASEH2A were set to
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Marked gene: RFX6 as ready
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Gene: rfx6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2063 RFX6 Zornitza Stark Phenotypes for gene: RFX6 were changed from Mitchell-Riley syndrome, 615710 (3) to Mitchell-Riley syndrome, MIM# 615710
Prepair 1000+ v1.2062 RFX6 Zornitza Stark reviewed gene: RFX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitchell-Riley syndrome, MIM# 615710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Marked gene: RFT1 as ready
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Gene: rft1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2062 RFT1 Zornitza Stark Phenotypes for gene: RFT1 were changed from Congenital disorder of glycosylation, type In, 612015 (3) to Congenital disorder of glycosylation, type In, MIM# 612015
Prepair 1000+ v1.2061 RFT1 Zornitza Stark Publications for gene: RFT1 were set to
Prepair 1000+ v1.2060 RFT1 Zornitza Stark reviewed gene: RFT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18313027, 19701946, 19856127, 23111317, 30071302, 29923091, 27927990, 26892341; Phenotypes: Congenital disorder of glycosylation, type In, MIM# 612015; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2060 RD3 Zornitza Stark Marked gene: RD3 as ready
Prepair 1000+ v1.2060 RD3 Zornitza Stark Gene: rd3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2060 RD3 Zornitza Stark reviewed gene: RD3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leber congenital amaurosis 12, MIM#610612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2060 RARB Zornitza Stark Tag for review tag was added to gene: RARB.
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2060 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from Severe combined immunodeficiency, B cell-negative, 601457 (3) to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Prepair 1000+ v1.2059 RAG1 Zornitza Stark reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.63 TIMP2 Jasmine Chew gene: TIMP2 was added
gene: TIMP2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TIMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TIMP2 were set to 20847186; 34756330
Phenotypes for gene: TIMP2 were set to Recurrent pregnancy loss susceptibility, MONDO:0000144
Review for gene: TIMP2 was set to AMBER
Added comment: i) PMID: 20847186- In family 6, TIMP2 partial duplication (involves Ex1-2) in mother and 4 out of 5 miscarriages. They have not yet been associated with RPL in humans, however, overexpression of TIMP2 was detected in a mouse model of RPL (Dixon et al., 2006). The TIMP2 disruption in miscarriages in Family 6 may have affected the placental development, but the possibility remains that maternal disruption of TIMP2 may contribute to RPL by impairing the remodeling of the endometrium in early pregnancy. Functional study was performed by PMID: 25674159, which showed reduced RNA and protein expression in chorionic villi cultures from miscarriages with the CNV.

ii) PMID: 34756330- de novo damaging heterozygous missense TIMP2 variant, c.[553G>A]; p.[Gly185Arg] in an eight-week euploid embryonic loss. The MMP2/TIMP2 complex is involved in several gestational processes including implantation and placentation.

iii) PMID: 11912288- The disruption of the TIMP2 gene was considered to be relevant for recurrent miscarriage due to its critical role in modulating invasion of the trophoblast into maternal endometrium and in vascular remodeling and angiogenesis of maternal and placenta tissues in the first trimester.
Sources: Literature
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Marked gene: PYCR1 as ready
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Gene: pycr1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2059 PYCR1 Zornitza Stark Phenotypes for gene: PYCR1 were changed from Cutis laxa, autosomal recessive, type IIB, 612940 (3) to Cutis laxa, autosomal recessive, type IIB MIM#612940; Cutis laxa, autosomal recessive, type IIIB MIM#614438
Prepair 1000+ v1.2058 PYCR1 Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cutis laxa, autosomal recessive, type IIB MIM#612940, Cutis laxa, autosomal recessive, type IIIB MIM#614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Marked gene: PSMB8 as ready
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Gene: psmb8 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2058 PSMB8 Zornitza Stark Phenotypes for gene: PSMB8 were changed from Autoinflammation, lipodystrophy, and dermatosis syndrome, 256040 (3) to Proteasome-associated autoinflammatory syndrome 1, MIM# 256040; MONDO:0054698
Prepair 1000+ v1.2057 PSMB8 Zornitza Stark Publications for gene: PSMB8 were set to
Prepair 1000+ v1.2056 PSMB8 Zornitza Stark reviewed gene: PSMB8: Rating: GREEN; Mode of pathogenicity: None; Publications: 21129723, 21881205, 21852578, 21953331; Phenotypes: Proteasome-associated autoinflammatory syndrome 1, MIM# 256040, MONDO:0054698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Marked gene: PROS1 as ready
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Gene: pros1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2056 PROS1 Zornitza Stark Phenotypes for gene: PROS1 were changed from Thrombophilia due to protein S deficiency, autosomal recessive, 614514 (3) to Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514
Prepair 1000+ v1.2055 PROS1 Zornitza Stark reviewed gene: PROS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2055 PPIB Zornitza Stark Marked gene: PPIB as ready
Prepair 1000+ v1.2055 PPIB Zornitza Stark Gene: ppib has been classified as Green List (High Evidence).
Prepair 1000+ v1.2055 PPIB Zornitza Stark Phenotypes for gene: PPIB were changed from Osteogenesis imperfecta, type IX, #259440 to Osteogenesis imperfecta, type IX MIM#259440
Prepair 1000+ v1.2054 PPIB Zornitza Stark Publications for gene: PPIB were set to
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Marked gene: POMT2 as ready
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Gene: pomt2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2053 POMT2 Zornitza Stark Phenotypes for gene: POMT2 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 2, MIM# 613156
Prepair 1000+ v1.2052 POMT2 Zornitza Stark Publications for gene: POMT2 were set to
Prepair 1000+ v1.2051 POLG Zornitza Stark Marked gene: POLG as ready
Prepair 1000+ v1.2051 POLG Zornitza Stark Gene: polg has been classified as Green List (High Evidence).
Prepair 1000+ v1.2051 POLG Zornitza Stark Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type), 203700 (3) to Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662
Prepair 1000+ v1.2050 POLG Zornitza Stark reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.63 KIF14 Jasmine Chew edited their review of gene: KIF14: Changed phenotypes: Autosomal recessive lethal fetal ciliopathy
Infertility and Recurrent Pregnancy Loss v0.63 KIF14 Jasmine Chew gene: KIF14 was added
gene: KIF14 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: KIF14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KIF14 were set to 24128419; 30388224
Review for gene: KIF14 was set to GREEN
Added comment: i) PMID: 24128419- First human phenotype associated with biallelic inactivating mutations of KIF14, reported 2 affected fetuses in a family with a recurrent fetal pattern of multiple congenital anomalies (MCA), which was considered to be lethal because of distinct brain and kidney malformations, which were both terminated before 20 weeks carrying LOF com het p.Glu584Ilefs*16 and p.Arg594*.Very recently, homozygous mutations in Kif14 (G/A substitution at the 3′ splice acceptor site of Kif14 exon 5) were identified in a novel spontaneous mouse mutant, laggard (lag). which recapitulated most of the fetal phenotypes including the brain malformations, reduced brain size, general growth restriction and early lethality seen in this family (PMID: 23308235).

ii) PMID: 30388224- Novel biallelic KIF14 variants in fetuses (IUFD) from 4 unrelated families presenting with strikingly similar severe brain and kidney phenotypes- renal hypodysplasia and microcephaly, diagnosed as lethal, highly penetrant syndromic CAKUT with microcephaly. Functional studies using transfection study and zebrafish models are supportive that loss of KIF14 result in defects in cytokinesis, microcephaly and ciliopathy-related phenotypes.
Sources: Literature
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Marked gene: PNPLA6 as ready
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2050 PNPLA6 Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Boucher-Neuhauser syndrome, 215470 (3) to Boucher-Neuhauser syndrome MIM#215470; Oliver-McFarlane syndrome MIM#275400; Spastic paraplegia 39, autosomal recessive MIM#612020
Prepair 1000+ v1.2049 PNPLA6 Zornitza Stark Publications for gene: PNPLA6 were set to
Prepair 1000+ v1.2048 PNP Zornitza Stark Marked gene: PNP as ready
Prepair 1000+ v1.2048 PNP Zornitza Stark Gene: pnp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2048 PNP Zornitza Stark Publications for gene: PNP were set to
Prepair 1000+ v1.2047 PNP Zornitza Stark edited their review of gene: PNP: Changed publications: 3029074, 1384322, 11453975, 32695102, 32514656
Prepair 1000+ v1.2047 PNP Zornitza Stark Phenotypes for gene: PNP were changed from Immunodeficiency due to purine nucleoside phosphorylase deficiency, 613179 (3) to Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179
Prepair 1000+ v1.2046 PNP Zornitza Stark reviewed gene: PNP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Marked gene: PHF6 as ready
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Gene: phf6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2046 PHF6 Zornitza Stark Phenotypes for gene: PHF6 were changed from Borjeson-Forssman-Lehmann syndrome, 301900 (3) to Borjeson-Forssman-Lehmann syndrome, MIM# 301900
Prepair 1000+ v1.2045 PHF6 Zornitza Stark reviewed gene: PHF6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Borjeson-Forssman-Lehmann syndrome, MIM# 301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Infertility and Recurrent Pregnancy Loss v0.63 GBE1 Jasmine Chew gene: GBE1 was added
gene: GBE1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GBE1 were set to 33772059; 25489661; 26166723
Phenotypes for gene: GBE1 were set to Glycogen storage disease IV, MIM# 232500
Review for gene: GBE1 was set to GREEN
Added comment: i) PMID: 33772059- one Iranian family with RPL (Fam 90759 , a 13-week fetus with hydrops fetalis observed in ultrasonography) carrying compound heterozygous p.156R>H and c.-35_-54del GCTCAGGCCCCACTCGACCC.

ii) PMID: 25489661- compound heterozygous c.1937delT and c.691+2T>C in a female with spontaneous miscarriage at 8 weeks of gestation with diagnosis of Glycogen storage disease type IV (GSD IV) supported by pathological examination of immature villi.

iii) PMID: 26166723-ompound heterozygous c.691+2T>C and p.R524X in A 30-yr-old woman presented with 2 consecutive miscarriages within 7 month with diagnosis of Glycogen storage disease type IV (GSD IV) supported by pathological examination of placental tissues. Concluded that glycogen storage disease Type IV can cause early miscarriage and that diagnosis can initially be made on histopathologic examination.
Sources: Literature
Prepair 1000+ v1.2045 PET100 Zornitza Stark Marked gene: PET100 as ready
Prepair 1000+ v1.2045 PET100 Zornitza Stark Gene: pet100 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2045 PET100 Zornitza Stark Phenotypes for gene: PET100 were changed from Mitochondrial complex IV deficiency, 220110 (3) to Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055
Prepair 1000+ v1.2044 PET100 Zornitza Stark reviewed gene: PET100: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Marked gene: PDP1 as ready
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Gene: pdp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2044 PDP1 Zornitza Stark Phenotypes for gene: PDP1 were changed from Pyruvate dehydrogenase phosphatase deficiency, 608782 (3) to Pyruvate dehydrogenase phosphatase deficiency,MIM#608782
Prepair 1000+ v1.2043 PDP1 Zornitza Stark Publications for gene: PDP1 were set to
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Marked gene: PCSK1 as ready
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Gene: pcsk1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2042 PCSK1 Zornitza Stark Phenotypes for gene: PCSK1 were changed from Obesity with impaired prohormone processing, 600955 (3) to Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955
Infertility and Recurrent Pregnancy Loss v0.63 SCN5A Jasmine Chew gene: SCN5A was added
gene: SCN5A was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: SCN5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: SCN5A were set to 33772059; 32421437; 23571586; 15184283
Review for gene: SCN5A was set to GREEN
Added comment: i) PMID: 33772059- An Iranian family with RPL (Fam 94947) without fetal autopsy carrying homozygous missense p.1250T>M. The parents were both carriers with a history of cardiac events in the family. This variant has been reported to cause long QT syndrome 3 (LQT3) (#603830) in the heterozygous state. Homozygous mutations in SCN5A in mice cause intrauterine lethality mostly during organogenesis due to heart defects (PMID: 11972032).

ii) PMID: 32421437- de novo SCN5A variants in four cases which all died and three of them died in utero.

iii) PMID: 23571586- 5 intrauterine fetal deaths hosted SCN5A rare nonsynonymous genetic variants (p.T220I, p.R1193Q, involving 2 cases, and p.P2006A, involving 2 cases).

iv) PMID: 15184283- A case of recurrent third-trimester fetal loss and maternal mosaicism for long-QT syndrome- low level mosaic R1623Q present in mom and cord blood from the third fetus also harbored the mutant allele, suggesting that all 3 cases of late-term fetal distress resulted from germ-line transfer of the LQTS-associated mutation.
Sources: Literature
Prepair 1000+ v1.2041 PCSK1 Zornitza Stark Publications for gene: PCSK1 were set to
Prepair 1000+ v1.2040 PCCA Zornitza Stark Marked gene: PCCA as ready
Prepair 1000+ v1.2040 PCCA Zornitza Stark Gene: pcca has been classified as Green List (High Evidence).
Prepair 1000+ v1.2040 PCCA Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, 606054 (3) to Propionicacidemia, MIM#606054
Prepair 1000+ v1.2039 PCCA Zornitza Stark Publications for gene: PCCA were set to
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2038 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from Mental retardation, X-linked 30/47, 300558 (3) to Intellectual developmental disorder, X-linked 30 MIM#300558
Prepair 1000+ v1.2037 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Infertility and Recurrent Pregnancy Loss v0.63 FRAS1 Jasmine Chew changed review comment from: New papers:
i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M.

ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss.
Sources: Literature; to: New papers:
i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M.

ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss due to oligohydramnios, renal agenesis and other congenital anomalies.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 FRAS1 Jasmine Chew gene: FRAS1 was added
gene: FRAS1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FRAS1 were set to 33772059; 32643034
Phenotypes for gene: FRAS1 were set to Fraser syndrome 1, MIM# 219000
Review for gene: FRAS1 was set to GREEN
Added comment: New papers:
i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M.

ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss.
Sources: Literature
Prepair 1000+ v1.2036 PAH Zornitza Stark Marked gene: PAH as ready
Prepair 1000+ v1.2036 PAH Zornitza Stark Gene: pah has been classified as Green List (High Evidence).
Prepair 1000+ v1.2036 PAH Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria, 261600 (3) to Phenylketonuria, MIM#261600
Prepair 1000+ v1.2035 PAH Zornitza Stark Publications for gene: PAH were set to
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Marked gene: OTUD6B as ready
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Gene: otud6b has been classified as Green List (High Evidence).
Prepair 1000+ v1.2034 OTUD6B Zornitza Stark Phenotypes for gene: OTUD6B were changed from Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, 617452 (3), Autosomal recessive to Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452
Prepair 1000+ v1.2033 OTUD6B Zornitza Stark Publications for gene: OTUD6B were set to
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Marked gene: LRSAM1 as ready
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Added comment: Comment when marking as ready: Only single AR family reported, insufficient evidence, downgrade to RED
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Gene: lrsam1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2032 LRSAM1 Lilian Downie Publications for gene: LRSAM1 were set to
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Prepair 1000+ v1.2031 OSGEP Zornitza Stark Phenotypes for gene: OSGEP were changed from Galloway-Mowat syndrome 3, 617729 (3), Autosomal recessive to Galloway-Mowat syndrome 3, MIM# 617729
Prepair 1000+ v1.2030 OSGEP Zornitza Stark Publications for gene: OSGEP were set to
Prepair 1000+ v1.2029 OSGEP Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Marked gene: OPA1 as ready
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Gene: opa1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2029 OPA1 Zornitza Stark Phenotypes for gene: OPA1 were changed from Behr syndrome, 210000 (3), Autosomal recessive to Behr syndrome, MIM#210000
Prepair 1000+ v1.2028 OPA1 Zornitza Stark Publications for gene: OPA1 were set to
Prepair 1000+ v1.2027 PUS7 Lilian Downie Marked gene: PUS7 as ready
Prepair 1000+ v1.2027 PUS7 Lilian Downie Added comment: Comment when marking as ready: Upgrade to green
Prepair 1000+ v1.2027 PUS7 Lilian Downie Gene: pus7 has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Marked gene: NUP107 as ready
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2027 NUP107 Zornitza Stark Phenotypes for gene: NUP107 were changed from Nephrotic syndrome, type 11, 616730 (3), Autosomal recessive to Galloway-Mowat syndrome 7, MIM#618348; Nephrotic syndrome, type 11, MIM#616730
Prepair 1000+ v1.2026 NUP107 Zornitza Stark Publications for gene: NUP107 were set to
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Marked gene: NUBPL as ready
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Gene: nubpl has been classified as Green List (High Evidence).
Prepair 1000+ v1.2025 NUBPL Zornitza Stark Phenotypes for gene: NUBPL were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 21, MIM#618242
Prepair 1000+ v1.2024 NUBPL Zornitza Stark Publications for gene: NUBPL were set to
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Marked gene: NR0B1 as ready
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Gene: nr0b1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2023 NR0B1 Zornitza Stark Phenotypes for gene: NR0B1 were changed from 46XY sex reversal 2, dosage-sensitive, 300018 (3) to Adrenal hypoplasia, congenital, MIM#300200
Prepair 1000+ v1.2022 NR0B1 Zornitza Stark Publications for gene: NR0B1 were set to
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Marked gene: NDUFV2 as ready
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Gene: ndufv2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2021 NDUFV2 Zornitza Stark Phenotypes for gene: NDUFV2 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 7, MIM#618229, MONDO:0044970
Prepair 1000+ v1.2020 NDUFV2 Zornitza Stark Publications for gene: NDUFV2 were set to
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Marked gene: NDUFS4 as ready
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2019 NDUFS4 Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 1, MIM#252010
Prepair 1000+ v1.2018 NCF1 Lilian Downie Tag for review tag was added to gene: NCF1.
Prepair 1000+ v1.2018 NDP Zornitza Stark Marked gene: NDP as ready
Prepair 1000+ v1.2018 NDP Zornitza Stark Gene: ndp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2018 NDP Zornitza Stark Phenotypes for gene: NDP were changed from Norrie disease, 310600 (3) to Norrie disease, MIM#310600
Prepair 1000+ v1.2017 NDP Zornitza Stark Publications for gene: NDP were set to
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Marked gene: NDE1 as ready
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Gene: nde1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2016 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), 614019 (3) to Lissencephaly 4 (with microcephaly), MIM#614019
Prepair 1000+ v1.2015 NDE1 Zornitza Stark Publications for gene: NDE1 were set to
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Marked gene: NCF2 as ready
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Gene: ncf2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2014 NCF2 Zornitza Stark Phenotypes for gene: NCF2 were changed from Chronic granulomatous disease due to deficiency of NCF-2, 233710 (3) to Chronic granulomatous disease 2, autosomal recessive, MIM# 233710
Prepair 1000+ v1.2013 NCF2 Zornitza Stark Publications for gene: NCF2 were set to
Prepair 1000+ v1.2012 NAGA Zornitza Stark Marked gene: NAGA as ready
Prepair 1000+ v1.2012 NAGA Zornitza Stark Gene: naga has been classified as Green List (High Evidence).
Prepair 1000+ v1.2012 NAGA Zornitza Stark Phenotypes for gene: NAGA were changed from Schindler disease, type I, 609241 (3) to Schindler disease, type I MIM#609241; Schindler disease, type III MIM#609241
Prepair 1000+ v1.2011 NAGA Zornitza Stark Publications for gene: NAGA were set to
Prepair 1000+ v1.2010 PDE6B Lilian Downie Marked gene: PDE6B as ready
Prepair 1000+ v1.2010 PDE6B Lilian Downie Gene: pde6b has been classified as Red List (Low Evidence).
Prepair 1000+ v1.2010 MYD88 Zornitza Stark Marked gene: MYD88 as ready
Prepair 1000+ v1.2010 MYD88 Zornitza Stark Gene: myd88 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2010 PDE6B Lilian Downie Publications for gene: PDE6B were set to
Prepair 1000+ v1.2009 MYD88 Zornitza Stark Phenotypes for gene: MYD88 were changed from Pyogenic bacterial infections, recurrent, due to MYD88 deficiency, 612260 (3) to Immunodeficiency 68, MIM# 612260
Prepair 1000+ v1.2008 MYD88 Zornitza Stark Publications for gene: MYD88 were set to
Prepair 1000+ v1.2007 MUSK Zornitza Stark Marked gene: MUSK as ready
Prepair 1000+ v1.2007 MUSK Zornitza Stark Gene: musk has been classified as Green List (High Evidence).
Prepair 1000+ v1.2007 MUSK Zornitza Stark Phenotypes for gene: MUSK were changed from Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 (3) to Fetal akinesia deformation sequence 1 MIM#208150; Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325
Prepair 1000+ v1.2006 MUSK Zornitza Stark Publications for gene: MUSK were set to
Prepair 1000+ v1.2005 GBA Lilian Downie Marked gene: GBA as ready
Prepair 1000+ v1.2005 GBA Lilian Downie Added comment: Comment when marking as ready: Consider upgrading to green as most common variant detectable and suitable disease for inclusion.
Prepair 1000+ v1.2005 GBA Lilian Downie Gene: gba has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.63 PIEZO1 Jasmine Chew gene: PIEZO1 was added
gene: PIEZO1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: PIEZO1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PIEZO1 were set to 33772059; 30244526; 26333996
Phenotypes for gene: PIEZO1 were set to Lymphatic malformation 6, MIM# 616843
Review for gene: PIEZO1 was set to GREEN
Added comment: i) PMID: 33772059- Two unrelated Iranian families with RPL carrying different biallelic variants (i. Fam 82169 with fetal autopsy showing generalized lymphatic dysplasia of Fotiou with non-immune fetal hydrops carry homozygous LOF c.30_31delAC, ii) fam 95136 without fetal autopsy carrying compound heterozygous p.2195S>L and p.922G>W).

ii) PMID: 30244526- Compound heterozygous variants p.Trp1069* and p.Lys2070Gln in a case of a woman with recurrent pregnancies affected by NIHF and had three fetal demises because of severe lymphatic dysplasia.

iii) PMID: 26333996- In a recent review of 10 patients within 6 families, 7 of the probands were diagnosed with NIHF, including 2 died in utero, carrying biallelic variants.
Sources: Literature
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Marked gene: CHMP1A as ready
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Added comment: Comment when marking as ready: Inclusion, green on PanelApp and severe childhood disease
Prepair 1000+ v1.2005 CHMP1A Lilian Downie Gene: chmp1a has been removed from the panel.
Infertility and Recurrent Pregnancy Loss v0.63 BTG4 Jasmine Chew gene: BTG4 was added
gene: BTG4 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: BTG4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BTG4 were set to 32502391; 34647228
Phenotypes for gene: BTG4 were set to Oocyte/zygote/embryo maturation arrest 8, MIM# 619009
Review for gene: BTG4 was set to GREEN
Added comment: Literature in OMIM- PMID: 32502391, 34647228- >3 unrelated infertile women due to failure of the fertilized ovum to undergo zygotic cleavage with different biallelic variants. Functional analysis demonstrated LOF, such as reduced mutant protein expression and disruption in the process of maternal mRNA decay, and loss of protein-protein interaction.

New paper:
i) PMID: 36471203- A novel homozygous truncating variant (p.V195Sfs) in a a female patient with primary infertility and recurrent failure of IVF with zygotic cleavage failure. Co-immunoprecipitation in 293 T cells showed that the mutation abolished the interaction between BTG4 and PABPN1L.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 NLRP2 Jasmine Chew gene: NLRP2 was added
gene: NLRP2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: NLRP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NLRP2 were set to 30877238; 39585517; 39905760
Phenotypes for gene: NLRP2 were set to Oocyte/zygote/embryo maturation arrest 18, MIM# 620332
Review for gene: NLRP2 was set to GREEN
Added comment: Literature in OMIM- PMID: 30877238 (>3 unrelated infertile women due to early embryonic arrest with different biallelic variants)

New papers (biallelic variants for EEA):
i) PMID: 39585517- A novel homozygous protein-truncating (p.Tyr66Thrfs*32) in an infertile female with early embryonic arrest, which resulted in the down-regulation of NLRP2 mRNA expression, truncation of the protein structure, and altered protein localization in cells.

ii) PMID: 39905760- Novel compound heterozygous protein-truncating variants ( p.Leu443Phefs*78 and p.Arg935Metfs*15) in a female with primary infertility, four early miscarriages, and one failed attempt of ICSI. The two variants mediate mRNA decay in EBV-transformed lymphoblastoid cells from the patient, lead to decreased NLRP2 protein levels, and alter NLRP2 interactions with other members of the SCMC in vitro.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 MOS Jasmine Chew gene: MOS was added
gene: MOS was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MOS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MOS were set to 34779126; 34997960; 35670744; 36403623
Phenotypes for gene: MOS were set to Oocyte/zygote/embryo maturation arrest 20, MIM# 620383
Review for gene: MOS was set to GREEN
Added comment: Literature in OMIM- PMID: 34779126; 34997960; 35670744; 36403623- >3 unrelated women with infertility due to early/preimplantation embryonic arrest and fragmentation carrying different biallelic variants. All variants except I197M had functional evidence showing that mutant proteins showed reduced activation/phosphorylation of the MOS downstream targets compared to wildtype MOS.
Note: couldn't find new case reports
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 KPNA7 Jasmine Chew gene: KPNA7 was added
gene: KPNA7 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: KPNA7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: KPNA7 were set to 36647821
Phenotypes for gene: KPNA7 were set to Oocyte/zygote/embryo maturation arrest 17, #MIM 620319
Review for gene: KPNA7 was set to GREEN
Added comment: Literature in OMIM- PMID:36647821- 10 Chinese women from 10 independent families with infertility due to preimplantation embryo arrest carrying the following biallelic variants: x6 homozygous L203F missense, x3 compound heterozygous L203F/P212L, L203F/Q175K, L203F/C451X, and x1 homozygous V152M. Western blot of transfected HEK293T cells showed that all mutant protein levels were significantly lower than wildtype KPNA7. Mutant KPNA7 showed significantly reduced SV40TNLS protein transport activity compared to wildtype KPNA7.
- There were no homozygotes for the recurrent L203F variant either in public databases or in-house control databases. Homozygosity mapping analysis suggested a low probability of founder effect for the recurrent variant L203F.

Note: couldn't find new case reports
Sources: Literature
Prepair 1000+ v1.2005 MTTP Zornitza Stark Marked gene: MTTP as ready
Prepair 1000+ v1.2005 MTTP Zornitza Stark Gene: mttp has been classified as Green List (High Evidence).
Prepair 1000+ v1.2005 MTTP Zornitza Stark Phenotypes for gene: MTTP were changed from Abetalipoproteinemia, 200100 (3) to Abetalipoproteinemia MIM#200100
Prepair 1000+ v1.2004 MTTP Zornitza Stark Publications for gene: MTTP were set to
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Marked gene: MTHFD1 as ready
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2003 MTHFD1 Zornitza Stark Phenotypes for gene: MTHFD1 were changed from Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive to Combined immunodeficiency and megaloblastic anaemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive
Prepair 1000+ v1.2002 MTHFD1 Zornitza Stark Publications for gene: MTHFD1 were set to
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Marked gene: MSTO1 as ready
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2001 MSTO1 Zornitza Stark Publications for gene: MSTO1 were set to 30684668; 31463572
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Marked gene: MMP2 as ready
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Gene: mmp2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.2000 MMP2 Zornitza Stark Phenotypes for gene: MMP2 were changed from Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3) to Multicentric osteolysis, nodulosis, and arthropathy, MIM#259600
Prepair 1000+ v1.1999 MMP2 Zornitza Stark Publications for gene: MMP2 were set to
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Marked gene: MLC1 as ready
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1998 MLC1 Zornitza Stark Phenotypes for gene: MLC1 were changed from Megalencephalic leukoencephalopathy with subcortical cysts, 604004 (3) to Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004
Prepair 1000+ v1.1997 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Marked gene: MKS1 as ready
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1996 MKS1 Zornitza Stark Phenotypes for gene: MKS1 were changed from Meckel syndrome 1, 249000 (3) to Bardet-Biedl syndrome 13 MIM#615990; Joubert syndrome 28 MIM#617121; Meckel syndrome 1 MIM#249000; Ciliopathy MONDO:0005308
Prepair 1000+ v1.1995 MKS1 Zornitza Stark Publications for gene: MKS1 were set to
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Marked gene: MICU1 as ready
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Gene: micu1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1994 MICU1 Zornitza Stark Phenotypes for gene: MICU1 were changed from Myopathy with extrapyramidal signs, 615673 (3) to Myopathy with extrapyramidal signs, MIM# 615673
Prepair 1000+ v1.1993 MICU1 Zornitza Stark Publications for gene: MICU1 were set to
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Marked gene: MFN2 as ready
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Gene: mfn2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1992 MFN2 Zornitza Stark Phenotypes for gene: MFN2 were changed from Charcot-Marie-Tooth disease, axonal, type 2A2B, 617087 (3), Autosomal recessive to Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087; Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800
Prepair 1000+ v1.1991 MFN2 Zornitza Stark reviewed gene: MFN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1991 MFN2 Zornitza Stark Publications for gene: MFN2 were set to
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Marked gene: METTL23 as ready
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Gene: mettl23 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1990 METTL23 Zornitza Stark Phenotypes for gene: METTL23 were changed from Mental retardation, autosomal recessive 44, 615942 (3) to Intellectual developmental disorder, autosomal recessive 44, MIM #615942
Prepair 1000+ v1.1989 METTL23 Zornitza Stark Publications for gene: METTL23 were set to
Infertility and Recurrent Pregnancy Loss v0.63 CHEK1 Jasmine Chew edited their review of gene: CHEK1: Changed rating: GREEN
Infertility and Recurrent Pregnancy Loss v0.63 CHEK1 Jasmine Chew gene: CHEK1 was added
gene: CHEK1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CHEK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: CHEK1 were set to 33953335; 33948904
Phenotypes for gene: CHEK1 were set to Oocyte/zygote/embryo maturation arrest 21, MIM# 620610
Added comment: Literature in OMIM- PMID: 33953335; 33948904
- >3 unrelated with infertility due to zygote/embryo cleavage arrest with three different missense variants and 1 1bp deletion. Functional studies using transfection studies showed that all mutant increased cytoplasmic localization significantly greater kinase activity. Injection of all mutant cRNA into mouse zygotes with 2 distinct pronuclei also resulted in significantly decreased cleavage rates compared to wildtype.

Note: couldn't find new case reports
Sources: Literature
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Marked gene: MEGF10 as ready
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Gene: megf10 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1988 MEGF10 Zornitza Stark Phenotypes for gene: MEGF10 were changed from Myopathy, areflexia, respiratory distress, and dysphagia, early-onset, 614399 (3) to Congenital myopathy 10A, severe variant, MIM #614399; Congenital myopathy 10B, mild variant, MIM #620249
Prepair 1000+ v1.1987 MEGF10 Zornitza Stark Publications for gene: MEGF10 were set to
Prepair 1000+ v1.1986 MED12 Zornitza Stark Marked gene: MED12 as ready
Prepair 1000+ v1.1986 MED12 Zornitza Stark Gene: med12 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1986 MED12 Zornitza Stark Phenotypes for gene: MED12 were changed from Lujan-Fryns syndrome, 309520 (3) to MED12-related intellectual disability syndrome, MONDO:0100000
Prepair 1000+ v1.1985 MED12 Zornitza Stark Publications for gene: MED12 were set to
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Marked gene: MBTPS2 as ready
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Gene: mbtps2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1984 MBTPS2 Zornitza Stark Phenotypes for gene: MBTPS2 were changed from IFAP syndrome with or without BRESHECK syndrome, 308205 (3) to IFAP syndrome with or without BRESHECK syndrome MIM#308205; Osteogenesis imperfecta, type XIX MIM#301014
Prepair 1000+ v1.1983 MBTPS2 Zornitza Stark Publications for gene: MBTPS2 were set to
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Marked gene: MAPKBP1 as ready
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Gene: mapkbp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1982 MAPKBP1 Zornitza Stark Phenotypes for gene: MAPKBP1 were changed from Nephronophthisis 20, 617271 (3), Autosomal recessive to Nephronophthisis 20, MIM# 617271; MONDO:0014997
Prepair 1000+ v1.1981 MAPKBP1 Zornitza Stark Publications for gene: MAPKBP1 were set to
Prepair 1000+ v1.1980 LYST Zornitza Stark Marked gene: LYST as ready
Prepair 1000+ v1.1980 LYST Zornitza Stark Gene: lyst has been classified as Green List (High Evidence).
Prepair 1000+ v1.1980 LYST Zornitza Stark Phenotypes for gene: LYST were changed from Chediak-Higashi syndrome, 214500 (3) to Chediak-Higashi syndrome MIM#214500
Prepair 1000+ v1.1979 LYST Zornitza Stark Publications for gene: LYST were set to
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Marked gene: LRMDA as ready
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Gene: lrmda has been classified as Green List (High Evidence).
Prepair 1000+ v1.1978 LRMDA Zornitza Stark Phenotypes for gene: LRMDA were changed from Albinism, oculocutaneous, type VII, 615179 (3) to Albinism, oculocutaneous, type VII MIM#615179; MONDO:0014070
Prepair 1000+ v1.1977 LRMDA Zornitza Stark Publications for gene: LRMDA were set to
Prepair 1000+ v1.1976 LRAT Zornitza Stark Marked gene: LRAT as ready
Prepair 1000+ v1.1976 LRAT Zornitza Stark Gene: lrat has been classified as Green List (High Evidence).
Prepair 1000+ v1.1976 LRAT Zornitza Stark Phenotypes for gene: LRAT were changed from Leber congenital amaurosis 14, 613341 (3) to Retinal dystrophy, early-onset severe; Leber congenital amaurosis 14; Retinitis pigmentosa, juvenile, all under MIM #613341
Prepair 1000+ v1.1975 LRAT Zornitza Stark Publications for gene: LRAT were set to
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Marked gene: LONP1 as ready
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Gene: lonp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1974 LONP1 Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, 600373 (3) to CODAS syndrome, MIM#600373
Prepair 1000+ v1.1973 LONP1 Zornitza Stark Publications for gene: LONP1 were set to
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Marked gene: LMOD3 as ready
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Gene: lmod3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1972 LMOD3 Zornitza Stark Phenotypes for gene: LMOD3 were changed from Nemaline myopathy 10, 616165 (3) to Nemaline myopathy 10, MIM#616165
Prepair 1000+ v1.1971 LMOD3 Zornitza Stark Publications for gene: LMOD3 were set to
Prepair 1000+ v1.1970 LIPC Zornitza Stark Tag for review tag was added to gene: LIPC.
Prepair 1000+ v1.1970 LIPC Zornitza Stark reviewed gene: LIPC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hepatic lipase deficiency, MIM# 614025; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Marked gene: LARS2 as ready
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1970 LARS2 Zornitza Stark Phenotypes for gene: LARS2 were changed from Perrault syndrome 4, 615300 (3) to Hydrops, lactic acidosis, and sideroblastic anaemia MIM#617021; Perrault syndrome 4 MIM#615300
Prepair 1000+ v1.1969 LARS2 Zornitza Stark Publications for gene: LARS2 were set to
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Marked gene: LAMB2 as ready
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Gene: lamb2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1968 LAMB2 Zornitza Stark Phenotypes for gene: LAMB2 were changed from Pierson syndrome, 609049 (3) to Pierson syndrome, MIM# 609049; Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199
Prepair 1000+ v1.1967 LAMB2 Zornitza Stark reviewed gene: LAMB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pierson syndrome, MIM# 609049, Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Marked gene: SLC7A7 as ready
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Gene: slc7a7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1967 SLC7A7 Lilian Downie Publications for gene: SLC7A7 were set to
Prepair 1000+ v1.1966 STIM1 Lilian Downie Marked gene: STIM1 as ready
Prepair 1000+ v1.1966 STIM1 Lilian Downie Gene: stim1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1966 STIM1 Lilian Downie Publications for gene: STIM1 were set to
Prepair 1000+ v1.1965 TOE1 Lilian Downie Marked gene: TOE1 as ready
Prepair 1000+ v1.1965 TOE1 Lilian Downie Gene: toe1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1965 TOE1 Lilian Downie Phenotypes for gene: TOE1 were changed from Pontocerebellar hypoplasia, type 7, 614969 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 7 MIM#614969
Prepair 1000+ v1.1964 TOE1 Lilian Downie Publications for gene: TOE1 were set to
Prepair 1000+ v1.1963 TPP1 Lilian Downie Marked gene: TPP1 as ready
Prepair 1000+ v1.1963 TPP1 Lilian Downie Gene: tpp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1963 TPP1 Lilian Downie Phenotypes for gene: TPP1 were changed from Ceroid lipofuscinosis, neuronal, 2, 204500 (3) to Ceroid lipofuscinosis, neuronal, 2 MIM#204500; Spinocerebellar ataxia, autosomal recessive 7 MIM#609270
Prepair 1000+ v1.1962 TPP1 Lilian Downie Publications for gene: TPP1 were set to
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Marked gene: TRAPPC11 as ready
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Gene: trappc11 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1961 TRAPPC11 Lilian Downie Publications for gene: TRAPPC11 were set to
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Marked gene: TRMT10A as ready
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Gene: trmt10a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1960 TRMT10A Lilian Downie Publications for gene: TRMT10A were set to
Prepair 1000+ v1.1959 UBE3B Lilian Downie Marked gene: UBE3B as ready
Prepair 1000+ v1.1959 UBE3B Lilian Downie Gene: ube3b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1959 UBE3B Lilian Downie Publications for gene: UBE3B were set to
Prepair 1000+ v1.1958 USH1G Lilian Downie Marked gene: USH1G as ready
Prepair 1000+ v1.1958 USH1G Lilian Downie Gene: ush1g has been classified as Green List (High Evidence).
Prepair 1000+ v1.1958 USH1G Lilian Downie Publications for gene: USH1G were set to
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Marked gene: VIPAS39 as ready
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Gene: vipas39 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1957 VIPAS39 Lilian Downie Publications for gene: VIPAS39 were set to
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Marked gene: VKORC1 as ready
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Added comment: Comment when marking as ready: Single homozygous missense variant, Arg98Trp reported to cause the AR phenotype (PMID: 12704386). (ClinGen 2023) This phenotype causes intracranial haemmorhage in the first weeks of life and ongoing bleeding predisposition but this is reversed with vit K administration so highly treatable.
Prepair 1000+ v1.1956 VKORC1 Lilian Downie Gene: vkorc1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Marked gene: XRCC4 as ready
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Gene: xrcc4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1956 XRCC4 Lilian Downie Phenotypes for gene: XRCC4 were changed from Short stature, microcephaly, and endocrine dysfunction, 616541 (3), Autosomal recessive to Short stature, microcephaly, and endocrine dysfunction MIM#616541
Prepair 1000+ v1.1955 XRCC4 Lilian Downie Publications for gene: XRCC4 were set to
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Marked gene: XYLT2 as ready
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Gene: xylt2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1954 XYLT2 Lilian Downie Phenotypes for gene: XYLT2 were changed from Spondyloocular syndrome, 605822 (3), Autosomal recessive to Spondyloocular syndrome MIM#605822
Prepair 1000+ v1.1953 XYLT2 Lilian Downie Publications for gene: XYLT2 were set to
Infertility and Recurrent Pregnancy Loss v0.63 ASTL Jasmine Chew gene: ASTL was added
gene: ASTL was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: ASTL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASTL were set to 34704130; 37640117; 37133443
Phenotypes for gene: ASTL were set to Oocyte/zygote/embryo maturation arrest 11, MIM# 619643
Review for gene: ASTL was set to GREEN
Added comment: Literature in OMIM- PMID: 34704130- One Saudi family with 2 sisters with reduced or absent fertility due to oocyte maturation defect carrying a homozygous splice variant.

New papers (biallelic variants)
i) PMID: 37640117 - Novel compound heterozygous missense variants (p.Arg117Cys and p.Arg274Trp) in a Chinese woman with primary infertility and polyspermy in IVF. Moreover, transfection studies using CHO-K1 cells indicated that mutant cells showed abnormal ovastacin zymogen activation or decreased enzyme stability.

ii) PMID: 37133443- Biallelic variants in four independent affected individuals with primary infertility. The frameshift variants significantly decreased the quantity of ASTL protein in vitro. And all missense variants affected the enzymatic activity that cleaves ZP2 in mouse egg in vitro. Three knock-in female mice (corresponding to three missense variants in patients) all show subfertility due to low embryo developmental potential.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 FOXP3 Jasmine Chew gene: FOXP3 was added
gene: FOXP3 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FOXP3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: FOXP3 were set to 28833278; 25546394; 26395338; 26387632; 26009232
Phenotypes for gene: FOXP3 were set to X-linked immunodysregulation, polyendocrinopathy, and enteropathy, MIM# 304790
Review for gene: FOXP3 was set to GREEN
Added comment: Multiple papers reported recurrent male miscarriages in different families:
i) PMID: 28833278- hemizygous truncating variant (p.D303fs*87) in a most recent male IUFD fetus (hydrops fetalis and fetal death around 18 GA weeks) in a family with recurrent IUFD of 19 males in total occurred at ≤20 weeks of gestation, and the same variant was carried by all five healthy obligatory female carriers. Recent studies involving patients with unexplained recurrent spontaneous abortions have demonstrated that downregulation of Treg cells may be due to a significant decrease in the expression of the FOXP3 gene due to epigenetic suppression of FOXP3 through promoter methylation, thus increasing the risk for IUFD (PMID: 27785899)

ii) PMID: 25546394- Two unrelated families with clear evidence of fetal-onset IPEX syndrome (Family 1 had a family history of five miscarriages of males in two generations, positive for hemizygous p.R397W, family 2 with first two males died prematurely after birth and miscarriage of two monochorionic male twins, positive for hemizygous truncating variant (p.S107Nfs*204).

iii) PMID: 26395338- A family with the loss of two male fetuses as a result of fetal hydrops of unknown etiology due to novel nonsense variant (p.R337*).

iv)PMID: 26387632- The same p.R337* in an unrelated family with multiple male miscarriages occurring around 18 to 20 weeks of EGA and associated with hydrops fetalis and fetal akinesia.

v) PMID: 26009232- A family with two miscarriages and three early IUFDs of male fetuses with hemizygous missense variant (p.L345F).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 STAR Jasmine Chew changed review comment from: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients:
i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro.

ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, respectively, of the wild-type, proving the main negative effects of the mutant proteins.
Sources: Literature; to: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients:
i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro.

ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, of the wild-type protein activity, respectively.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 STAR Jasmine Chew gene: STAR was added
gene: STAR was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: STAR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: STAR were set to 38913505; 36733346
Phenotypes for gene: STAR were set to Lipoid adrenal hyperplasia, MIM# 201710
Review for gene: STAR was set to GREEN
Added comment: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients:
i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro.

ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, respectively, of the wild-type, proving the main negative effects of the mutant proteins.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 SYCE1 Jasmine Chew changed review comment from: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA)

New papers (biallelic variants for POI/NOA):
i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal).

ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del).

iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient.
Sources: Literature; to: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA)

New papers (biallelic variants for POI/NOA):
i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal).

ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del).

iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient.
Sources: Literature
Mode of pathogenicity: Provide exceptions to loss-of-function
Infertility and Recurrent Pregnancy Loss v0.63 SYCE1 Jasmine Chew edited their review of gene: SYCE1: Changed mode of pathogenicity: Other; Changed phenotypes: Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM# 616950
Infertility and Recurrent Pregnancy Loss v0.63 SYCE1 Jasmine Chew edited their review of gene: SYCE1: Changed phenotypes: Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM#616950
Infertility and Recurrent Pregnancy Loss v0.63 SYCE1 Jasmine Chew changed review comment from: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA)

New papers (biallelic variants for POI/NOA):
i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal).

ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del).

iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient.
Sources: Literature; to: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA)

New papers (biallelic variants for POI/NOA):
i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal).

ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del).

iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 SYCE1 Jasmine Chew gene: SYCE1 was added
gene: SYCE1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: SYCE1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYCE1 were set to 25062452; 25899990; 26203179; 36373164; 35718780; 34718620
Phenotypes for gene: SYCE1 were set to Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM# 616950
Mode of pathogenicity for gene: SYCE1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: SYCE1 was set to GREEN
Added comment: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA)

New papers (biallelic variants for POI/NOA):
i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal).

ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del).

iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 WT1 Jasmine Chew gene: WT1 was added
gene: WT1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: WT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: WT1 were set to 26358501; 34845858
Phenotypes for gene: WT1 were set to Primary ovarian failure, MONDO:0005387
Review for gene: WT1 was set to GREEN
Added comment: New papers reported variants associated with POI:
i) PMID: 26358501- Two novel heterozygous missense variants (p. Pro126Ser in exon1 and p. Arg370His in exon7) in two unrelated POI patients, and functional study on these two missense variants showed in impaired transcription of downstream genes, including AMH, FSHR, CYP19 and CDH.

ii) PMID: 34845858- A de novo heterozygous nonsense variant p.R463* in a non-syndromic POI woman. Western blot analysis further demonstrated that the WT1 variant could produce a truncated WT1 isoform in vitro.
Sources: Literature
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Marked gene: KIF7 as ready
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1952 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from Hydrolethalus syndrome 2, 614120 (3) to Al-Gazali-Bakalinova syndrome MIM#607131; Hydrolethalus syndrome 2 MIM#614120; Acrocallosal syndrome MIM#200990; Joubert syndrome 12 MIM#200990
Prepair 1000+ v1.1951 KIF7 Zornitza Stark Publications for gene: KIF7 were set to
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Marked gene: KIAA1109 as ready
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Gene: kiaa1109 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1950 KIAA1109 Zornitza Stark Phenotypes for gene: KIAA1109 were changed from Alkuraya-Kucinskas syndrome, 617822 (3), Autosomal recessive to Alkuraya-Kucinskas syndrome MIM#617822
Prepair 1000+ v1.1949 KIAA1109 Zornitza Stark Publications for gene: KIAA1109 were set to
Prepair 1000+ v1.1948 KIAA1109 Zornitza Stark Tag new gene name tag was added to gene: KIAA1109.
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Marked gene: KCNV2 as ready
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Gene: kcnv2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1948 KCNV2 Zornitza Stark Phenotypes for gene: KCNV2 were changed from Retinal cone dystrophy 3B, 610356 (3) to Retinal cone dystrophy 3B MIM#610356
Prepair 1000+ v1.1947 KCNV2 Zornitza Stark Publications for gene: KCNV2 were set to
Prepair 1000+ v1.1946 ITK Zornitza Stark Marked gene: ITK as ready
Prepair 1000+ v1.1946 ITK Zornitza Stark Gene: itk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1946 ITK Zornitza Stark Phenotypes for gene: ITK were changed from Lymphoproliferative syndrome 1, 613011 (3) to Lymphoproliferative syndrome 1 MIM# 613011
Prepair 1000+ v1.1945 ITK Zornitza Stark Publications for gene: ITK were set to
Prepair 1000+ v1.1944 ITK Zornitza Stark changed review comment from: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anemia or renal disease, may also occur.; to: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anaemia or renal disease, may also occur.
Prepair 1000+ v1.1944 ITK Zornitza Stark reviewed gene: ITK: Rating: GREEN; Mode of pathogenicity: None; Publications: 19425169, 22289921, 25061172, 26056787, 9311799, 10213685; Phenotypes: Lymphoproliferative syndrome 1 MIM# 613011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1944 INVS Zornitza Stark Marked gene: INVS as ready
Prepair 1000+ v1.1944 INVS Zornitza Stark Gene: invs has been classified as Green List (High Evidence).
Prepair 1000+ v1.1944 INVS Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088)
Prepair 1000+ v1.1943 INVS Zornitza Stark reviewed gene: INVS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Nephronophthisis 2, infantile, (MIM#602088); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Marked gene: INPP5K as ready
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Gene: inpp5k has been classified as Green List (High Evidence).
Prepair 1000+ v1.1943 INPP5K Zornitza Stark Phenotypes for gene: INPP5K were changed from Muscular dystrophy, congenital, with cataracts and intellectual disability, 617404 (3), Autosomal recessive to Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404
Prepair 1000+ v1.1942 INPP5K Zornitza Stark Publications for gene: INPP5K were set to
Prepair 1000+ v1.1941 INPP5K Zornitza Stark Tag founder tag was added to gene: INPP5K.
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Marked gene: IFT172 as ready
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Gene: ift172 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1941 IFT172 Zornitza Stark Phenotypes for gene: IFT172 were changed from Short-rib thoracic dysplasia 10 with or without polydactyly, 615630 (3) to Bardet-Biedl syndrome 20 MIM#619471; Retinitis pigmentosa 71 MIM#616394; Short-rib thoracic dysplasia 10 with or without polydactyly MIM#615630
Prepair 1000+ v1.1940 IFT172 Zornitza Stark Publications for gene: IFT172 were set to
Prepair 1000+ v1.1939 IDUA Zornitza Stark Marked gene: IDUA as ready
Prepair 1000+ v1.1939 IDUA Zornitza Stark Gene: idua has been classified as Green List (High Evidence).
Prepair 1000+ v1.1939 IDUA Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014
Prepair 1000+ v1.1938 IDUA Zornitza Stark reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Marked gene: IBA57 as ready
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Gene: iba57 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1938 IBA57 Zornitza Stark Phenotypes for gene: IBA57 were changed from Multiple mitochondrial dysfunctions syndrome 3, 615330 (3), Autosomal recessive to Multiple mitochondrial dysfunctions syndrome 3 MIM#615330
Prepair 1000+ v1.1937 IBA57 Zornitza Stark Publications for gene: IBA57 were set to
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Marked gene: HYLS1 as ready
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1936 HYLS1 Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680)
Prepair 1000+ v1.1935 HYLS1 Zornitza Stark Publications for gene: HYLS1 were set to
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Marked gene: HSPD1 as ready
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Gene: hspd1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1934 HSPD1 Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, 612233 (3) to Leukodystrophy, hypomyelinating, 4 MIM#612233
Prepair 1000+ v1.1933 HSPD1 Zornitza Stark Publications for gene: HSPD1 were set to
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark edited their review of gene: HSD3B7: Changed publications: 27604308
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Marked gene: HSD3B7 as ready
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Gene: hsd3b7 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1932 HSD3B7 Zornitza Stark Publications for gene: HSD3B7 were set to
Prepair 1000+ v1.1931 HSD3B7 Zornitza Stark Phenotypes for gene: HSD3B7 were changed from Bile acid synthesis defect, congenital, 1, 607765 (3) to Bile acid synthesis defect, congenital, 1 MIM#607765
Prepair 1000+ v1.1930 HSD3B7 Zornitza Stark reviewed gene: HSD3B7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Bile acid synthesis defect, congenital, 1 MIM#607765; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Marked gene: HPS3 as ready
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1930 HPS3 Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072
Prepair 1000+ v1.1929 HPS3 Zornitza Stark Publications for gene: HPS3 were set to
Prepair 1000+ v1.1928 HAMP Zornitza Stark Marked gene: HAMP as ready
Prepair 1000+ v1.1928 HAMP Zornitza Stark Gene: hamp has been classified as Green List (High Evidence).
Prepair 1000+ v1.1928 HAMP Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313
Prepair 1000+ v1.1927 HAMP Zornitza Stark Publications for gene: HAMP were set to
Prepair 1000+ v1.1926 HADH Zornitza Stark Marked gene: HADH as ready
Prepair 1000+ v1.1926 HADH Zornitza Stark Gene: hadh has been classified as Green List (High Evidence).
Prepair 1000+ v1.1926 HADH Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530
Prepair 1000+ v1.1925 HADH Zornitza Stark Publications for gene: HADH were set to
Prepair 1000+ v1.1924 GM2A Zornitza Stark Marked gene: GM2A as ready
Prepair 1000+ v1.1924 GM2A Zornitza Stark Gene: gm2a has been classified as Green List (High Evidence).
Prepair 1000+ v1.1924 GM2A Zornitza Stark Phenotypes for gene: GM2A were changed from GM2-gangliosidosis, AB variant, 272750 (3) to GM2-gangliosidosis, AB variant MIM #272750
Prepair 1000+ v1.1923 GM2A Zornitza Stark Publications for gene: GM2A were set to
Prepair 1000+ v1.1922 GLDN Zornitza Stark Marked gene: GLDN as ready
Prepair 1000+ v1.1922 GLDN Zornitza Stark Gene: gldn has been classified as Green List (High Evidence).
Prepair 1000+ v1.1922 GLDN Zornitza Stark Phenotypes for gene: GLDN were changed from Lethal congenital contracture syndrome 11, 617194 (3), Autosomal recessive to Lethal congenital contracture syndrome 11 MIM#617194
Prepair 1000+ v1.1921 GLDN Zornitza Stark Publications for gene: GLDN were set to
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Marked gene: FYCO1 as ready
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Gene: fyco1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1920 FYCO1 Zornitza Stark Phenotypes for gene: FYCO1 were changed from Cataract 18, autosomal recessive, 610019 (3) to Cataract 18, MIM#610019
Prepair 1000+ v1.1919 FYCO1 Zornitza Stark reviewed gene: FYCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cataract 18, MIM#610019; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Marked gene: FTSJ1 as ready
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1919 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549
Prepair 1000+ v1.1918 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1917 FRAS1 Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000
Prepair 1000+ v1.1916 FRAS1 Zornitza Stark Publications for gene: FRAS1 were set to
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Marked gene: FLAD1 as ready
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Gene: flad1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1915 FLAD1 Zornitza Stark Phenotypes for gene: FLAD1 were changed from Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency, 255100 (3), Autosomal recessive to Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100
Prepair 1000+ v1.1914 FLAD1 Zornitza Stark Publications for gene: FLAD1 were set to
Prepair 1000+ v1.1913 FLAD1 Zornitza Stark reviewed gene: FLAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34454814, 34718578, 31392824, 30982706, 30311138, 30427553, 28433476, 27259049, 25058219; Phenotypes: Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Marked gene: FKBP14 as ready
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Gene: fkbp14 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1913 FKBP14 Zornitza Stark Phenotypes for gene: FKBP14 were changed from Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss, 614557 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 2 MIM#614557
Prepair 1000+ v1.1912 FKBP14 Zornitza Stark Publications for gene: FKBP14 were set to
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Marked gene: FHL1 as ready
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1911 FHL1 Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680
Prepair 1000+ v1.1910 FHL1 Zornitza Stark Publications for gene: FHL1 were set to
Prepair 1000+ v1.1909 FHL1 Zornitza Stark Mode of inheritance for gene: FHL1 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Marked gene: FGD4 as ready
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Gene: fgd4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1908 FGD4 Zornitza Stark Phenotypes for gene: FGD4 were changed from Charcot-Marie-Tooth disease, type 4H, 609311 (3) to Charcot-Marie-Tooth disease, type 4H MIM#609311; Charcot-Marie-Tooth disease MONDO:0015626
Prepair 1000+ v1.1907 FGD4 Zornitza Stark Publications for gene: FGD4 were set to
Prepair 1000+ v1.1906 FANCL Zornitza Stark Marked gene: FANCL as ready
Prepair 1000+ v1.1906 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Prepair 1000+ v1.1906 FANCL Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083
Prepair 1000+ v1.1905 FANCL Zornitza Stark Publications for gene: FANCL were set to
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Marked gene: FANCD2 as ready
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1904 FANCD2 Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2 MIM#227646
Prepair 1000+ v1.1903 FANCD2 Zornitza Stark Publications for gene: FANCD2 were set to
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Marked gene: ERCC4 as ready
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1902 ERCC4 Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590
Prepair 1000+ v1.1901 ERCC4 Zornitza Stark reviewed gene: ERCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108, Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215, XFE progeroid syndrome, MIM# 610965 MONDO:0012590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1901 DOLK Zornitza Stark Marked gene: DOLK as ready
Prepair 1000+ v1.1901 DOLK Zornitza Stark Gene: dolk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1901 DOLK Zornitza Stark Phenotypes for gene: DOLK were changed from Congenital disorder of glycosylation, type Im, 610768 (3) to Congenital disorder of glycosylation, type Im, MIM# 610768
Prepair 1000+ v1.1900 DOLK Zornitza Stark Publications for gene: DOLK were set to
Prepair 1000+ v1.1899 DOLK Zornitza Stark reviewed gene: DOLK: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273964, 22242004, 23890587, 30653653, 28816422, 24144945; Phenotypes: Congenital disorder of glycosylation, type Im, MIM# 610768; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Marked gene: COL11A2 as ready
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Added comment: Comment when marking as ready: Deafness currently out of scope for this panel.
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1899 COL11A2 Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Fibrochondrogenesis 2 MIM#614524
Prepair 1000+ v1.1898 COL11A2 Zornitza Stark Publications for gene: COL11A2 were set to
Prepair 1000+ v1.1897 AGK Zornitza Stark Marked gene: AGK as ready
Prepair 1000+ v1.1897 AGK Zornitza Stark Gene: agk has been classified as Green List (High Evidence).
Prepair 1000+ v1.1897 AGK Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350
Prepair 1000+ v1.1896 AGK Zornitza Stark reviewed gene: AGK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sengers syndrome, MIM#212350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2481 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164; Cranioectodermal dysplasia 5, MIM# 621180
Mendeliome v1.2480 IFT140 Zornitza Stark Publications for gene: IFT140 were set to 34890546; 22503633; 23418020; 28288023; 28724397; 26216056; 26968735
Mendeliome v1.2479 IFT140 Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 32007091, 35873489, 37628605; Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164, Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.66 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.65 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180
Ciliopathies v1.64 IFT140 Zornitza Stark Publications for gene: IFT140 were set to 22503633; 23418020; 28288023; 28724397; 26216056; 26968735; 34890546
Ciliopathies v1.63 IFT140 Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 34890546, 32007091, 35873489, 37628605; Changed phenotypes: Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant, Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, Cranioectodermal dysplasia 5, MIM# 621180
Genetic Epilepsy v1.126 USP25 Sangavi Sivagnanasundram reviewed gene: USP25: Rating: AMBER; Mode of pathogenicity: Other; Publications: 38875478; Phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2479 USP25 Sangavi Sivagnanasundram edited their review of gene: USP25: Added comment: This gene-disease association has been DISPUTED by ClinGen Epilepsy GCEP on 01/04/2025 - https://search.clinicalgenome.org/CCID:008786

ClinGen's reason for disuputed classification - "Case-level data was not considered strong enough to score. Functional data was not consistent among the variants and was difficult to interpret in relationship to a seizure phenotype. The knock-out mouse model did not exhibit spontaneous seizures so was not scored."

Downgrade to Amber due to the uncertainty was agreed within the user group.; Changed rating: AMBER; Changed phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027)
Additional findings_Adult v1.127 MEFV Zornitza Stark Marked gene: MEFV as ready
Additional findings_Adult v1.127 MEFV Zornitza Stark Gene: mefv has been classified as Green List (High Evidence).
Additional findings_Adult v1.127 MEFV Zornitza Stark Classified gene: MEFV as Green List (high evidence)
Additional findings_Adult v1.127 MEFV Zornitza Stark Gene: mefv has been classified as Green List (High Evidence).
Additional findings_Adult v1.126 MEFV Zornitza Stark gene: MEFV was added
gene: MEFV was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: MEFV was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: MEFV were set to Familial Mediterranean fever MIM#134610; Familial Mediterranean fever MIM#249100
Review for gene: MEFV was set to GREEN
Added comment: Diagnosis can be delayed. Treatment with colchicine. Inheritance is generally recessive but a defined list of variants have been shown to cause dominant disease (list available).
Sources: Expert Review
Additional findings_Adult v1.125 FLCN Zornitza Stark Marked gene: FLCN as ready
Additional findings_Adult v1.125 FLCN Zornitza Stark Gene: flcn has been classified as Green List (High Evidence).
Additional findings_Adult v1.125 JUP Zornitza Stark Marked gene: JUP as ready
Additional findings_Adult v1.125 JUP Zornitza Stark Gene: jup has been classified as Green List (High Evidence).
Additional findings_Adult v1.125 JUP Zornitza Stark Classified gene: JUP as Green List (high evidence)
Additional findings_Adult v1.125 JUP Zornitza Stark Gene: jup has been classified as Green List (High Evidence).
Additional findings_Adult v1.124 JUP Zornitza Stark gene: JUP was added
gene: JUP was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: JUP was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Phenotypes for gene: JUP were set to Arrhythmogenic right ventricular dysplasia 12 MIM# 611528; Naxos disease MIM# 601214
Review for gene: JUP was set to GREEN
Added comment: MODERATE actionability by ClinGen.

Cardiology assessment to guide decisions about medical/surgical intervention.
Sources: Expert list
Additional findings_Adult v1.123 TECRL Zornitza Stark Marked gene: TECRL as ready
Additional findings_Adult v1.123 TECRL Zornitza Stark Gene: tecrl has been classified as Green List (High Evidence).
Additional findings_Adult v1.123 TECRL Zornitza Stark Classified gene: TECRL as Green List (high evidence)
Additional findings_Adult v1.123 TECRL Zornitza Stark Gene: tecrl has been classified as Green List (High Evidence).
Additional findings_Adult v1.122 TECRL Zornitza Stark gene: TECRL was added
gene: TECRL was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: TECRL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TECRL were set to Ventricular tachycardia, catecholaminergic polymorphic, 3, MIM# 614021
Review for gene: TECRL was set to GREEN
Added comment: STRONG actionability by ClinGen in adults.

Cardiology surveillance with consideration of medical and surgical treatment (beta blockers and ICD).
Sources: Expert Review
Additional findings_Adult v1.121 CALM3 Zornitza Stark Marked gene: CALM3 as ready
Additional findings_Adult v1.121 CALM3 Zornitza Stark Gene: calm3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.121 CALM3 Zornitza Stark Classified gene: CALM3 as Green List (high evidence)
Additional findings_Adult v1.121 CALM3 Zornitza Stark Gene: calm3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.120 CALM3 Zornitza Stark gene: CALM3 was added
gene: CALM3 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CALM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CALM3 were set to Ventricular tachycardia, catecholaminergic polymorphic 6, MIM# 618782; Long QT syndrome 16, MIM# 618782
Review for gene: CALM3 was set to GREEN
Added comment: MODERATE actionability in adults by ClinGen.

Cardiology surveillance and consideration of medical and surgical treatment (beta blockers and ICD for CPVT).
Sources: Expert list
Additional findings_Adult v1.119 CALM2 Zornitza Stark Marked gene: CALM2 as ready
Additional findings_Adult v1.119 CALM2 Zornitza Stark Gene: calm2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.119 CALM2 Zornitza Stark Classified gene: CALM2 as Green List (high evidence)
Additional findings_Adult v1.119 CALM2 Zornitza Stark Gene: calm2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.118 CALM2 Zornitza Stark gene: CALM2 was added
gene: CALM2 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CALM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CALM2 were set to Catecholaminergic polymorphic ventricular tachycardia MONDO:0017990; Long QT syndrome 15 616249
Review for gene: CALM2 was set to GREEN
Added comment: MODERATE actionability by ClinGen.

Cardiac surveillance with consideration for medical and surgical treatment (beta blockers, ICD for CPVT).
Sources: Expert list
Additional findings_Adult v1.117 CALM1 Zornitza Stark changed review comment from: MODERATE actionability by ClinGen in adults.

Cardiac surveillance recommended with consideration for medical and if required, surgical intervention (beta-blockers, ICD).
Sources: Expert list; to: MODERATE actionability by ClinGen in adults.

Cardiac surveillance recommended with consideration for medical and if required, surgical intervention (beta-blockers, ICD for CPVT).
Sources: Expert list
Additional findings_Adult v1.117 CALM1 Zornitza Stark Marked gene: CALM1 as ready
Additional findings_Adult v1.117 CALM1 Zornitza Stark Gene: calm1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.117 CALM1 Zornitza Stark Classified gene: CALM1 as Green List (high evidence)
Additional findings_Adult v1.117 CALM1 Zornitza Stark Gene: calm1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.116 CALM1 Zornitza Stark gene: CALM1 was added
gene: CALM1 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CALM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CALM1 were set to Ventricular tachycardia, catecholaminergic polymorphic, 4 614916; Long QT syndrome 14, MIM# 616247
Review for gene: CALM1 was set to GREEN
Added comment: MODERATE actionability by ClinGen in adults.

Cardiac surveillance recommended with consideration for medical and if required, surgical intervention (beta-blockers, ICD).
Sources: Expert list
Additional findings_Adult v1.115 PRKAR1A Zornitza Stark Marked gene: PRKAR1A as ready
Additional findings_Adult v1.115 PRKAR1A Zornitza Stark Gene: prkar1a has been classified as Green List (High Evidence).
Additional findings_Adult v1.115 PRKAR1A Zornitza Stark Classified gene: PRKAR1A as Green List (high evidence)
Additional findings_Adult v1.115 PRKAR1A Zornitza Stark Gene: prkar1a has been classified as Green List (High Evidence).
Additional findings_Adult v1.114 PRKAR1A Zornitza Stark gene: PRKAR1A was added
gene: PRKAR1A was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: PRKAR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKAR1A were set to Carney complex, type 1, MIM# 160980
Review for gene: PRKAR1A was set to GREEN
Added comment: MODERATE actionability by ClinGen in adults.

Risk of sudden death due to cardiac myxomas -- surveillance warranted to facilitate timely excision. Surveillance for testicular tumors, acromegaly, and thyroid lesions is also recommended.
Sources: Expert list
Additional findings_Adult v1.113 SLX4 Zornitza Stark Marked gene: SLX4 as ready
Additional findings_Adult v1.113 SLX4 Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.113 SLX4 Zornitza Stark Classified gene: SLX4 as Green List (high evidence)
Additional findings_Adult v1.113 SLX4 Zornitza Stark Gene: slx4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.112 SLX4 Zornitza Stark gene: SLX4 was added
gene: SLX4 was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: SLX4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLX4 were set to Fanconi anaemia, complementation group P, MIM# 613951
Review for gene: SLX4 was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, SLX4 included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.111 RAD51C Zornitza Stark Marked gene: RAD51C as ready
Additional findings_Adult v1.111 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Additional findings_Adult v1.111 RAD51C Zornitza Stark Phenotypes for gene: RAD51C were changed from Fanconi anemia, complementation group O, MIM# 613390 to Fanconi anaemia, complementation group O, MIM# 613390
Additional findings_Adult v1.110 RAD51C Zornitza Stark Classified gene: RAD51C as Green List (high evidence)
Additional findings_Adult v1.110 RAD51C Zornitza Stark Gene: rad51c has been classified as Green List (High Evidence).
Additional findings_Adult v1.109 RAD51C Zornitza Stark gene: RAD51C was added
gene: RAD51C was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: RAD51C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAD51C were set to Fanconi anemia, complementation group O, MIM# 613390
Review for gene: RAD51C was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, RAD51C included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.108 FANCL Zornitza Stark Marked gene: FANCL as ready
Additional findings_Adult v1.108 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Additional findings_Adult v1.108 FANCL Zornitza Stark Classified gene: FANCL as Green List (high evidence)
Additional findings_Adult v1.108 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Additional findings_Adult v1.107 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCL were set to Fanconi anaemia, complementation group L, MIM# 614083
Review for gene: FANCL was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, FANCL included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.106 FANCI Zornitza Stark Marked gene: FANCI as ready
Additional findings_Adult v1.106 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Additional findings_Adult v1.106 FANCI Zornitza Stark Phenotypes for gene: FANCI were changed from Fanconi anemia, complementation group I, MIM# 609053 to Fanconi anaemia, complementation group I, MIM# 609053
Additional findings_Adult v1.105 FANCI Zornitza Stark Classified gene: FANCI as Green List (high evidence)
Additional findings_Adult v1.105 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Additional findings_Adult v1.104 FANCI Zornitza Stark gene: FANCI was added
gene: FANCI was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCI were set to Fanconi anemia, complementation group I, MIM# 609053
Review for gene: FANCI was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen; FANCI included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.103 FANCF Zornitza Stark Marked gene: FANCF as ready
Additional findings_Adult v1.103 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Additional findings_Adult v1.103 FANCF Zornitza Stark Classified gene: FANCF as Green List (high evidence)
Additional findings_Adult v1.103 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Additional findings_Adult v1.102 FANCF Zornitza Stark gene: FANCF was added
gene: FANCF was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCF were set to Fanconi anaemia, complementation group F 603467
Review for gene: FANCF was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, FANCF included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by a haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.101 FANCE Zornitza Stark Marked gene: FANCE as ready
Additional findings_Adult v1.101 FANCE Zornitza Stark Gene: fance has been classified as Green List (High Evidence).
Additional findings_Adult v1.101 FANCE Zornitza Stark Classified gene: FANCE as Green List (high evidence)
Additional findings_Adult v1.101 FANCE Zornitza Stark Gene: fance has been classified as Green List (High Evidence).
Additional findings_Adult v1.100 FANCE Zornitza Stark gene: FANCE was added
gene: FANCE was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCE were set to Fanconi anaemia, complementation group E, MIM# 600901
Review for gene: FANCE was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, FANCE included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by a haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.99 FANCD2 Zornitza Stark Marked gene: FANCD2 as ready
Additional findings_Adult v1.99 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.99 FANCD2 Zornitza Stark Classified gene: FANCD2 as Green List (high evidence)
Additional findings_Adult v1.99 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.98 FANCD2 Zornitza Stark gene: FANCD2 was added
gene: FANCD2 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCD2 were set to Fanconi anaemia, complementation group D2, MIM# 227646
Review for gene: FANCD2 was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, FANCD2 included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by a haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.97 FANCB Zornitza Stark Marked gene: FANCB as ready
Additional findings_Adult v1.97 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Additional findings_Adult v1.97 FANCB Zornitza Stark Classified gene: FANCB as Green List (high evidence)
Additional findings_Adult v1.97 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Additional findings_Adult v1.96 FANCB Zornitza Stark gene: FANCB was added
gene: FANCB was added to Additional findings_Adult. Sources: Expert Review
Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FANCB were set to Fanconi anaemia, complementation group B, MIM# 300514
Review for gene: FANCB was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, FANCB included for completeness.

In the absence of congenital anomalies, FA can present with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert Review
Additional findings_Adult v1.95 ERCC4 Zornitza Stark Marked gene: ERCC4 as ready
Additional findings_Adult v1.95 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.95 ERCC4 Zornitza Stark Classified gene: ERCC4 as Green List (high evidence)
Additional findings_Adult v1.95 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.94 ERCC4 Zornitza Stark gene: ERCC4 was added
gene: ERCC4 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC4 were set to Fanconi anaemia, complementation group Q, MIM# 615272
Review for gene: ERCC4 was set to GREEN
Added comment: Other FA genes assessed as MODERATE actionability by ClinGen, ERCC4 included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.93 BRCA1 Zornitza Stark Phenotypes for gene: BRCA1 were changed from Breast-ovarian cancer, familial, 1, MIM# 604370 to Breast-ovarian cancer, familial, 1, MIM# 604370; Fanconi anaemia, complementation group S, MIM# 617883
Additional findings_Adult v1.92 BRCA1 Zornitza Stark Mode of inheritance for gene: BRCA1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Additional findings_Adult v1.91 BRCA1 Zornitza Stark edited their review of gene: BRCA1: Added comment: Association between biallelic variants and FA: other FA genes assessed as MODERATE actionability by ClinGen. BRCA1 included for completeness.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by a haematologist is warranted to optimise timing of BMT.; Changed phenotypes: Breast-ovarian cancer, familial, 1, MIM# 604370, Fanconi anaemia, complementation group S, MIM# 617883; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Additional findings_Adult v1.91 PALB2 Zornitza Stark Phenotypes for gene: PALB2 were changed from {Breast cancer, susceptibility to} 114480 to {Breast cancer, susceptibility to} 114480; Fanconi anaemia, complementation group N, MIM# 610832
Additional findings_Adult v1.90 PALB2 Zornitza Stark Mode of inheritance for gene: PALB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Additional findings_Adult v1.89 PALB2 Zornitza Stark edited their review of gene: PALB2: Added comment: Association between biallelic variants and FA: MODERATE actionability by ClinGen.

In the absence of congenital anomalies, presentation can be in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.; Changed phenotypes: {Breast cancer, susceptibility to} 114480, Fanconi anaemia, complementation group N, MIM# 610832; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Additional findings_Adult v1.89 FANCC Zornitza Stark Marked gene: FANCC as ready
Additional findings_Adult v1.89 FANCC Zornitza Stark Gene: fancc has been classified as Green List (High Evidence).
Additional findings_Adult v1.89 FANCC Zornitza Stark Classified gene: FANCC as Green List (high evidence)
Additional findings_Adult v1.89 FANCC Zornitza Stark Gene: fancc has been classified as Green List (High Evidence).
Additional findings_Adult v1.88 FANCC Zornitza Stark gene: FANCC was added
gene: FANCC was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCC were set to Fanconi anemia, complementation group C, MIM# 227645
Review for gene: FANCC was set to GREEN
Added comment: MODERATE actionability by ClinGen.

In the absence of congenital anomalies, presentation can be with BMF in adulthood and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.87 BRIP1 Zornitza Stark Marked gene: BRIP1 as ready
Additional findings_Adult v1.87 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.87 BRIP1 Zornitza Stark Classified gene: BRIP1 as Green List (high evidence)
Additional findings_Adult v1.87 BRIP1 Zornitza Stark Gene: brip1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.86 BRIP1 Zornitza Stark gene: BRIP1 was added
gene: BRIP1 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: BRIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRIP1 were set to Fanconi anaemia, complementation group J, MIM# 609054
Review for gene: BRIP1 was set to GREEN
Added comment: MODERATE actionability by ClinGen.

In the absence of congenital anomalies, presentation can be in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.85 FANCG Zornitza Stark Marked gene: FANCG as ready
Additional findings_Adult v1.85 FANCG Zornitza Stark Gene: fancg has been classified as Green List (High Evidence).
Additional findings_Adult v1.85 FANCG Zornitza Stark Classified gene: FANCG as Green List (high evidence)
Additional findings_Adult v1.85 FANCG Zornitza Stark Gene: fancg has been classified as Green List (High Evidence).
Additional findings_Adult v1.84 FANCG Zornitza Stark gene: FANCG was added
gene: FANCG was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCG were set to Fanconi anaemia, complementation group G, MIM# 614082
Review for gene: FANCG was set to GREEN
Added comment: MODERATE actionability by ClinGen.

In the absence of congenital anomalies, can present in adulthood with BMF and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.83 FANCA Zornitza Stark Marked gene: FANCA as ready
Additional findings_Adult v1.83 FANCA Zornitza Stark Gene: fanca has been classified as Green List (High Evidence).
Additional findings_Adult v1.83 FANCA Zornitza Stark Classified gene: FANCA as Green List (high evidence)
Additional findings_Adult v1.83 FANCA Zornitza Stark Gene: fanca has been classified as Green List (High Evidence).
Additional findings_Adult v1.82 FANCA Zornitza Stark gene: FANCA was added
gene: FANCA was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCA were set to Fanconi anaemia, complementation group A, MIM# 227650
Review for gene: FANCA was set to GREEN
Added comment: MODERATE actionability by ClinGen.

In the absence of congenital anomalies, presentation can be with BMF in adulthood and surveillance by haematologist is warranted to optimise timing of BMT.
Sources: Expert list
Additional findings_Adult v1.81 BRCA2 Zornitza Stark Phenotypes for gene: BRCA2 were changed from Breast-ovarian cancer, familial, 2, MIM#612555 to Breast-ovarian cancer, familial, 2, MIM#612555; Fanconi anaemia, complementation group D1, MIM# 605724
Additional findings_Adult v1.80 BRCA2 Zornitza Stark Mode of inheritance for gene: BRCA2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Additional findings_Adult v1.79 BRCA2 Zornitza Stark edited their review of gene: BRCA2: Added comment: Association between biallelic variants and FA: MODERATE actionability by ClinGen.

In the absence of congenital anomalies can present with BMF in adulthood and surveillance by haematologist is warranted to optimise timing of BMT.; Changed phenotypes: Breast-ovarian cancer, familial, 2, MIM#612555, Fanconi anaemia, complementation group D1, MIM# 605724; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2479 FOXM1 Achchuthan Shanmugasundram gene: FOXM1 was added
gene: FOXM1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: FOXM1 were set to 38969938
Phenotypes for gene: FOXM1 were set to Moyamoya disease, MONDO:0016820
Review for gene: FOXM1 was set to AMBER
Added comment: PMID:38969938 reported a 60-year-old father and 31-year-old daughter with unilateral Moyamoya Disease and with c.1205 C > A variant in FOXM1 gene (p.(Ala402Glu). There is also functional evidence available for the identified variant from the publication. This gene should be rated amber with current evidence.
Sources: Literature
Additional findings_Adult v1.79 ITGA2B Zornitza Stark Marked gene: ITGA2B as ready
Additional findings_Adult v1.79 ITGA2B Zornitza Stark Gene: itga2b has been classified as Green List (High Evidence).
Additional findings_Adult v1.79 ITGA2B Zornitza Stark Classified gene: ITGA2B as Green List (high evidence)
Additional findings_Adult v1.79 ITGA2B Zornitza Stark Gene: itga2b has been classified as Green List (High Evidence).
Additional findings_Adult v1.78 ITGA2B Zornitza Stark gene: ITGA2B was added
gene: ITGA2B was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: ITGA2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA2B were set to Glanzmann thrombasthaenia 1, MIM# 273800
Review for gene: ITGA2B was set to GREEN
Added comment: STRONG actionability by ClinGen.

GT is a moderate to severe haemorrhagic disorder characterized by spontaneous mucocutaneous bleeding and an exaggerated response to trauma or surgical procedures due to defective platelet aggregation. Purpura, easy bruising, epistaxis, gingival bleeding and menorrhagia are the most common clinical features. Presentation is typically in infancy but severity can be variable.

A range of treatments available depending on severity as guided by specialist haematological services.
Sources: Expert list
Additional findings_Adult v1.77 ITGB3 Zornitza Stark Marked gene: ITGB3 as ready
Additional findings_Adult v1.77 ITGB3 Zornitza Stark Gene: itgb3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.77 ITGB3 Zornitza Stark Classified gene: ITGB3 as Green List (high evidence)
Additional findings_Adult v1.77 ITGB3 Zornitza Stark Gene: itgb3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.76 ITGB3 Zornitza Stark gene: ITGB3 was added
gene: ITGB3 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: ITGB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ITGB3 were set to Bleeding disorder, platelet-type, 24, MIM#619271
Review for gene: ITGB3 was set to GREEN
Added comment: STRONG actionability by ClinGen.

GT is a moderate to severe haemorrhagic disorder characterized by spontaneous mucocutaneous bleeding and an exaggerated response to trauma or surgical procedures due to defective platelet aggregation. Purpura, easy bruising, epistaxis, gingival bleeding and menorrhagia are the most common clinical features. Presentation is typically in infancy but severity can be variable.

A range of treatments available depending on severity as guided by specialist haematological services.
Sources: Expert list
Additional findings_Adult v1.75 OAT Zornitza Stark Marked gene: OAT as ready
Additional findings_Adult v1.75 OAT Zornitza Stark Gene: oat has been classified as Green List (High Evidence).
Additional findings_Adult v1.75 OAT Zornitza Stark Classified gene: OAT as Green List (high evidence)
Additional findings_Adult v1.75 OAT Zornitza Stark Gene: oat has been classified as Green List (High Evidence).
Additional findings_Adult v1.74 OAT Zornitza Stark gene: OAT was added
gene: OAT was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: OAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OAT were set to Gyrate atrophy of choroid and retina with or without ornithinemia MIM#258870
Review for gene: OAT was set to GREEN
Added comment: MODERATE actionability by ClinGen.

The condition is characterized by the development of chorioretinal atrophic patches that start in the mid-peripheral retina in the first decade of life. Myopia, night blindness, changes in the macula (including cystic changes), and visual field affection usually start in the first or second decade. Most patients with GA have posterior subcapsular cataracts by the end of the second decade. Irreversible loss of vision and blindness generally occurs between 40 and 55 years of age but is highly variable.

Treatment of GA consists mainly of dietary modifications to help lower elevated systemic ornithine levels. Restriction of dietary arginine, a precursor of ornithine, appears to have therapeutic value.
Sources: Expert list
Additional findings_Adult v1.73 PHYH Zornitza Stark Marked gene: PHYH as ready
Additional findings_Adult v1.73 PHYH Zornitza Stark Gene: phyh has been classified as Green List (High Evidence).
Additional findings_Adult v1.73 PHYH Zornitza Stark Classified gene: PHYH as Green List (high evidence)
Additional findings_Adult v1.73 PHYH Zornitza Stark Gene: phyh has been classified as Green List (High Evidence).
Additional findings_Adult v1.72 PHYH Zornitza Stark gene: PHYH was added
gene: PHYH was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: PHYH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHYH were set to Refsum disease, MIM# 266500
Review for gene: PHYH was set to GREEN
Added comment: MODERATE actionability by ClinGen.

Adult forms described. RD is clinically characterized by anosmia (absence of smell) and early-onset retinitis pigmentosa (RP), which are both universal findings with variable combinations of peripheral neuropathy, cerebellar ataxia, deafness, ichthyosis, and short metatarsals and metacarpals.

Treatment for many manifestations of RD are supportive: hydrating creams for ichthyosis, drugs for cardiac arrhythmias and cardiomyopathy, cataract surgery, and implantation of cochlear implants.

The standard therapy for prevention of primary manifestations is to lower plasma phytanic acid (PA) levels by dietary restriction of PA. For acute care or when diet is not sufficient, PA may be eliminated by plasmapheresis or lipid apheresis. These therapies have been found to reduce plasma PA concentrations by 50-70%, and possibly stabilize or improve symptoms of ichthyosis, sensory neuropathy, ataxia, improve cardiac arrhythmia, and extreme weakness. It is uncertain whether either treatment affects the progression of the anosmia, deafness, or RP and other ocular outcomes.
Sources: Expert list
Additional findings_Adult v1.71 PIK3R1 Zornitza Stark Marked gene: PIK3R1 as ready
Additional findings_Adult v1.71 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.71 PIK3R1 Zornitza Stark Classified gene: PIK3R1 as Green List (high evidence)
Additional findings_Adult v1.71 PIK3R1 Zornitza Stark Gene: pik3r1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.70 PIK3R1 Zornitza Stark gene: PIK3R1 was added
gene: PIK3R1 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: PIK3R1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PIK3R1 were set to SHORT syndrome, MIM# 269880
Review for gene: PIK3R1 was set to GREEN
Added comment: MODERATE actionability in adults by ClinGen.

Many features manifest in infancy/childhood but diagnosis may be delayed. Insulin resistance has a highly variable age at diagnosis ranging from 7-49 years. Though insulin resistance may be evident in mid-childhood or adolescence, diabetes mellitus typically does not develop until early adulthood.
Sources: Expert list
Additional findings_Adult v1.69 CPT2 Zornitza Stark Marked gene: CPT2 as ready
Additional findings_Adult v1.69 CPT2 Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.69 CPT2 Zornitza Stark Classified gene: CPT2 as Green List (high evidence)
Additional findings_Adult v1.69 CPT2 Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence).
Additional findings_Adult v1.68 CPT2 Zornitza Stark gene: CPT2 was added
gene: CPT2 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CPT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CPT2 were set to CPT II deficiency, myopathic, stress-induced, MIM# 255110
Review for gene: CPT2 was set to GREEN
Added comment: Variable age of onset and severity. Adult form tends to be myopathic.

The recommendation for treatment of CPT II deficiency is to follow current treatment for long-chain FAO disorders:
- Reduce the amount of long-chain dietary fat (<20%) while covering the need for essential fatty acids
- Provide carnitine to convert potentially toxic long-chain acyl-CoAs to acylcarnitines
- Provide a large fraction of calories as carbohydrates (70%) to reduce body fat utilization and prevent hypoglycaemia
- Provide approximately one third of calories as even-chain medium chain triglycerides (MCT)
Sources: Expert list
Additional findings_Adult v1.67 F7 Zornitza Stark Marked gene: F7 as ready
Additional findings_Adult v1.67 F7 Zornitza Stark Gene: f7 has been classified as Green List (High Evidence).
Additional findings_Adult v1.67 F7 Zornitza Stark Classified gene: F7 as Green List (high evidence)
Additional findings_Adult v1.67 F7 Zornitza Stark Gene: f7 has been classified as Green List (High Evidence).
Additional findings_Adult v1.66 F7 Zornitza Stark gene: F7 was added
gene: F7 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: F7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: F7 were set to Factor VII deficiency, MIM# 227500
Review for gene: F7 was set to GREEN
Added comment: STRONG actionability by ClinGen.

Measurement of Factor VII levels available and guide management. Therapeutic options include administration of recombinant activated factor VII (rFVIIa), or plasma derived FVII concentrate (if rFVIIa is not available) and through use of antifibrinolytic agents (such as tranexamic acid).
Sources: Expert list
Additional findings_Adult v1.65 RUNX1 Zornitza Stark Marked gene: RUNX1 as ready
Additional findings_Adult v1.65 RUNX1 Zornitza Stark Gene: runx1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.65 RUNX1 Zornitza Stark Classified gene: RUNX1 as Green List (high evidence)
Additional findings_Adult v1.65 RUNX1 Zornitza Stark Gene: runx1 has been classified as Green List (High Evidence).
Additional findings_Adult v1.64 RUNX1 Zornitza Stark gene: RUNX1 was added
gene: RUNX1 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: RUNX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RUNX1 were set to Platelet disorder, familial, with associated myeloid malignancy, MIM# 601399
Review for gene: RUNX1 was set to GREEN
Added comment: MODERATE actionability in adults by ClinGen.

Bleeding tendency and haematological malignancies with variable age of onset. Mostly based on expert opinion, regular evaluation of haematological indices by a haematologist is recommended, with consideration given to optimal timing of BMT.
Sources: Expert list
Additional findings_Adult v1.63 SDHA Zornitza Stark Marked gene: SDHA as ready
Additional findings_Adult v1.63 SDHA Zornitza Stark Gene: sdha has been classified as Green List (High Evidence).
Additional findings_Adult v1.63 SDHA Zornitza Stark Classified gene: SDHA as Green List (high evidence)
Additional findings_Adult v1.63 SDHA Zornitza Stark Gene: sdha has been classified as Green List (High Evidence).
Additional findings_Adult v1.62 SDHA Zornitza Stark gene: SDHA was added
gene: SDHA was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: SDHA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHA were set to Paragangliomas 5 , MIM#614165
Review for gene: SDHA was set to GREEN
Added comment: MODERATE actionability by ClinGen.

Lifelong biochemical and clinical surveillance for paragangliomas recommended.
Sources: Expert list
Additional findings_Adult v1.61 CP Zornitza Stark Marked gene: CP as ready
Additional findings_Adult v1.61 CP Zornitza Stark Gene: cp has been classified as Green List (High Evidence).
Additional findings_Adult v1.61 CP Zornitza Stark Classified gene: CP as Green List (high evidence)
Additional findings_Adult v1.61 CP Zornitza Stark Gene: cp has been classified as Green List (High Evidence).
Additional findings_Adult v1.60 CP Zornitza Stark gene: CP was added
gene: CP was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CP were set to Aceruloplasminaemia, MIM#604290
Review for gene: CP was set to GREEN
Added comment: Progressive disorder of iron accumulation in the brain and viscera. Potentially amenable to treatment with iron chelating agents.

MODERATE actionability by ClinGen.
Sources: Expert list
Additional findings_Adult v1.59 COL4A4 Zornitza Stark Marked gene: COL4A4 as ready
Additional findings_Adult v1.59 COL4A4 Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.59 COL4A4 Zornitza Stark Classified gene: COL4A4 as Green List (high evidence)
Additional findings_Adult v1.59 COL4A4 Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence).
Additional findings_Adult v1.58 COL4A4 Zornitza Stark gene: COL4A4 was added
gene: COL4A4 was added to Additional findings_Adult. Sources: Literature
Mode of inheritance for gene: COL4A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL4A4 were set to Alport syndrome 2, autosomal recessive, MIM#203780
Review for gene: COL4A4 was set to GREEN
Added comment: STRONG actionability by ClinGen.

Although heterozygous variants can cause disease, this is typically milder, later-onset and of variable penetrance/expressivity so less suited to population screening.

Screen for biallelic disease only at the moment. Referrals to renal, ophthalmology and audiology recommended.
Sources: Literature
Additional findings_Adult v1.57 COL4A3 Zornitza Stark Marked gene: COL4A3 as ready
Additional findings_Adult v1.57 COL4A3 Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.57 COL4A3 Zornitza Stark Classified gene: COL4A3 as Green List (high evidence)
Additional findings_Adult v1.57 COL4A3 Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence).
Additional findings_Adult v1.56 COL4A3 Zornitza Stark gene: COL4A3 was added
gene: COL4A3 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: COL4A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL4A3 were set to Alport syndrome 2, autosomal recessive, MIM# 203780
Review for gene: COL4A3 was set to GREEN
Added comment: STRONG actionability by ClinGen.

Although heterozygous variants can cause disease, this is typically milder, later-onset and of variable penetrance/expressivity so less suited to population screening.

Screen for biallelic disease only at the moment. Referrals to renal, ophthalmology and audiology recommended.
Sources: Expert list
Additional findings_Adult v1.55 COL4A5 Zornitza Stark Marked gene: COL4A5 as ready
Additional findings_Adult v1.55 COL4A5 Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence).
Additional findings_Adult v1.55 COL4A5 Zornitza Stark Classified gene: COL4A5 as Green List (high evidence)
Additional findings_Adult v1.55 COL4A5 Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence).
Additional findings_Adult v1.54 COL4A5 Zornitza Stark gene: COL4A5 was added
gene: COL4A5 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: COL4A5 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Phenotypes for gene: COL4A5 were set to Alport syndrome 1, X-linked, MIM# 301050
Review for gene: COL4A5 was set to GREEN
Added comment: STRONG actionability by ClinGen.

Both males and females can be affected, though females show variable expressivity. Genotype-phenotype correlation available with truncating/frameshift variants typically resulting in more severe disease. Referrals to renal, ophthalmology and audiology for surveillance.
Sources: Expert list
Additional findings_Adult v1.53 SLC22A5 Zornitza Stark Marked gene: SLC22A5 as ready
Additional findings_Adult v1.53 SLC22A5 Zornitza Stark Gene: slc22a5 has been classified as Green List (High Evidence).
Additional findings_Adult v1.53 SLC22A5 Zornitza Stark Classified gene: SLC22A5 as Green List (high evidence)
Additional findings_Adult v1.53 SLC22A5 Zornitza Stark Gene: slc22a5 has been classified as Green List (High Evidence).
Additional findings_Adult v1.52 SLC22A5 Zornitza Stark gene: SLC22A5 was added
gene: SLC22A5 was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: SLC22A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC22A5 were set to Carnitine deficiency, systemic primary, MIM# 212140
Review for gene: SLC22A5 was set to GREEN
Added comment: MODERATE actionability in adults by ClinGen.

Adulthood presentation is associated with minor symptoms like fatigue and decreased stamina, but dilated cardiomyopathy and arrhythmias and sudden cardiac death have also been reported.

The main treatment for CDSP is lifelong oral levocarnitine (L-carnitine) supplementation. The benefit of treatment in asymptomatic adults is less well established, but is hoped it may prevent cardiac events and decompensations. Metabolic decompensation and hypoglycaemic episodes are treated with glucose in addition to carnitine supplementation. Referral to cardiology for cardiomyopathy assessment is recommended.
Sources: Expert list
Additional findings_Adult v1.51 CDKN2A Zornitza Stark Marked gene: CDKN2A as ready
Additional findings_Adult v1.51 CDKN2A Zornitza Stark Gene: cdkn2a has been classified as Green List (High Evidence).
Additional findings_Adult v1.51 CDKN2A Zornitza Stark Classified gene: CDKN2A as Green List (high evidence)
Additional findings_Adult v1.51 CDKN2A Zornitza Stark Gene: cdkn2a has been classified as Green List (High Evidence).
Additional findings_Adult v1.50 CDKN2A Zornitza Stark gene: CDKN2A was added
gene: CDKN2A was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CDKN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDKN2A were set to {Melanoma-pancreatic cancer syndrome} MIM#606719
Review for gene: CDKN2A was set to GREEN
Added comment: MODERATE actionability by ClinGen.

Refer to cancer genetics services, surveillance for melanoma and pancreatic cancer available.
Sources: Expert list
Additional findings_Adult v1.49 G6PD Zornitza Stark changed review comment from: Haemolytic crises can be prevented through avoidance of triggering foods, medicines and other chemicals.
Sources: Expert list; to: Haemolytic crises can be prevented through avoidance of triggering foods, medicines and other chemicals.

MODERATE actionability in adults by ClinGen.

Sources: Expert list
Additional findings_Adult v1.49 G6PD Zornitza Stark Marked gene: G6PD as ready
Additional findings_Adult v1.49 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Additional findings_Adult v1.49 G6PD Zornitza Stark Classified gene: G6PD as Green List (high evidence)
Additional findings_Adult v1.49 G6PD Zornitza Stark Gene: g6pd has been classified as Green List (High Evidence).
Additional findings_Adult v1.48 G6PD Zornitza Stark gene: G6PD was added
gene: G6PD was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: G6PD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: G6PD were set to Haemolytic anemia, G6PD deficient (favism), MIM# 300908
Review for gene: G6PD was set to GREEN
Added comment: Haemolytic crises can be prevented through avoidance of triggering foods, medicines and other chemicals.
Sources: Expert list
Additional findings_Adult v1.47 NAGS Zornitza Stark Marked gene: NAGS as ready
Additional findings_Adult v1.47 NAGS Zornitza Stark Gene: nags has been classified as Green List (High Evidence).
Additional findings_Adult v1.47 NAGS Zornitza Stark Classified gene: NAGS as Green List (high evidence)
Additional findings_Adult v1.47 NAGS Zornitza Stark Gene: nags has been classified as Green List (High Evidence).
Additional findings_Adult v1.46 NAGS Zornitza Stark gene: NAGS was added
gene: NAGS was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: NAGS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGS were set to N-acetylglutamate synthase deficiency - MIM#237310
Review for gene: NAGS was set to GREEN
Added comment: Severe deficiency typically presents in infancy but milder deficiency can present at any age. Metabolic decompensation can be triggered by intercurrent illness, fasting, protein loading, pregnancy/delivery. Hyperammonaemic encephalopathy is associated with high mortality rates.

The American College of Medical Genetics and Genomics (ACMG) has developed an ACT sheet to help clinical decision-making during transition to adult health care: https://www.acmg.net/PDFLibrary/Nags-Deficiency-Transition.pdf.

The mainstay of long-term management of NAGSD is treatment with carbamylglutamate (also called carglumic acid or N-carbamyl-L-glutamate), an oral NAGS analogue. Given the risk of acute metabolic decompensation during surgery and general anesthesia, elective surgery should only be carried out in centers able and prepared to deal with hyperammonaemic decompensations. Pregnancies should be managed as high risk. Steroids and valproic acid to be avoided.
Sources: Expert list
Additional findings_Adult v1.45 EPCAM Zornitza Stark Marked gene: EPCAM as ready
Additional findings_Adult v1.45 EPCAM Zornitza Stark Gene: epcam has been classified as Green List (High Evidence).
Additional findings_Adult v1.45 EPCAM Zornitza Stark Classified gene: EPCAM as Green List (high evidence)
Additional findings_Adult v1.45 EPCAM Zornitza Stark Gene: epcam has been classified as Green List (High Evidence).
Additional findings_Adult v1.44 EPCAM Zornitza Stark gene: EPCAM was added
gene: EPCAM was added to Additional findings_Adult. Sources: Expert list
SV/CNV tags were added to gene: EPCAM.
Mode of inheritance for gene: EPCAM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EPCAM were set to Lynch syndrome 8, MONDO:0013196
Mode of pathogenicity for gene: EPCAM was set to Other
Review for gene: EPCAM was set to GREEN
Added comment: DEFINITIVE actionability by ClinGen in adults.

Deletion of 3’end of EPCAM gene leading to epigenetic silencing of adjacent downstream MSH2 gene.
Sources: Expert list
Additional findings_Adult v1.43 FH Zornitza Stark Marked gene: FH as ready
Additional findings_Adult v1.43 FH Zornitza Stark Gene: fh has been classified as Green List (High Evidence).
Additional findings_Adult v1.43 FH Zornitza Stark Classified gene: FH as Green List (high evidence)
Additional findings_Adult v1.43 FH Zornitza Stark Gene: fh has been classified as Green List (High Evidence).
Additional findings_Adult v1.42 FH Zornitza Stark gene: FH was added
gene: FH was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: FH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FH were set to Hereditary leiomyomatosis and renal cell cancer, MONDO:0007888
Review for gene: FH was set to GREEN
Added comment: STRONG actionability in adults by ClinGen.

Referral to cancer genetics service for surveillance for skin, gynaecological and renal manifestations, notably renal cancers.
Sources: Expert list
Additional findings_Adult v1.41 CBS Zornitza Stark Marked gene: CBS as ready
Additional findings_Adult v1.41 CBS Zornitza Stark Gene: cbs has been classified as Green List (High Evidence).
Additional findings_Adult v1.41 CBS Zornitza Stark Classified gene: CBS as Green List (high evidence)
Additional findings_Adult v1.41 CBS Zornitza Stark Gene: cbs has been classified as Green List (High Evidence).
Additional findings_Adult v1.40 CBS Zornitza Stark gene: CBS was added
gene: CBS was added to Additional findings_Adult. Sources: Expert list
Mode of inheritance for gene: CBS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CBS were set to Homocystinuria, B6-responsive and nonresponsive types, MIM# 236200
Review for gene: CBS was set to GREEN
Added comment: MODERATE actionability in adults by ClinGen.

Progressive disorder with variable range of onset of clinical manifestations, including adult presentations. Diagnosis can be delayed. Thromboembolism is the major cause of disability and death. Pregnancy and postpartum period present heightened risk. The aim of treatment is to prevent all complications (early and late) by controlling the elevated total plasma homocysteine (tHcy) concentrations by using one or a combination of treatments. This includes assessment of whether the disorder is pyridoxine-responsive and dietary measures. Betaine and anti-coagulants can be used as adjunct treatments.

For pathogenic variants commonly present in the homozygous state, there are a few well established genotype-phenotype correlations with good concordance between pyridoxine responsiveness and a milder clinical phenotype. For example, one of the most the common variants, c.833T>C (p.I278T), is pan ethnic, accounts for nearly 24% of all pathogenic variants, and when homozygous leads to a mild pyridoxine-responsive type of CBS deficiency.
Sources: Expert list
Hereditary Neuropathy_CMT - isolated v1.52 NARS Chris Ciotta changed review comment from: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of this variant with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature; to: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of these variants with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature
Hereditary Neuropathy_CMT - isolated v1.52 NARS Chris Ciotta gene: NARS was added
gene: NARS was added to Hereditary Neuropathy_CMT - isolated. Sources: Literature
Mode of inheritance for gene: NARS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: NARS were set to PMID: 38495304; 38769024
Phenotypes for gene: NARS were set to Axonal neuropathy; Charcot-Marie-Tooth disease; distal hereditary motor neuropathy
Review for gene: NARS was set to AMBER
Added comment: Three families reported in the literature with heterozygous NARS1 variants and an isolated peripheral neuropathy phenotype, lacking the global developmental delay, seizures and intellectual disability and more seen in the dominant and recessive neurodevelopmental disorder phenotypes listed in OMIM (MIM#619091 and MIM#619092).

Beijer (2024) (PMID: 38495304): Two families with previously unreported missense variants and an isolated neuropathy phenotype. Segregation of this variant with disease also shown. Both missense variants severely reduced yeast growth compared to wildtype in a yeast rescue complementation assay. A mouse model expressing the p.Ser461Phe variant did not show any signs of peripheral neuropathy in mice heterozygous for this variant at multiple time points to 18 months of age.

Theuriet (2024) (PMID: 38769024): A novel missense reported in a French family with distal hereditary motor neuropathy. A mother and two sons all with an isolated phenotype with no seizures or ID. Mother presented in 30s and two sons presented 5 and 3 with toe walking. A yeast model was also done here with this variant allowing for no growth compared to wildtype.
Sources: Literature
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Marked gene: SLC37A4 as ready
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Gene: slc37a4 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1896 SLC37A4 Lilian Downie Phenotypes for gene: SLC37A4 were changed from Glycogen storage disease Ib, 232220 (3) to Glycogen storage disease Ib MIM#232220; Glycogen storage disease Ic MIM#232240; Glycogen Storage Disease I MONDO:0002413
Prepair 1000+ v1.1895 SP110 Lilian Downie Marked gene: SP110 as ready
Prepair 1000+ v1.1895 SP110 Lilian Downie Gene: sp110 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1895 SP110 Lilian Downie Publications for gene: SP110 were set to
Prepair 1000+ v1.1894 SPR Lilian Downie Marked gene: SPR as ready
Prepair 1000+ v1.1894 SPR Lilian Downie Gene: spr has been classified as Green List (High Evidence).
Prepair 1000+ v1.1894 SPR Lilian Downie Phenotypes for gene: SPR were changed from Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, 612716 (3) to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716
Prepair 1000+ v1.1893 SPR Lilian Downie Publications for gene: SPR were set to
Prepair 1000+ v1.1892 STRA6 Lilian Downie Marked gene: STRA6 as ready
Prepair 1000+ v1.1892 STRA6 Lilian Downie Gene: stra6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1892 STRA6 Lilian Downie Phenotypes for gene: STRA6 were changed from Microphthalmia MIM#601186 to Microphthalmia, isolated, with coloboma 8 MIM#601186; Microphthalmia, syndromic 9 MIM#601186
Prepair 1000+ v1.1891 STRA6 Lilian Downie Phenotypes for gene: STRA6 were changed from Microphthalmia, isolated, with coloboma 8, 601186 (3) to Microphthalmia MIM#601186
Mendeliome v1.2479 B3GALT6 Sangavi Sivagnanasundram reviewed gene: B3GALT6: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008674; Phenotypes: B3GALT6-congenital disorder of glycosylation MONDO:0100586; Mode of inheritance: None
Prepair 1000+ v1.1890 STRA6 Lilian Downie Publications for gene: STRA6 were set to
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Marked gene: TRIM32 as ready
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Gene: trim32 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1889 TRIM32 Lilian Downie Phenotypes for gene: TRIM32 were changed from Muscular dystrophy, limb-girdle, type 2H, 254110 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110
Prepair 1000+ v1.1888 TRIM32 Lilian Downie Publications for gene: TRIM32 were set to
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Marked gene: TRPM6 as ready
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Gene: trpm6 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1887 TRPM6 Lilian Downie Publications for gene: TRPM6 were set to
Prepair 1000+ v1.1886 TTI2 Lilian Downie Marked gene: TTI2 as ready
Prepair 1000+ v1.1886 TTI2 Lilian Downie Gene: tti2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1886 TTI2 Lilian Downie Phenotypes for gene: TTI2 were changed from Mental retardation, autosomal recessive 39, 615541 (3) to Intellectual developmental disorder, autosomal recessive 39 MIM#615541
Mendeliome v1.2479 PIK3R5 Sangavi Sivagnanasundram reviewed gene: PIK3R5: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008779; Phenotypes: ataxia with oculomotor apraxia type 3 MONDO:0014084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1885 TTI2 Lilian Downie Publications for gene: TTI2 were set to
Prepair 1000+ v1.1884 TTPA Lilian Downie Marked gene: TTPA as ready
Prepair 1000+ v1.1884 TTPA Lilian Downie Gene: ttpa has been classified as Green List (High Evidence).
Prepair 1000+ v1.1884 TTPA Lilian Downie Publications for gene: TTPA were set to
Prepair 1000+ v1.1883 VARS Lilian Downie Marked gene: VARS as ready
Prepair 1000+ v1.1883 VARS Lilian Downie Gene: vars has been classified as Green List (High Evidence).
Prepair 1000+ v1.1883 VARS Lilian Downie Phenotypes for gene: VARS were changed from Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy, 617802 (3), Autosomal recessive to Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802
Prepair 1000+ v1.1882 VARS Lilian Downie Publications for gene: VARS were set to
Mendeliome v1.2479 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Mendeliome. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Prepair 1000+ v1.1881 WNT10B Lilian Downie Marked gene: WNT10B as ready
Prepair 1000+ v1.1881 WNT10B Lilian Downie Gene: wnt10b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1881 WNT10B Lilian Downie Publications for gene: WNT10B were set to
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Marked gene: CSPP1 as ready
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Gene: cspp1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1880 CSPP1 Lilian Downie Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288
Prepair 1000+ v1.1879 CSPP1 Lilian Downie Publications for gene: CSPP1 were set to
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Marked gene: DNAH5 as ready
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Gene: dnah5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1878 DNAH5 Lilian Downie Publications for gene: DNAH5 were set to
Prepair 1000+ v1.1877 PEX5 Lilian Downie Marked gene: PEX5 as ready
Prepair 1000+ v1.1877 PEX5 Lilian Downie Gene: pex5 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1877 PEX5 Lilian Downie Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger), 214110 to Peroxisome Biogenesis Disorder, MONDO:0019234
Prepair 1000+ v1.1876 PEX5 Lilian Downie Publications for gene: PEX5 were set to 21031596; 7719337; 26220973; 20301621
Prepair 1000+ v1.1875 PEX5 Lilian Downie Publications for gene: PEX5 were set to
Prepair 1000+ v1.1874 PIGN Lilian Downie Marked gene: PIGN as ready
Prepair 1000+ v1.1874 PIGN Lilian Downie Gene: pign has been classified as Green List (High Evidence).
Prepair 1000+ v1.1874 PIGN Lilian Downie Publications for gene: PIGN were set to
Prepair 1000+ v1.1873 PLAA Lilian Downie Marked gene: PLAA as ready
Prepair 1000+ v1.1873 PLAA Lilian Downie Gene: plaa has been classified as Green List (High Evidence).
Prepair 1000+ v1.1873 PLAA Lilian Downie Phenotypes for gene: PLAA were changed from Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, 617527 (3), Autosomal recessive to Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527
Prepair 1000+ v1.1872 PLAA Lilian Downie Publications for gene: PLAA were set to
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Marked gene: PLCE1 as ready
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Gene: plce1 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1871 PLCE1 Lilian Downie Publications for gene: PLCE1 were set to
Prepair 1000+ v1.1870 POLR3B Lilian Downie Marked gene: POLR3B as ready
Prepair 1000+ v1.1870 POLR3B Lilian Downie Gene: polr3b has been classified as Green List (High Evidence).
Prepair 1000+ v1.1870 POLR3B Lilian Downie Mode of pathogenicity for gene: POLR3B was changed from to None
Prepair 1000+ v1.1869 POLR3B Lilian Downie Publications for gene: POLR3B were set to
Mendeliome v1.2479 ANKZF1 Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Inflammatory bowel disease v0.124 ANKZF1 Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Monogenic Diabetes v0.137 SIRT1 Sangavi Sivagnanasundram gene: SIRT1 was added
gene: SIRT1 was added to Monogenic Diabetes. Sources: ClinGen
Mode of inheritance for gene: SIRT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SIRT1 were set to https://search.clinicalgenome.org/CCID:008794
Phenotypes for gene: SIRT1 were set to monogenic diabetes MONDO:0015967
Review for gene: SIRT1 was set to RED
Added comment: Classified as LIMITED by Monogenic Diabetes GCEP on 18/04/2025 - https://search.clinicalgenome.org/CCID:008794
Sources: ClinGen
Mendeliome v1.2479 SIRT1 Sangavi Sivagnanasundram reviewed gene: SIRT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008794; Phenotypes: monogenic diabetes MONDO:0015967; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genomic newborn screening: ICoNS v0.0 Zornitza Stark Added Panel Genomic newborn screening: ICoNS
Genomic newborn screening: BabyScreen+ v1.117 Zornitza Stark Panel name changed from BabyScreen+ newborn screening to Genomic newborn screening: BabyScreen+
Mendeliome v1.2479 FGFR3 Bryony Thompson Mode of inheritance for gene: FGFR3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2478 FGFR1 Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290; 16470795; 15625620; 29147600; 20339250
Mendeliome v1.2477 FGFR1 Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290
Infertility and Recurrent Pregnancy Loss v0.63 PANX1 Jasmine Chew gene: PANX1 was added
gene: PANX1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: PANX1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Publications for gene: PANX1 were set to 30918116; 39232764; 35834089; 36469255; 33495594
Phenotypes for gene: PANX1 were set to Oocyte/zygote/embryo maturation arrest 7, MIM# 618550
Review for gene: PANX1 was set to GREEN
Added comment: Literature in OMIM- PMID: 30918116: 4 different monoallelic variants in 4 unrelated Chinese families with 8 women who were infertile due to oocyte death. Functional analysis demonstrated that the mutations alter the PANX1 glycosylation pattern, influence subcellular localization, and increase channel activity and ATP release.

New papers-
i) PMID: 39232764;35834089;36469255- 3 novel monoallelic variants (p.Ser137Leu,p. Arg29Gln, p.Asn326del) causing human oocyte death and female infertility. Western blot analysis confirmed that Arg29Gln and p.Asn326del changed the glycosylation pattern in HeLa cells.

ii) PMID: 33495594- two novel homozygous missense variants associated with the oocyte death phenotype in two families. Both of the homozygous variants altered the PANX1 glycosylation pattern in cultured cells, led to aberrant PANX1 channel activation, and resulted in mouse oocyte death after fertilization in vitro. It is worth noting that the destructive effect of the two homozygous variants on PANX1 function was weaker than that caused by the recently reported heterozygous variants.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 TRIP13 Jasmine Chew gene: TRIP13 was added
gene: TRIP13 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TRIP13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TRIP13 were set to 32473092; 28553959; 35812326
Phenotypes for gene: TRIP13 were set to Oocyte/zygote/embryo maturation arrest 9, #MIM 619011; Mosaic variegated aneuploidy syndrome 3, #MIM 617598
Review for gene: TRIP13 was set to GREEN
Added comment: Literature in OMIM- PMID: 32473092;28553959- different biallelic variants in >3 unrelated affected individuals

New papers:
i) PMID: 35812326- Two women with zygotic cleavage failure (ZCF) carrying homozygous p. Glu381Lys and compound heterozygous p. Lys420Glu and p. His26Arg. All three variants resulted in obvious changes in hydrogen bonding and consistent increase in DNA damage. Additionally, transcriptomic sequencing of oocytes and arrested embryos containing these variants suggested a greater number of differentially expressed transcripts in germinal vesicle (GV) oocytes than in 1-cell embryos.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 FBXO43 Jasmine Chew gene: FBXO43 was added
gene: FBXO43 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FBXO43 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO43 were set to 34052850; 30878252; 34595750
Phenotypes for gene: FBXO43 were set to Oocyte/zygote/embryo maturation arrest 12, MIM# 619697; Spermatogenic failure 64, MIM# 619696
Review for gene: FBXO43 was set to GREEN
Added comment: Literature in OMIM: PMID: 34052850 (three different homozygous variants in 3 unrelated women; 30878252, 34595750 (two different families with different homozygous variants)
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 FGA Jasmine Chew gene: FGA was added
gene: FGA was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FGA were set to 29016666; 34925444
Phenotypes for gene: FGA were set to Recurrent pregnancy loss
Review for gene: FGA was set to GREEN
Added comment: i) PMID: 29016666- A heterozygous missense p.Phe685Cys called pathogenic in a female with RPL (3 miscarriages, all embryonic loss) and fragment molecular orbital analysis showed that the p.F685C variant led to changes in total interaction energy, thus leading to protein instability

ii) PMID: 34925444: Two heterozygous FGA variants were identified in two women, each with three consecutive miscarriages- one variant (NM_000508.5: c.1906_1908del; p.636del) leading to the deletion of an amino acid was not found in public databases. The other variant in FGA (p.A762V) causing an amino acid substitution was extremely rare in East Asian populations in the gnomAD database and was predicted to be deleterious by in silico prediction tools.
- " Mutations of FGA have been linked to coagulation pathologies including afibrinogenemia (OMIM:202400) and dysfibrinogenemia/hypodysfibrinogenemia (OMIM:616004), which can result in miscarriage (PMID: 31368232).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 KHDC3L Jasmine Chew changed review comment from: Biallelic variants have been reported for several unrelated families with recurrent complete hydatidiform mole (CHM) pregnancy- predominantly biparental and RPL- PMID: 21885028, 19246479, 23232697.

New evidence-
i) PMID 31847873: homozygous LOF variant in a woman with multiple consanguineous marriages in her extended family and history of 2 biparental complete hydatidiform mole (BiCHM) and methylation study on her oocytes revealed a genome-wide deficit of DNA methylation compared with normal human oocytes.

ii) PMID: 31609975- two deletions of KHDC3L (p.E150_V160del and p.E150_V172del) in female RPL patients, both of which harbor a common loss of Thr156 and are impaired in PARP1 activation and homologous recombination (HR) repair. Also provided functional evidence that KHDC3L dysfunction causes PARP1 inhibition and HR-mediated DNA repair deficiency, which is synthetically lethal.

iii) PMID: 29606347- a novel homozygous frameshift p.Q15Rfs*25 variant in a female patient (II-1) from family 4 with a history of 2 spontaneous abortions and x2 partial hydatidiform moles, and her embryos formed after ICSI are fertilized normally but arrest at the morula stage.
Sources: Literature; to: Biallelic variants have been reported for several unrelated families with recurrent complete hydatidiform mole (CHM) pregnancy- predominantly biparental and RPL- PMID: 21885028, 19246479, 23232697.

New evidence (biallelic variants and CHM pregnancy)-
i) PMID 31847873: homozygous LOF variant in a woman with multiple consanguineous marriages in her extended family and history of 2 biparental complete hydatidiform mole (BiCHM) and methylation study on her oocytes revealed a genome-wide deficit of DNA methylation compared with normal human oocytes.

ii) PMID: 31609975- two deletions of KHDC3L (p.E150_V160del and p.E150_V172del) in female RPL patients, both of which harbor a common loss of Thr156 and are impaired in PARP1 activation and homologous recombination (HR) repair. Also provided functional evidence that KHDC3L dysfunction causes PARP1 inhibition and HR-mediated DNA repair deficiency, which is synthetically lethal.

iii) PMID: 29606347- a novel homozygous frameshift p.Q15Rfs*25 variant in a female patient (II-1) from family 4 with a history of 2 spontaneous abortions and x2 partial hydatidiform moles, and her embryos formed after ICSI are fertilized normally but arrest at the morula stage.

New evidence (monoallelic variants and RPL)-
i) PMID: 34925444- a heterozygous in frame deletion in KHDC3L (p.146_156del) in a 31-year-old woman with a history of two miscarriages.
ii) PMID: 31609975- heterozygous deletions (p.150_160del and p.150_172del) were found in patients experiencing RPL without forming an hydatidiform mole.
Note: All of the deletions in patients with RPL affected the Thr156 residue, a critical phosphorylation site for normal KHDC3L protein function. Loss of Thr156 results in impaired PARP1 activation and HR repair.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 KHDC3L Jasmine Chew edited their review of gene: KHDC3L: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2476 FGF8 Bryony Thompson Publications for gene: FGF8 were set to 34433009; 32664970; 7768185; 32664970; 10603341; 19509466; 9462741; 10603341; 12223415
Mendeliome v1.2475 FGF8 Bryony Thompson Publications for gene: FGF8 were set to 34433009
Mendeliome v1.2474 FGA Bryony Thompson Publications for gene: FGA were set to 31064749; 17295221; 19073821; 11739173
Mendeliome v1.2473 FGA Bryony Thompson Mode of inheritance for gene: FGA was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.55 FGA Bryony Thompson Mode of inheritance for gene: FGA was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.54 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396; 24560896
Bleeding and Platelet Disorders v1.54 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396
Bleeding and Platelet Disorders v1.53 FGB Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Bleeding and Platelet Disorders v1.52 FGB Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2472 FGB Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396
Mendeliome v1.2471 FGB Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FGB Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FGA Bryony Thompson reviewed gene: FGA: Rating: GREEN; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes
Bleeding and Platelet Disorders v1.52 FGA Bryony Thompson edited their review of gene: FGA: Changed rating: GREEN
Bleeding and Platelet Disorders v1.52 FGA Bryony Thompson reviewed gene: FGA: Rating: ; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Mendeliome v1.2470 FAR1 Bryony Thompson reviewed gene: FAR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33586168, 25439727; Phenotypes: Fatty acyl-CoA reductase 1 deficiency MONDO:0014510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v1.2470 FANCM Bryony Thompson edited their review of gene: FANCM: Added comment: Now 4 families with biallelic variants reported with spermatogenic failure; Changed publications: 29231814, 28837162, 33036707, 25010009, 38927643, 35413094, 30075111, 29895858; Changed phenotypes: Premature ovarian failure 15 MIM#618096, spermatogenic failure 28 MONDO:0054732; Set current diagnostic: yes
Mendeliome v1.2470 FANCI Bryony Thompson Publications for gene: FANCI were set to 17452773
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson changed review comment from: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants, however 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for the thrombophilia.; to: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants; however, 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for thrombophilia.
Mendeliome v1.2469 F9 Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: Other; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2469 F9 Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538; 3001143; 9016521; 19815722
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson edited their review of gene: F9: Changed mode of pathogenicity: Other
Bleeding and Platelet Disorders v1.52 F9 Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2468 F9 Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538
Mendeliome v1.2467 F5 Bryony Thompson Publications for gene: F5 were set to
Mendeliome v1.2466 F2 Bryony Thompson Classified gene: F2 as Green List (high evidence)
Mendeliome v1.2466 F2 Bryony Thompson Added comment: Comment on list classification: Gain of function is the mechanism of disease for dominant thrombophilia, and biallelic loss of function is the mechanism for congenital prothrombin deficiency.
Mendeliome v1.2466 F2 Bryony Thompson Gene: f2 has been classified as Green List (High Evidence).
Mendeliome v1.2465 F2 Bryony Thompson Tag 5'UTR was removed from gene: F2.
Tag UTR tag was added to gene: F2.
Mendeliome v1.2465 F2 Bryony Thompson Publications for gene: F2 were set to 30297698
Infertility and Recurrent Pregnancy Loss v0.63 ZFP36L2 Jasmine Chew gene: ZFP36L2 was added
gene: ZFP36L2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: ZFP36L2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFP36L2 were set to 34611029; 38829516; 37211617
Phenotypes for gene: ZFP36L2 were set to Oocyte/zygote/embryo maturation arrest 13, MIM# 620154
Review for gene: ZFP36L2 was set to GREEN
Added comment: i) Literature in OMIM- PMID:34611029- x2 unrelated infertile Chinese women with defective oocyte maturation carrying different biallelic variants and functional analysis suggested that the variants cause maternal mRNA decay defects that result in female infertility.

ii) New papers reporting biallelic variants in conjunction with female infertility due to oocyte maturation defect+/- embryonic development arrest
- PMID: 38829516: Novel compound heterozygous variant (p.His62Gln and p.Pro290Leu) in a patient with oocyte maturation defect. These variants lead to compromised binding capacity of the ZFP36L2-CONT6L complex and impaired mRNA degradation in HeLa cells and mouse oocytes.
- PMID: 37211617: Novel homozygous variant c.853_861del (p.285_287del) in the affected individual with oocyte maturation defect from a consanguineous family. In vitro studies showed that the variant caused decreased protein levels of ZFP36L2 in oocytes due to mRNA instability and might lead to the loss of its function to degrade maternal mRNAs
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 REC114 Jasmine Chew gene: REC114 was added
gene: REC114 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: REC114 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: REC114 were set to 31704776; 30388401; 38148155
Phenotypes for gene: REC114 were set to Oocyte/zygote/embryo maturation arrest 10, #MIM 619176
Review for gene: REC114 was set to GREEN
Added comment: i) Literature in OMIM (PMID: 31704776;30388401)- x3 unrelated females with different biallelic variants presented with infertility due to oocyte maturation defects/multiple pronuclei zygotes, early embryonic arrest, and failed implantation of surviving embryos/miscarriages/recurrent hydatidiform moles.

ii) New paper on male infertility:
- PMID: 38148155- First report that identifies REC114 as the causative gene for male infertility- homozygous p.Gln190* variant in a Chinese NOA patient. Co-immunoprecipitation (Co-IP) and Western blot (WB) revealed that the variant resulted in truncated REC114 protein and impaired interaction with MEI4, which was essential for meiotic DNA double-strand break (DSB) formation.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 WEE2 Jasmine Chew gene: WEE2 was added
gene: WEE2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: WEE2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WEE2 were set to 29606300; 30628060; 39476306; 37772619; 36568932; 34476630
Phenotypes for gene: WEE2 were set to Oocyte/zygote/embryo maturation arrest 5, MIM# 617996
Review for gene: WEE2 was set to GREEN
Added comment: i) Literature in OMIM- PMID: 29606300;30628060- >3 unrelated infertile women (e.g., oocyte maturation defect, recurrent fertilization failure) with different biallelic variants

ii) Many other new papers reporting biallelic variants in conjunction with oocyte degradation +/- unexplained fertilization failure - PMID: 39476306;37772619;36568932;34476630

iii) definitive evidence for OZEMA in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 TLE6 Jasmine Chew changed review comment from: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y. ). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC.

ii) New papers:
- PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure.
- PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells.
- PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014)

iii) Classified as definitive for OZEMA in FeRGI database
Sources: Literature; to: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC.

ii) New papers:
- PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure.
- PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells.
- PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014).

iii) Classified as definitive for OZEMA in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 TLE6 Jasmine Chew gene: TLE6 was added
gene: TLE6 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TLE6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TLE6 were set to 26537248; 31897846; 40225929; 32172300
Phenotypes for gene: TLE6 were set to Oocyte/zygote/embryo maturation arrest 15, #MIM 616814
Review for gene: TLE6 was set to GREEN
Added comment: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y. ). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC.

ii) New papers:
- PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure.
- PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells.
- PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014)

iii) Classified as definitive for OZEMA in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 PABPC1L Jasmine Chew gene: PABPC1L was added
gene: PABPC1L was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: PABPC1L was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PABPC1L were set to 37052235; 37723834; 38177974; 32172300
Phenotypes for gene: PABPC1L were set to Oocyte/zygote/embryo maturation arrest 22, #MIM 621093
Review for gene: PABPC1L was set to GREEN
Added comment: i) Literature in OMIM (PMID: 37052235;37723834;38177974)- >3 unrelated infertile women (due to a mixed phenotype including oocyte maturation abnormalities, fertilization failure, and embryonic development arrest) with different biallelic variants

ii) Additional paper (PMID: 32172300)- Homozygous likely deleterious variant in PABPC1L p.(Met26Lys) in a woman whose infertility phenotype resembles that of Pabpc1l−/− mouse. During her IVF cycles, 18 oocytes were retrieved and subjected to IVF and ICSI. Nine oocytes were assigned to ICSI, but eight were at germinal vesicle stage and only one showed polar body and failed to fertilize following ICSI. Similarly, nine oocytes were assigned to IVF, and only two showed polar body on the next day without any sign of fertilization. The remaining oocytes were at germinal vesicle stage.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 NLRP7 Jasmine Chew gene: NLRP7 was added
gene: NLRP7 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: NLRP7 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: NLRP7 were set to 17579354; 19650864; 25097207; 23201303; 23722513; 32172300; 37148315
Phenotypes for gene: NLRP7 were set to Recurrent hydatidiform mole 1, # MIM 231090
Review for gene: NLRP7 was set to GREEN
Added comment: i) The association between diploid biparental hydatidiform mole (HM), miscarriages, and infertility has been observed in many patients with biallelic functional variants in NLRP7 and some of their HM were diagnosed by morphology as non-molar miscarriages, partial HM (because of their mild trophoblastic proliferation), non-classical HM [PMID: 23201303], or not easy to classify HM [PMID: 23722513].
ii) classified as strong evidence for HM on the FeRGI database
iii) New paper- PMID: 32172300- homozygous truncating variant p.(Lys619Asnfs*18) in an individual with recurrent molar pregnancy and no pregnancy observed following three intra-uterine insemination attempts.
iv) New phenotype (AD):
- PMID: 37148315- five heterozygous variants (c.251G > A, c.1258G > A, c.1441G > A, c. 2227G > A, c.2323C > T) of NLRP7 were identified in five infertile patients who experienced early embryo arrest. Injecting complementary RNAs in mouse oocytes and early embryos showed that NLRP7 variants influenced the oocyte quality and some of the variants significantly affected early embryo development.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.63 DNAH11 Jasmine Chew gene: DNAH11 was added
gene: DNAH11 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: DNAH11 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAH11 were set to 39256880; 32172300
Phenotypes for gene: DNAH11 were set to Ciliary dyskinesia, primary, 7, with or without situs inversus, # MIM 611884
Added comment: i) PMID: 39256880- Four unrelated asthenoteratozoospermia Chinese males with biallelic deleterious variants in the DNAH11 gene, and 7 of those variants are novel. These variants led the absence of DNAH11 proteins and ultrastructure defects in sperm flagella, particularly affecting the outer dynein arms (ODAs) and adjacent structures. The levels of ODA protein DNAI2 and axoneme related proteins were down regulated.

ii) PMID: 32172300- One infertile woman with a homozygous truncating variant, p.(Arg3229Trp), presented with primary infertility only. She had three cycles of IVF and had one clinical pregnancy that, unfortunately, ended in a spontaneous loss during first trimester.
Sources: Literature
Renal Macrocystic Disease v0.83 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Cystic Kidney Disease, MONDO# 0002473 to {Polycystic kidney disease 9, susceptibility to} MIM#621164
Renal Macrocystic Disease v0.82 IFT140 Zornitza Stark reviewed gene: IFT140: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: {Polycystic kidney disease 9, susceptibility to} MIM#621164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Renal Ciliopathies and Nephronophthisis v1.27 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Cystic Kidney Disease, MONDO# 0002473, IFT140-related, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; {Polycystic kidney disease 9, susceptibility to} MIM#621164
Renal Ciliopathies and Nephronophthisis v1.26 IFT140 Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, MONDO:0009964, {Polycystic kidney disease 9, susceptibility to} MIM#621164
Mendeliome v1.2464 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164
Mendeliome v1.2463 IFT140 Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164
Prepair 1000+ v1.1868 POLR3B Karina Sandoval reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 27512013, 23355746, 22036171, 22036172, 25339210, 33005949, 22855961, 33417887; Phenotypes: Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism,MIM#614381; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PLCE1 Karina Sandoval reviewed gene: PLCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17086182, 18065803, 20591883; Phenotypes: Nephrotic syndrome, type 3,MIM#610725; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PLAA Karina Sandoval reviewed gene: PLAA: Rating: GREEN; Mode of pathogenicity: None; Publications: 28007986, 28413018, 31322726; Phenotypes: Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PIGN Karina Sandoval reviewed gene: PIGN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21493957, 24253414, 26364997, 26394714, 33193741, 32585529, 33528536, 38693247, 36322149; Phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 1,MIM#614080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PEX5 Karina Sandoval reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 21031596, 7719337, 26220973, 20301621; Phenotypes: Peroxisome Biogenesis Disorder, MONDO:0019234; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2463 EYA4 Bryony Thompson reviewed gene: EYA4: Rating: AMBER; Mode of pathogenicity: None; Publications: 10769282, 30155266, 33745059; Phenotypes: dilated cardiomyopathy 1J MONDO:0011541; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1868 DNAH5 Andrew Coventry reviewed gene: DNAH5: Rating: GREEN; Mode of pathogenicity: None; Publications: 16627867, 11788826, 40033371; Phenotypes: Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 CSPP1 Andrew Coventry reviewed gene: CSPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360808, 24360803, 24360807, 25997910; Phenotypes: Joubert syndrome 21 MIM#615636, MONDO:0014288; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 WNT10B Andrew Coventry reviewed gene: WNT10B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20635353, 16688749, 29427788, 24211389, 38058757, 39310870; Phenotypes: Split-hand/foot malformation 6 MIM#225300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 VARS Andrew Coventry reviewed gene: VARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30755616, 30755602, 26539891, 29691655, 30275004, 30755616; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TTPA Andrew Coventry reviewed gene: TTPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 7719340; Phenotypes: Ataxia with isolated vitamin E deficiency MIM#277460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TTI2 Andrew Coventry reviewed gene: TTI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32061250, 23956177, 31737043; Phenotypes: Intellectual developmental disorder, autosomal recessive 39 MIM#615541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TRPM6 Andrew Coventry reviewed gene: TRPM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 35903165, 18818955; Phenotypes: Hypomagnesemia 1, intestinal MIM#602014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 TRIM32 Andrew Coventry reviewed gene: TRIM32: Rating: GREEN; Mode of pathogenicity: None; Publications: 9634523, 10399877, 17994549, 25351777, 19492423, 19303295, 31309175; Phenotypes: Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2463 ERLIN2 Bryony Thompson Mode of inheritance for gene: ERLIN2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 STRA6 Andrew Coventry reviewed gene: STRA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273977, 17503335, 19213032, 26373900, 30880327, 26373900, 25457163; Phenotypes: Microphthalmia, isolated, with coloboma 8 MIM#601186, Microphthalmia, syndromic 9 MIM#601186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Marked gene: ERLIN2 as ready
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence).
Prepair 1000+ v1.1868 SPR Andrew Coventry reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522443, 26131547, 33903016, 31777525, 16650784, 21431957, 28189489; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Classified gene: ERLIN2 as Green List (high evidence)
Motor Neurone Disease v1.29 ERLIN2 Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence).
Motor Neurone Disease v1.28 ERLIN2 Bryony Thompson gene: ERLIN2 was added
gene: ERLIN2 was added to Motor Neurone Disease. Sources: Literature
Mode of inheritance for gene: ERLIN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: ERLIN2 were set to 38607533; 38427163; 34734492; 32042907
Phenotypes for gene: ERLIN2 were set to hereditary spastic paraplegia 18 MONDO:0012639
Review for gene: ERLIN2 was set to GREEN
gene: ERLIN2 was marked as current diagnostic
Added comment: HSP phenoconversion to ALS has been reported in AD and AR families.
Sources: Literature
Prepair 1000+ v1.1868 SP110 Andrew Coventry reviewed gene: SP110: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301448, 16648851, 23448538, 22621957, 32395362; Phenotypes: Hepatic venoocclusive disease with immunodeficiency MIM#235550; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SLC37A4 Andrew Coventry reviewed gene: SLC37A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33964207, 9675154, 9758626; Phenotypes: Glycogen storage disease Ib MIM#232220, Glycogen storage disease Ic MIM#232240, Glycogen Storage Disease I MONDO:0002413; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 ERLIN2 Bryony Thompson edited their review of gene: ERLIN2: Added comment: AR and AD variants appear to have a different mechanism of disease. AR is presumably loss of function. The mechanism of disease for AD HSP is expected to be dominant negative but has not been confirmed; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SLC12A5 Andrew Coventry reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 24928908, 30763027, 24668262; Phenotypes: Developmental and epileptic encephalopathy 34 MIM#616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 SEC23B Andrew Coventry reviewed gene: SEC23B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19561605, 19621418, 26522472, 27471141, 37373084; Phenotypes: Dyserythropoietic anemia, congenital, type II MIM#224100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RNASET2 Andrew Coventry reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly MIM#612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RNASEH2A Andrew Coventry reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 15870678, 25604658, 23592335, 20301648, 29239743, 16845400, 24183309, 35551623; Phenotypes: Aicardi-Goutieres syndrome 4 MIM#610333, RNASEH2A-related type 1 interferonopathy MONDO:0700259; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RARB Andrew Coventry reviewed gene: RARB: Rating: AMBER; Mode of pathogenicity: None; Publications: 30880327, 30281527, 24075189, 27120018, 25457163, 17506106; Phenotypes: Microphthalmia, syndromic 12 MIM#615524; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 RAB23 Andrew Coventry reviewed gene: RAB23: Rating: GREEN; Mode of pathogenicity: None; Publications: 17503333, 21412941, 23599695, 25168863; Phenotypes: Carpenter syndrome MIM#201000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PUS7 Andrew Coventry reviewed gene: PUS7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30526862, 30778726, 31583274, 35144859; Phenotypes: Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature MIM#618342; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PPIB Andrew Coventry reviewed gene: PPIB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19781681, 32392875; Phenotypes: Osteogenesis imperfecta, type IX MIM#259440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 SIRT6 Achchuthan Shanmugasundram gene: SIRT6 was added
gene: SIRT6 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SIRT6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SIRT6 were set to 29555651; 30135584
Review for gene: SIRT6 was set to GREEN
Added comment: PMID:29555651 reported a family with four consecutive cases of late foetal loss with gestational ages between 17 and 35 weeks. The foetuses showed prenatal abnormalities including intrauterine growth restriction (IUGR), microcephaly, craniofacial anomalies, sex reversal in male foetuses, and congenital heart defects. A homozygous inactivating variant in SIRT6 gene (c.187G > C; p.(Asp63His)) was identified by WES in the four foetuses. There is also functional data available from in vitro studies, SIRT6 D63H mouse embryonic stem cells and human induced pluripotent stem cells (iPSCs) derived from D63H homozygous foetuses.

There is also functional evidence available from several other studies including PMID:30135584, where CRISPR-Cas9-based approach was used to generate a SIRT6-null cynomolgus monkey (Macaca fascicularis) model. SIRT6-deficient monkeys died hours after birth and exhibited severe prenatal developmental retardation.

This gene has not been associated with any phenotypes either in OMIM or in Gene2Phenotype.
Sources: Literature
Prepair 1000+ v1.1868 OPA1 Cassandra Muller reviewed gene: OPA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25012220; Phenotypes: Behr syndrome, 210000 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PDP1 Karina Sandoval reviewed gene: PDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15855260, 31392110, 19184109; Phenotypes: Pyruvate dehydrogenase phosphatase deficiency,MIM#608782; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NUBPL Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression.; to: Well established gene-disease association. Severe, multi system, mitochondrial condition with variable severity and progression.
Prepair 1000+ v1.1868 NUBPL Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression. Onset in infancy or childhood.; to: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression.
Prepair 1000+ v1.1868 NUBPL Cassandra Muller reviewed gene: NUBPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20818383, 32518176, 23553477, 31917109, 32518176, 31787496, 30897263, 22826544; Phenotypes: Mitochondrial complex I deficiency, nuclear type 21, 618242 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NR2E3 Cassandra Muller Deleted their review
Prepair 1000+ v1.1868 NR2E3 Cassandra Muller reviewed gene: NR2E3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval reviewed gene: PCSK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825, 23562752; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 NDUFS4 Cassandra Muller reviewed gene: NDUFS4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex I deficiency, nuclear type 1, 252010 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval Deleted their review
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval changed review comment from: Unsure if severe enough to include in panel.

MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood.

PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue
parenteral feeding.

PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support
that may be tapered off as the child ages.; to: Unsure if severe enough to include in panel.

MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood.

PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue
parenteral feeding.

PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support
that may be tapered off as the child ages.
Prepair 1000+ v1.1868 NDE1 Cassandra Muller reviewed gene: NDE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30637988, 21529751, 34562061; Phenotypes: Lissencephaly 4 (with microcephaly), 614019 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Adult Cardiac SuperPanel v2.9 Bryony Thompson Changed child panels to: Dilated Cardiomyopathy; Short QT syndrome; Atrial Fibrillation; Cardiac conduction disease; Hypertrophic cardiomyopathy_HCM; Arrhythmogenic Cardiomyopathy; Long QT Syndrome; Catecholaminergic Polymorphic Ventricular Tachycardia; Brugada syndrome; Ventricular Fibrillation
Prepair 1000+ v1.1868 MMP2 Cassandra Muller reviewed gene: MMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11431697, 15691365, 17059372, 17400654; Phenotypes: Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2462 RNU2-2P Achchuthan Shanmugasundram reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: 40210679; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 1000+ v1.1868 PCSK1 Karina Sandoval reviewed gene: PCSK1: Rating: AMBER; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 PAH Karina Sandoval reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 3008810, 31636599, 32141105; Phenotypes: Phenylketonuria,MIM#261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 OTUD6B Karina Sandoval reviewed gene: OTUD6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28343629, 32924626, 31147255; Phenotypes: Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 OPN1LW Karina Sandoval reviewed gene: OPN1LW: Rating: RED; Mode of pathogenicity: None; Publications: 25168334, 32860923, 8213841; Phenotypes: Blue cone monochromacy,MIM#303700, Colorblindness, protan,MIM#303900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 1000+ v1.1868 MED12 Melanie Marty reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: 33244166, 32174975, 30006928, 27312080; Phenotypes: MED12-related intellectual disability syndrome, MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 1000+ v1.1868 HYLS1 Melanie Marty reviewed gene: HYLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15843405, 18648327, 19400947, 19656802, 32509774, 39626953, 26830932; Phenotypes: Hydrolethalus syndrome (MIM#236680), Ciliopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 1000+ v1.1868 FHL1 Melanie Marty changed review comment from: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287).

Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease.

Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy.

XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function.; to: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287).

Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease.

Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy. Female carriers may experience mild proximal muscle weakness or be asymptomatic.

XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function.
Prepair 1000+ v1.1868 FHL1 Melanie Marty reviewed gene: FHL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19716112, 20186852, 20301609, 18179901, 25274776, 34366191, 18274675, 19181672, 21310615, 40017287; Phenotypes: Reducing body myopathy MONDO:0019948, X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v1.2462 ENAM Bryony Thompson Added comment: Comment on mode of inheritance: Same mechanism of disease for monoallelic vs biallelic. Biallelic phenotype is more severe
Mendeliome v1.2462 ENAM Bryony Thompson Mode of inheritance for gene: ENAM was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Marked gene: EMILIN1 as ready
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v1.3 EMILIN1 Bryony Thompson Phenotypes for gene: EMILIN1 were changed from arterial tortuosity-bone fragility syndrome to arterial tortuosity-bone fragility syndrome MONDO:0971179
Osteogenesis Imperfecta and Osteoporosis v1.2 EMILIN1 Bryony Thompson Classified gene: EMILIN1 as Green List (high evidence)
Osteogenesis Imperfecta and Osteoporosis v1.2 EMILIN1 Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence).
Osteogenesis Imperfecta and Osteoporosis v1.1 EMILIN1 Bryony Thompson gene: EMILIN1 was added
gene: EMILIN1 was added to Osteogenesis Imperfecta and Osteoporosis. Sources: Literature
Mode of inheritance for gene: EMILIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EMILIN1 were set to 36351433
Phenotypes for gene: EMILIN1 were set to arterial tortuosity-bone fragility syndrome
Review for gene: EMILIN1 was set to GREEN
gene: EMILIN1 was marked as current diagnostic
Added comment: Prenatal and neonatal fractures are a feature of the condition.
Sources: Literature
Macular Dystrophy/Stargardt Disease v0.54 ELOVL4 Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Macular Dystrophy/Stargardt Disease v0.53 ELOVL4 Bryony Thompson reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11138005, 15028284, 11726641, 17208947; Phenotypes: Stargardt disease MONDO:0019353; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Marked gene: ELOVL4 as ready
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence).
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Classified gene: ELOVL4 as Red List (low evidence)
Syndromic Retinopathy v0.222 ELOVL4 Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence).
Syndromic Retinopathy v0.221 ELOVL4 Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: The macular dystrophy/Stargardt disease phenotype is nonsyndromic and the biallelic congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome doesn't include any retinal findings. Parents who were heterozygous for the variants did not have macular dystrophy.
Syndromic Retinopathy v0.221 ELOVL4 Bryony Thompson edited their review of gene: ELOVL4: Changed rating: RED; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2461 ELOVL4 Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: Well-established gene-disease associations. Monoallelic truncating variants in the last exon with an expected dominant effect are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.
Mendeliome v1.2461 ELOVL1 Bryony Thompson Publications for gene: ELOVL1 were set to
Mendeliome v1.2460 ELOVL1 Bryony Thompson Mode of inheritance for gene: ELOVL1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2459 ELOVL1 Bryony Thompson reviewed gene: ELOVL1: Rating: RED; Mode of pathogenicity: None; Publications: 35379526; Phenotypes: ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facial features MONDO:0032798; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2459 ELOVL1 Bryony Thompson Deleted their review
Mendeliome v1.2459 EIF2AK4 Bryony Thompson Publications for gene: EIF2AK4 were set to
Mendeliome v1.2458 EIF2AK2 Bryony Thompson Phenotypes for gene: EIF2AK2 were changed from Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia to Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia; complex neurodevelopmental disorder MONDO:0100038
Mendeliome v1.2457 EIF2A Bryony Thompson Phenotypes for gene: EIF2A were changed from Intellectual disability, epilepsy to Intellectual disability, epilepsy; MONDO:0700092
Mendeliome v1.2456 EIF2AK1 Bryony Thompson Phenotypes for gene: EIF2AK1 were changed from Intellectual disability; white matter abnormalities to Intellectual disability; white matter abnormalities; MONDO:0100038
Mendeliome v1.2455 EGR2 Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2454 EGR2 Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal
Fetal anomalies v1.321 EFNA4 Bryony Thompson Publications for gene: EFNA4 were set to 29215649; 29168297; 16540516
Fetal anomalies v1.320 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Fetal anomalies v1.320 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Fetal anomalies v1.319 EFNA4 Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Craniosynostosis v1.69 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Craniosynostosis v1.69 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Craniosynostosis v1.68 EFNA4 Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2453 EFNA4 Bryony Thompson Classified gene: EFNA4 as Red List (low evidence)
Mendeliome v1.2453 EFNA4 Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence).
Mendeliome v1.2452 EFNA4 Bryony Thompson changed review comment from: Supporting animal models, but no compelling evidence in human cases. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease.

PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member

PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls

PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases

PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent.

PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly.

PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls.

PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4.; to: Supporting animal models, but no compelling evidence in human cases has been reported since 2006. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease.

PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member

PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls

PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases

PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent.

PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly.

PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls.

PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4.
Mendeliome v1.2452 EFNA4 Bryony Thompson edited their review of gene: EFNA4: Changed rating: RED; Changed publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Marked gene: EFEMP1 as ready
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Gene: efemp1 has been classified as Green List (High Evidence).
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Added comment: Comment on phenotypes: Singe missense variant (p.Arg345Trp) associated with disease
Macular Dystrophy/Stargardt Disease v0.53 EFEMP1 Bryony Thompson Phenotypes for gene: EFEMP1 were changed from Inherited macular dystrophy (Doyne/dominant drusen) to Doyne honeycomb retinal dystrophy MONDO:0007471
Macular Dystrophy/Stargardt Disease v0.52 EFEMP1 Bryony Thompson Publications for gene: EFEMP1 were set to
Mendeliome v1.2452 EFEMP1 Bryony Thompson Publications for gene: EFEMP1 were set to 32006683; 31792352; 33807164
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Classified gene: EEF1D as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.102 EEF1D Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.101 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Mendeliome v1.2451 EEF1D Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321
Intellectual disability syndromic and non-syndromic v1.100 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2450 EEF1D Bryony Thompson Classified gene: EEF1D as Green List (high evidence)
Mendeliome v1.2450 EEF1D Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence).
Mendeliome v1.2449 EEF1D Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: None
Deafness_IsolatedAndComplex v1.214 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Deafness_IsolatedAndComplex v1.214 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Hirschsprung disease v0.26 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Hirschsprung disease v0.26 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Gastrointestinal neuromuscular disease v1.25 EDN3 Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed
Gastrointestinal neuromuscular disease v1.25 EDN3 Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal