PanelApp

Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Prepair 500+ v1.1009 SACS Zornitza Stark Publications for gene: SACS were set to
Prepair 500+ v1.1008 SACS Zornitza Stark Tag SV/CNV tag was added to gene: SACS.
Prepair 500+ v1.1008 RYR1 Zornitza Stark Marked gene: RYR1 as ready
Prepair 500+ v1.1008 RYR1 Zornitza Stark Gene: ryr1 has been classified as Green List (High Evidence).
Prepair 500+ v1.1008 RYR1 Zornitza Stark Phenotypes for gene: RYR1 were changed from Central core disease, MIM# 117000; Neuromuscular disease, congenital, with uniform type 1 fiber, MIM# 117000 to Central core disease (MIM#117000); Minicore myopathy with external ophthalmoplegia (MIM#255320); Neuromuscular disease, congenital, with uniform type 1 fiber (MIM#117000)
Prepair 500+ v1.1007 RTEL1 Zornitza Stark Marked gene: RTEL1 as ready
Prepair 500+ v1.1007 RTEL1 Zornitza Stark Gene: rtel1 has been classified as Green List (High Evidence).
Prepair 500+ v1.1007 RTEL1 Zornitza Stark Phenotypes for gene: RTEL1 were changed from Dyskeratosis congenita, autosomal recessive 5, 615190 (3) to Dyskeratosis congenita, autosomal recessive 5, MIM#615190
Prepair 500+ v1.1006 RTEL1 Zornitza Stark Publications for gene: RTEL1 were set to
Prepair 500+ v1.1005 RPS6KA3 Zornitza Stark Marked gene: RPS6KA3 as ready
Prepair 500+ v1.1005 RPS6KA3 Zornitza Stark Gene: rps6ka3 has been classified as Green List (High Evidence).
Prepair 500+ v1.1005 RPS6KA3 Zornitza Stark Mode of inheritance for gene: RPS6KA3 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 500+ v1.1004 RPS6KA3 Zornitza Stark Phenotypes for gene: RPS6KA3 were changed from Coffin-Lowry syndrome to Coffin-Lowry syndrome, MIM#303600; Intellectual developmental disorder, X-linked 19; MIM#300844
Prepair 500+ v1.1003 RPS6KA3 Zornitza Stark Publications for gene: RPS6KA3 were set to
Prepair 500+ v1.1002 RPGRIP1L Zornitza Stark Marked gene: RPGRIP1L as ready
Prepair 500+ v1.1002 RPGRIP1L Zornitza Stark Gene: rpgrip1l has been classified as Green List (High Evidence).
Prepair 500+ v1.1002 RPGRIP1L Zornitza Stark Phenotypes for gene: RPGRIP1L were changed from Meckel syndrome 5, 611561 (3) to Joubert syndrome 7, MIM# 611560; Meckel syndrome 5, MIM# 611561; COACH syndrome 3, MIM# 619113; Ciliopathy, RPGRIP1L-related, MONDO:0005308
Prepair 500+ v1.1001 RPGRIP1L Zornitza Stark Publications for gene: RPGRIP1L were set to
Prepair 500+ v1.1000 RPE65 Zornitza Stark Marked gene: RPE65 as ready
Prepair 500+ v1.1000 RPE65 Zornitza Stark Gene: rpe65 has been classified as Green List (High Evidence).
Prepair 500+ v1.1000 RPE65 Zornitza Stark Phenotypes for gene: RPE65 were changed from Leber congenital amaurosis 2, 204100 (3) to Retinitis pigmentosa 20, MIM#613794; Leber congenital amaurosis 2, MIM#204100
Prepair 500+ v1.999 RP2 Zornitza Stark Marked gene: RP2 as ready
Prepair 500+ v1.999 RP2 Zornitza Stark Gene: rp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.999 RP2 Zornitza Stark Phenotypes for gene: RP2 were changed from Retinitis pigmentosa 2, 312600 (3) to Retinitis pigmentosa 2, MIM #312600
Prepair 500+ v1.998 RP2 Zornitza Stark Publications for gene: RP2 were set to
Prepair 500+ v1.997 RNASEH2C Zornitza Stark Marked gene: RNASEH2C as ready
Prepair 500+ v1.997 RNASEH2C Zornitza Stark Gene: rnaseh2c has been classified as Green List (High Evidence).
Prepair 500+ v1.997 RNASEH2C Zornitza Stark Phenotypes for gene: RNASEH2C were changed from Aicardi-Goutieres syndrome 3, 610329 (3) to Aicardi-Goutieres syndrome 3, MIM# 610329
Prepair 500+ v1.996 RNASEH2C Zornitza Stark Publications for gene: RNASEH2C were set to
Prepair 500+ v1.995 RNASEH2B Zornitza Stark Marked gene: RNASEH2B as ready
Prepair 500+ v1.995 RNASEH2B Zornitza Stark Gene: rnaseh2b has been classified as Green List (High Evidence).
Prepair 500+ v1.995 RNASEH2B Zornitza Stark Phenotypes for gene: RNASEH2B were changed from Aicardi-Goutieres syndrome 2, 610181 (3) to Aicardi-Goutieres syndrome 2 MIM#610181
Prepair 500+ v1.994 RNASEH2B Zornitza Stark Publications for gene: RNASEH2B were set to
Prepair 500+ v1.993 RNASEH2A Zornitza Stark Marked gene: RNASEH2A as ready
Prepair 500+ v1.993 RNASEH2A Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence).
Prepair 500+ v1.993 RNASEH2A Zornitza Stark Phenotypes for gene: RNASEH2A were changed from Aicardi-Goutieres syndrome 4, 610333 (3) to Aicardi-Goutieres syndrome 4 MIM#610333; RNASEH2A-related type 1 interferonopathy MONDO:0700259
Prepair 500+ v1.992 RNASEH2A Zornitza Stark Publications for gene: RNASEH2A were set to
Prepair 500+ v1.991 RMRP Zornitza Stark Marked gene: RMRP as ready
Prepair 500+ v1.991 RMRP Zornitza Stark Gene: rmrp has been classified as Green List (High Evidence).
Prepair 500+ v1.991 RMRP Zornitza Stark Phenotypes for gene: RMRP were changed from Cartilage-hair hypoplasia, 250250 (3) to Cartilage-hair hypoplasia MIM#250250; Anauxetic dysplasia 1, MIM#607095; Metaphyseal dysplasia without hypotrichosis MIM#250460
Prepair 500+ v1.990 RMRP Zornitza Stark Publications for gene: RMRP were set to
Prepair 500+ v1.989 RMND1 Zornitza Stark Marked gene: RMND1 as ready
Prepair 500+ v1.989 RMND1 Zornitza Stark Gene: rmnd1 has been classified as Green List (High Evidence).
Prepair 500+ v1.989 RMND1 Zornitza Stark Phenotypes for gene: RMND1 were changed from Combined oxidative phosphorylation deficiency 11, 614922 (3) to Combined oxidative phosphorylation deficiency 11, MIM#614922
Prepair 500+ v1.988 RMND1 Zornitza Stark Publications for gene: RMND1 were set to
Prepair 500+ v1.987 RDH12 Zornitza Stark Marked gene: RDH12 as ready
Prepair 500+ v1.987 RDH12 Zornitza Stark Gene: rdh12 has been classified as Green List (High Evidence).
Prepair 500+ v1.987 RDH12 Zornitza Stark Phenotypes for gene: RDH12 were changed from Leber congenital amaurosis 13, 612712 (3) to Leber congenital amaurosis 13, MIM#612712
Prepair 500+ v1.986 RDH12 Zornitza Stark Publications for gene: RDH12 were set to
Prepair 500+ v1.985 RBBP8 Zornitza Stark Marked gene: RBBP8 as ready
Prepair 500+ v1.985 RBBP8 Zornitza Stark Gene: rbbp8 has been classified as Green List (High Evidence).
Prepair 500+ v1.985 RBBP8 Zornitza Stark Phenotypes for gene: RBBP8 were changed from Seckel syndrome 2, 606744 (3) to Jawad syndrome MIM#251255; Seckel syndrome 2 MIM#606744
Prepair 500+ v1.984 RBBP8 Zornitza Stark Publications for gene: RBBP8 were set to
Prepair 500+ v1.983 RAX Zornitza Stark Marked gene: RAX as ready
Prepair 500+ v1.983 RAX Zornitza Stark Gene: rax has been classified as Green List (High Evidence).
Prepair 500+ v1.983 RAX Zornitza Stark Phenotypes for gene: RAX were changed from Microphthalmia, isolated 3, 611038 (3) to Microphthalmia, syndromic 16, MIM #611038
Prepair 500+ v1.982 RAX Zornitza Stark Publications for gene: RAX were set to
Prepair 500+ v1.981 RARS2 Zornitza Stark Marked gene: RARS2 as ready
Prepair 500+ v1.981 RARS2 Zornitza Stark Gene: rars2 has been classified as Green List (High Evidence).
Prepair 500+ v1.981 RARS2 Zornitza Stark Phenotypes for gene: RARS2 were changed from Pontocerebellar hypoplasia, type 6, 611523 (3) to Pontocerebellar hypoplasia, type 6, MIM#611523
Prepair 500+ v1.980 RARS2 Zornitza Stark Publications for gene: RARS2 were set to
Prepair 500+ v1.979 RAPSN Zornitza Stark Marked gene: RAPSN as ready
Prepair 500+ v1.979 RAPSN Zornitza Stark Gene: rapsn has been classified as Green List (High Evidence).
Prepair 500+ v1.979 RAPSN Zornitza Stark Phenotypes for gene: RAPSN were changed from Fetal akinesia deformation sequence, 208150 (3) to Myasthenic syndrome, congenital, 11, associated with acetylcholine receptor deficiency MIM#616326; Fetal akinesia deformation sequence 2 MIM#618388
Prepair 500+ v1.978 RAPSN Zornitza Stark Publications for gene: RAPSN were set to
Prepair 500+ v1.977 RAG2 Zornitza Stark Marked gene: RAG2 as ready
Prepair 500+ v1.977 RAG2 Zornitza Stark Gene: rag2 has been classified as Green List (High Evidence).
Prepair 500+ v1.977 RAG2 Zornitza Stark Phenotypes for gene: RAG2 were changed from Severe combined immunodeficiency, B cell-negative, 601457 (3) to Combined cellular and humoral immune defects with granulomas (MIM#233650); Omenn syndrome (MIM#603554); Severe combined immunodeficiency, B cell-negative (MIM#601457)
Prepair 500+ v1.976 RAG1 Zornitza Stark Marked gene: RAG1 as ready
Prepair 500+ v1.976 RAG1 Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence).
Prepair 500+ v1.976 RAG1 Zornitza Stark Phenotypes for gene: RAG1 were changed from Severe combined immunodeficiency, B cell-negative, 601457 (3) to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457
Prepair 500+ v1.975 RAB3GAP2 Zornitza Stark Marked gene: RAB3GAP2 as ready
Prepair 500+ v1.975 RAB3GAP2 Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence).
Prepair 500+ v1.975 RAB3GAP2 Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from Warburg micro syndrome 2, 614225 (3) to Warburg micro syndrome MONDO:0016649
Prepair 500+ v1.974 RAB3GAP2 Zornitza Stark Publications for gene: RAB3GAP2 were set to
Prepair 500+ v1.973 RAB3GAP1 Zornitza Stark Marked gene: RAB3GAP1 as ready
Prepair 500+ v1.973 RAB3GAP1 Zornitza Stark Gene: rab3gap1 has been classified as Green List (High Evidence).
Prepair 500+ v1.973 RAB3GAP1 Zornitza Stark Phenotypes for gene: RAB3GAP1 were changed from Warburg micro syndrome 1, 600118 (3) to Warburg micro syndrome 1, MIM# 600118; Martsolf syndrome 2, MIM# 619420
Prepair 500+ v1.972 RAB3GAP1 Zornitza Stark Publications for gene: RAB3GAP1 were set to
Prepair 500+ v1.971 RAB23 Zornitza Stark Marked gene: RAB23 as ready
Prepair 500+ v1.971 RAB23 Zornitza Stark Gene: rab23 has been classified as Green List (High Evidence).
Prepair 500+ v1.971 RAB23 Zornitza Stark Phenotypes for gene: RAB23 were changed from Carpenter syndrome, 201000 (3) to Carpenter syndrome MIM#201000
Prepair 500+ v1.970 RAB23 Zornitza Stark Publications for gene: RAB23 were set to
Prepair 500+ v1.969 RAB18 Zornitza Stark Marked gene: RAB18 as ready
Prepair 500+ v1.969 RAB18 Zornitza Stark Gene: rab18 has been classified as Green List (High Evidence).
Prepair 500+ v1.969 RAB18 Zornitza Stark Phenotypes for gene: RAB18 were changed from Warburg micro syndrome 3, 614222 (3) to Warburg micro syndrome 3 MIM#614222
Prepair 500+ v1.968 RAB18 Zornitza Stark Publications for gene: RAB18 were set to
Prepair 500+ v1.967 TMEM231 Seb Lunke Marked gene: TMEM231 as ready
Prepair 500+ v1.967 TMEM231 Seb Lunke Gene: tmem231 has been classified as Green List (High Evidence).
Prepair 500+ v1.967 TMEM231 Seb Lunke Phenotypes for gene: TMEM231 were changed from Joubert syndrome 20, 614970 (3) to Joubert syndrome 20, MIM#614970; Meckel syndrome 11, MIM#615397
Prepair 500+ v1.966 TMEM231 Seb Lunke Publications for gene: TMEM231 were set to
Prepair 500+ v1.965 TMEM237 Seb Lunke Marked gene: TMEM237 as ready
Prepair 500+ v1.965 TMEM237 Seb Lunke Gene: tmem237 has been classified as Green List (High Evidence).
Prepair 500+ v1.965 TMEM237 Seb Lunke Phenotypes for gene: TMEM237 were changed from Joubert syndrome 14, 614424 (3) to Joubert syndrome 14, MIM#614424
Prepair 500+ v1.964 TMEM237 Seb Lunke Publications for gene: TMEM237 were set to
Prepair 500+ v1.963 TMEM67 Seb Lunke Marked gene: TMEM67 as ready
Prepair 500+ v1.963 TMEM67 Seb Lunke Gene: tmem67 has been classified as Green List (High Evidence).
Prepair 500+ v1.963 TMEM67 Seb Lunke Phenotypes for gene: TMEM67 were changed from Joubert syndrome 6, 610688 (3) to COACH syndrome 1 MIM#216360; Joubert syndrome 6 MIM#610688; Meckel syndrome 3 MIM#607361; Nephronophthisis 11 MIM#613550
Prepair 500+ v1.962 TMEM67 Seb Lunke Publications for gene: TMEM67 were set to
Prepair 500+ v1.961 TMTC3 Seb Lunke Marked gene: TMTC3 as ready
Prepair 500+ v1.961 TMTC3 Seb Lunke Gene: tmtc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.961 TMTC3 Seb Lunke Phenotypes for gene: TMTC3 were changed from Lissencephaly 8, 617255 (3), Autosomal recessive to Lissencephaly 8 MIM#617255, MONDO:0014992
Prepair 500+ v1.960 TMTC3 Seb Lunke Publications for gene: TMTC3 were set to
Prepair 500+ v1.959 TOE1 Seb Lunke Marked gene: TOE1 as ready
Prepair 500+ v1.959 TOE1 Seb Lunke Gene: toe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.959 TOE1 Seb Lunke Phenotypes for gene: TOE1 were changed from Pontocerebellar hypoplasia, type 7, 614969 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 7 MIM#614969
Prepair 500+ v1.958 TOE1 Seb Lunke Publications for gene: TOE1 were set to
Prepair 500+ v1.957 TPP1 Seb Lunke Marked gene: TPP1 as ready
Prepair 500+ v1.957 TPP1 Seb Lunke Gene: tpp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.957 TPP1 Seb Lunke Phenotypes for gene: TPP1 were changed from Ceroid lipofuscinosis, neuronal, 2, 204500 (3) to Ceroid lipofuscinosis, neuronal, 2 MIM#204500; Spinocerebellar ataxia, autosomal recessive 7 MIM#609270
Prepair 500+ v1.956 TPP1 Seb Lunke Publications for gene: TPP1 were set to
Prepair 500+ v1.955 TRDN Seb Lunke Marked gene: TRDN as ready
Prepair 500+ v1.955 TRDN Seb Lunke Gene: trdn has been classified as Green List (High Evidence).
Prepair 500+ v1.955 TRDN Seb Lunke Phenotypes for gene: TRDN were changed from Ventricular tachycardia, catecholaminergic polymorphic, 5, with or without muscle weakness, 615441 (3) to Cardiac arrhythmia syndrome, with or without skeletal muscle weakness MIM#615441; Catecholaminergic polymorphic ventricular tachycardia MONDO:0017990
Prepair 500+ v1.954 TRDN Seb Lunke Publications for gene: TRDN were set to
Prepair 500+ v1.953 TREX1 Seb Lunke Marked gene: TREX1 as ready
Prepair 500+ v1.953 TREX1 Seb Lunke Gene: trex1 has been classified as Green List (High Evidence).
Prepair 500+ v1.953 TREX1 Seb Lunke Phenotypes for gene: TREX1 were changed from Aicardi-Goutieres syndrome 1, dominant and recessive, 225750 (3) to Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750, MONDO:0009165
Prepair 500+ v1.952 TREX1 Seb Lunke Publications for gene: TREX1 were set to
Prepair 500+ v1.951 TRIM32 Seb Lunke Marked gene: TRIM32 as ready
Prepair 500+ v1.951 TRIM32 Seb Lunke Gene: trim32 has been classified as Green List (High Evidence).
Prepair 500+ v1.951 TRIM32 Seb Lunke Publications for gene: TRIM32 were set to 9634523; 10399877; 17994549; 25351777; 19492423, 19303295, 31309175
Prepair 500+ v1.950 TRIM32 Seb Lunke Phenotypes for gene: TRIM32 were changed from Muscular dystrophy, limb-girdle, type 2H, 254110 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110
Prepair 500+ v1.949 TRIM32 Seb Lunke Publications for gene: TRIM32 were set to
Prepair 500+ v1.948 TRIM37 Seb Lunke Marked gene: TRIM37 as ready
Prepair 500+ v1.948 TRIM37 Seb Lunke Gene: trim37 has been classified as Green List (High Evidence).
Prepair 500+ v1.948 TRIM37 Seb Lunke Phenotypes for gene: TRIM37 were changed from Mulibrey nanism, 253250 (3) to Mulibrey nanism MIM#253250
Prepair 500+ v1.947 TRIM37 Seb Lunke Publications for gene: TRIM37 were set to
Prepair 500+ v1.946 TRMU Seb Lunke Marked gene: TRMU as ready
Prepair 500+ v1.946 TRMU Seb Lunke Gene: trmu has been classified as Green List (High Evidence).
Prepair 500+ v1.946 TRMU Seb Lunke Phenotypes for gene: TRMU were changed from Liver failure, transient infantile, 613070 (3) to Liver failure, transient infantile MIM# 613070; acute infantile liver failure due to synthesis defect of mtDNA-encoded proteins MONDO:0013111
Prepair 500+ v1.945 TRMU Seb Lunke Publications for gene: TRMU were set to
Prepair 500+ v1.944 TRPM6 Seb Lunke Marked gene: TRPM6 as ready
Prepair 500+ v1.944 TRPM6 Seb Lunke Gene: trpm6 has been classified as Green List (High Evidence).
Prepair 500+ v1.944 TRPM6 Seb Lunke Phenotypes for gene: TRPM6 were changed from Hypomagnesemia 1, intestinal, 602014 (3) to Hypomagnesemia 1, intestinal MIM#602014
Prepair 500+ v1.943 TRPM6 Seb Lunke Publications for gene: TRPM6 were set to
Prepair 500+ v1.942 TSEN2 Seb Lunke Marked gene: TSEN2 as ready
Prepair 500+ v1.942 TSEN2 Seb Lunke Gene: tsen2 has been classified as Green List (High Evidence).
Prepair 500+ v1.942 TSEN2 Seb Lunke Phenotypes for gene: TSEN2 were changed from Pontocerebellar hypoplasia type 2B, 612389 (3) to Pontocerebellar hypoplasia type 2B, MIM #612389
Prepair 500+ v1.941 TSEN2 Seb Lunke Publications for gene: TSEN2 were set to
Prepair 500+ v1.940 TSEN54 Seb Lunke Marked gene: TSEN54 as ready
Prepair 500+ v1.940 TSEN54 Seb Lunke Gene: tsen54 has been classified as Green List (High Evidence).
Prepair 500+ v1.940 TSEN54 Seb Lunke Phenotypes for gene: TSEN54 were changed from Pontocerebellar hypoplasia type 2A, 277470 (3) to Pontocerebellar hypoplasia type 2A (MIM#277470); Pontocerebellar hypoplasia type 4 (MIM#225753); ?Pontocerebellar hypoplasia type 5 (MIM#610204)
Prepair 500+ v1.939 TSEN54 Seb Lunke Publications for gene: TSEN54 were set to
Prepair 500+ v1.938 TSFM Seb Lunke Marked gene: TSFM as ready
Prepair 500+ v1.938 TSFM Seb Lunke Gene: tsfm has been classified as Green List (High Evidence).
Prepair 500+ v1.938 TSFM Seb Lunke Phenotypes for gene: TSFM were changed from Combined oxidative phosphorylation deficiency 3, 610505 (3) to Combined oxidative phosphorylation deficiency 3, MIM#610505
Prepair 500+ v1.937 TSFM Seb Lunke Publications for gene: TSFM were set to
Prepair 500+ v1.936 TSHB Seb Lunke Marked gene: TSHB as ready
Prepair 500+ v1.936 TSHB Seb Lunke Gene: tshb has been classified as Green List (High Evidence).
Prepair 500+ v1.936 TSHB Seb Lunke Phenotypes for gene: TSHB were changed from Hypothryoidism, congenital, nongoitrous 4, 275100 (3) to Hypothyroidism, congenital, nongoitrous 4 MIM#275100
Prepair 500+ v1.935 TSHB Seb Lunke Publications for gene: TSHB were set to
Prepair 500+ v1.934 TTC37 Seb Lunke Marked gene: TTC37 as ready
Prepair 500+ v1.934 TTC37 Seb Lunke Gene: ttc37 has been classified as Green List (High Evidence).
Prepair 500+ v1.934 TTC37 Seb Lunke Phenotypes for gene: TTC37 were changed from Trichohepatoenteric syndrome 1, 222470 (3) to Trichohepatoenteric syndrome 1 MIM#222470
Prepair 500+ v1.933 TTC37 Seb Lunke Publications for gene: TTC37 were set to
Prepair 500+ v1.932 TTC7A Seb Lunke Marked gene: TTC7A as ready
Prepair 500+ v1.932 TTC7A Seb Lunke Gene: ttc7a has been classified as Green List (High Evidence).
Prepair 500+ v1.932 TTC7A Seb Lunke Publications for gene: TTC7A were set to
Prepair 500+ v1.931 TTC8 Seb Lunke Marked gene: TTC8 as ready
Prepair 500+ v1.931 TTC8 Seb Lunke Gene: ttc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.931 TTC8 Seb Lunke Phenotypes for gene: TTC8 were changed from Bardet-Biedl syndrome 8, 615985 (3) to Bardet-Biedl syndrome 8, MIM #615985
Prepair 500+ v1.930 TTC8 Seb Lunke Publications for gene: TTC8 were set to
Prepair 500+ v1.929 TTPA Seb Lunke Marked gene: TTPA as ready
Prepair 500+ v1.929 TTPA Seb Lunke Gene: ttpa has been classified as Green List (High Evidence).
Prepair 500+ v1.929 TTPA Seb Lunke Phenotypes for gene: TTPA were changed from Ataxia with isolated vitamin E deficiency, 277460 (3) to Ataxia with isolated vitamin E deficiency MIM#277460
Prepair 500+ v1.928 TTPA Seb Lunke Publications for gene: TTPA were set to
Prepair 500+ v1.927 TULP1 Seb Lunke Marked gene: TULP1 as ready
Prepair 500+ v1.927 TULP1 Seb Lunke Gene: tulp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.927 TULP1 Seb Lunke Phenotypes for gene: TULP1 were changed from Retinitis pigmentosa 14, 600132 (3) to Leber congenital amaurosis 15, MIM#613843; Retinitis pigmentosa 14, MIM#600132
Prepair 500+ v1.926 TULP1 Seb Lunke Publications for gene: TULP1 were set to
Prepair 500+ v1.925 TWNK Seb Lunke Marked gene: TWNK as ready
Prepair 500+ v1.925 TWNK Seb Lunke Gene: twnk has been classified as Green List (High Evidence).
Prepair 500+ v1.925 TWNK Seb Lunke Phenotypes for gene: TWNK were changed from Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245 (3) to Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), MIM#271245; Perrault syndrome 5, MIM#616138
Prepair 500+ v1.924 TWNK Seb Lunke Publications for gene: TWNK were set to
Prepair 500+ v1.923 TYMP Seb Lunke Marked gene: TYMP as ready
Prepair 500+ v1.923 TYMP Seb Lunke Gene: tymp has been classified as Green List (High Evidence).
Prepair 500+ v1.923 TYMP Seb Lunke Phenotypes for gene: TYMP were changed from Mitochondrial DNA depletion syndrome 1 (MNGIE type), 603041 (3) to Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM#603041
Prepair 500+ v1.922 TYMP Seb Lunke Publications for gene: TYMP were set to
Prepair 500+ v1.921 TYR Seb Lunke Marked gene: TYR as ready
Prepair 500+ v1.921 TYR Seb Lunke Gene: tyr has been classified as Green List (High Evidence).
Prepair 500+ v1.921 TYR Seb Lunke Phenotypes for gene: TYR were changed from Albinism, oculocutaneous, type IA, 203100 (3) to Oculocutaneous albinism type 1 (MONDO:0018135); Albinism, oculocutaneous, type IA, MIM#203100; Albinism, oculocutaneous, type IB, MIM#606952
Prepair 500+ v1.920 TYR Seb Lunke Publications for gene: TYR were set to
Prepair 500+ v1.919 TYRP1 Seb Lunke Marked gene: TYRP1 as ready
Prepair 500+ v1.919 TYRP1 Seb Lunke Gene: tyrp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.919 TYRP1 Seb Lunke Phenotypes for gene: TYRP1 were changed from Albinism, oculocutaneous, type III, 203290 (3) to Albinism, oculocutaneous, type III MIM#203290
Prepair 500+ v1.918 TYRP1 Seb Lunke Publications for gene: TYRP1 were set to
Prepair 500+ v1.917 UBA5 Seb Lunke Marked gene: UBA5 as ready
Prepair 500+ v1.917 UBA5 Seb Lunke Gene: uba5 has been classified as Green List (High Evidence).
Prepair 500+ v1.917 UBA5 Seb Lunke Phenotypes for gene: UBA5 were changed from Epileptic encephalopathy, early infantile, 44, 617132 (3), Autosomal recessive to Developmental and epileptic encephalopathy 44, MIM#617132
Prepair 500+ v1.916 UBA5 Seb Lunke Publications for gene: UBA5 were set to
Prepair 500+ v1.915 UBE2T Seb Lunke Marked gene: UBE2T as ready
Prepair 500+ v1.915 UBE2T Seb Lunke Gene: ube2t has been classified as Green List (High Evidence).
Prepair 500+ v1.915 UBE2T Seb Lunke Phenotypes for gene: UBE2T were changed from Fanconi anemia, complementation group T, 616435 (3) to Fanconi anemia, complementation group T MIM#616435
Prepair 500+ v1.914 UBE2T Seb Lunke Publications for gene: UBE2T were set to 32646888; 26119737; 26046368; 26085575
Prepair 500+ v1.913 UBE2T Seb Lunke Publications for gene: UBE2T were set to
Prepair 500+ v1.912 UBR1 Seb Lunke Marked gene: UBR1 as ready
Prepair 500+ v1.912 UBR1 Seb Lunke Gene: ubr1 has been classified as Green List (High Evidence).
Prepair 500+ v1.912 UBR1 Seb Lunke Phenotypes for gene: UBR1 were changed from Johanson-Blizzard syndrome, 243800 (3) to Johanson-Blizzard syndrome MIM#243800
Prepair 500+ v1.911 UBR1 Seb Lunke Publications for gene: UBR1 were set to 24599544; 18553553; 16311597
Prepair 500+ v1.910 UBR1 Seb Lunke Publications for gene: UBR1 were set to
Prepair 500+ v1.909 UGT1A1 Seb Lunke Marked gene: UGT1A1 as ready
Prepair 500+ v1.909 UGT1A1 Seb Lunke Gene: ugt1a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.909 UGT1A1 Seb Lunke Phenotypes for gene: UGT1A1 were changed from Crigler-Najjar syndrome, type I, 218800 (3) to Bilirubin UDP-glucuronosyltransferase 1 deficiency (Disorders of bile acid metabolism and transport); Crigler-Najjar syndrome, type I MIM#218800; Crigler-Najjar syndrome, type II MIM#606785
Prepair 500+ v1.908 UGT1A1 Seb Lunke Publications for gene: UGT1A1 were set to
Prepair 500+ v1.907 UNC13D Seb Lunke Marked gene: UNC13D as ready
Prepair 500+ v1.907 UNC13D Seb Lunke Gene: unc13d has been classified as Green List (High Evidence).
Prepair 500+ v1.907 UNC13D Seb Lunke Phenotypes for gene: UNC13D were changed from Hemophagocytic lymphohistiocytosis, familial, 3, 608898 (3) to Hemophagocytic lymphohistiocytosis, familial, 3, MIM#608898
Prepair 500+ v1.906 UNC13D Seb Lunke Publications for gene: UNC13D were set to
Prepair 500+ v1.905 UPF3B Seb Lunke Marked gene: UPF3B as ready
Prepair 500+ v1.905 UPF3B Seb Lunke Gene: upf3b has been classified as Green List (High Evidence).
Prepair 500+ v1.905 UPF3B Seb Lunke Phenotypes for gene: UPF3B were changed from Mental retardation, X-linked, syndromic 14, 300676 (3) to Intellectual developmental disorder, X-linked syndromic 14 MIM#300676
Prepair 500+ v1.904 UPF3B Seb Lunke Publications for gene: UPF3B were set to
Prepair 500+ v1.903 USH1C Seb Lunke Marked gene: USH1C as ready
Prepair 500+ v1.903 USH1C Seb Lunke Gene: ush1c has been classified as Green List (High Evidence).
Prepair 500+ v1.903 USH1C Seb Lunke Phenotypes for gene: USH1C were changed from Usher syndrome, type 1C, 276904 (3) to Usher syndrome, type 1C MIM# 276904, MONDO:0010171
Prepair 500+ v1.902 USH1C Seb Lunke Publications for gene: USH1C were set to
Prepair 500+ v1.901 USH1G Seb Lunke Marked gene: USH1G as ready
Prepair 500+ v1.901 USH1G Seb Lunke Gene: ush1g has been classified as Green List (High Evidence).
Prepair 500+ v1.901 USH1G Seb Lunke Phenotypes for gene: USH1G were changed from Usher syndrome, type 1G, 606943 (3) to Usher syndrome, type 1G MIM#606943
Prepair 500+ v1.900 USH1G Seb Lunke Publications for gene: USH1G were set to
Prepair 500+ v1.899 USH2A Seb Lunke Marked gene: USH2A as ready
Prepair 500+ v1.899 USH2A Seb Lunke Gene: ush2a has been classified as Green List (High Evidence).
Prepair 500+ v1.899 USH2A Seb Lunke Phenotypes for gene: USH2A were changed from Usher syndrome, type 2A, 276901 (3) to Usher syndrome, type 2A, MIM#276901
Prepair 500+ v1.898 USH2A Seb Lunke Publications for gene: USH2A were set to
Prepair 500+ v1.897 USP9X Seb Lunke Marked gene: USP9X as ready
Prepair 500+ v1.897 USP9X Seb Lunke Gene: usp9x has been classified as Green List (High Evidence).
Prepair 500+ v1.897 USP9X Seb Lunke Phenotypes for gene: USP9X were changed from Intellectual developmental disorder 99 MIM#300919; syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968 to Intellectual developmental disorder, X-linked 99, MIM#300919
Prepair 500+ v1.896 USP9X Seb Lunke Publications for gene: USP9X were set to
Prepair 500+ v1.895 USP9X Seb Lunke Mode of inheritance for gene: USP9X was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Prepair 500+ v1.894 VLDLR Seb Lunke Marked gene: VLDLR as ready
Prepair 500+ v1.894 VLDLR Seb Lunke Gene: vldlr has been classified as Green List (High Evidence).
Prepair 500+ v1.894 VLDLR Seb Lunke Phenotypes for gene: VLDLR were changed from Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 (3) to Cerebellar hypoplasia, impaired intellectual development, and dysequilibrium syndrome 1, MIM#224050
Prepair 500+ v1.893 VLDLR Seb Lunke Publications for gene: VLDLR were set to
Prepair 500+ v1.892 VPS11 Seb Lunke Phenotypes for gene: VPS11 were changed from Leukodystrophy, hypomyelinating, 12 (MIM#616683) to Leukodystrophy, hypomyelinating, 12 MIM#616683
Prepair 500+ v1.891 VPS11 Seb Lunke Marked gene: VPS11 as ready
Prepair 500+ v1.891 VPS11 Seb Lunke Gene: vps11 has been classified as Green List (High Evidence).
Prepair 500+ v1.891 VPS11 Seb Lunke Phenotypes for gene: VPS11 were changed from Leukodystrophy, hypomyelinating, 12, 616683 (3), Autosomal recessive to Leukodystrophy, hypomyelinating, 12 (MIM#616683)
Prepair 500+ v1.890 VPS11 Seb Lunke Publications for gene: VPS11 were set to 27473128; 26307567; 27120463
Prepair 500+ v1.889 VPS53 Seb Lunke Marked gene: VPS53 as ready
Prepair 500+ v1.889 VPS53 Seb Lunke Gene: vps53 has been classified as Green List (High Evidence).
Prepair 500+ v1.889 VPS13B Seb Lunke Marked gene: VPS13B as ready
Prepair 500+ v1.889 VPS13B Seb Lunke Gene: vps13b has been classified as Green List (High Evidence).
Prepair 500+ v1.889 VPS13B Seb Lunke Phenotypes for gene: VPS13B were changed from Cohen syndrome, 216550 (3) to Cohen syndrome, MIM# 216550
Prepair 500+ v1.888 VPS13B Seb Lunke Publications for gene: VPS13B were set to
Prepair 500+ v1.887 VPS45 Seb Lunke Marked gene: VPS45 as ready
Prepair 500+ v1.887 VPS45 Seb Lunke Gene: vps45 has been classified as Green List (High Evidence).
Prepair 500+ v1.887 VPS45 Seb Lunke Phenotypes for gene: VPS45 were changed from Neutropenia, severe congenital, 5, autosomal recessive, 615285 (3) to Neutropaenia, severe congenital, 5, autosomal recessive, MIM# 615285
Prepair 500+ v1.886 VPS45 Seb Lunke Publications for gene: VPS45 were set to
Prepair 500+ v1.885 VPS53 Seb Lunke Phenotypes for gene: VPS53 were changed from Pontocerebellar hypoplasia, type 2E, 615851 (3) to Pontocerebellar hypoplasia, type 2E, MIM#615851
Prepair 500+ v1.884 VPS53 Seb Lunke Publications for gene: VPS53 were set to
Prepair 500+ v1.883 VRK1 Seb Lunke Marked gene: VRK1 as ready
Prepair 500+ v1.883 VRK1 Seb Lunke Gene: vrk1 has been classified as Green List (High Evidence).
Prepair 500+ v1.883 VRK1 Seb Lunke Phenotypes for gene: VRK1 were changed from Pontocerebellar hypoplasia type 1A, 607596 (3) to Pontocerebellar hypoplasia type 1A, MIM# 607596, MONDO:0011866; Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542
Prepair 500+ v1.882 VRK1 Seb Lunke Publications for gene: VRK1 were set to
Prepair 500+ v1.881 VSX2 Seb Lunke Marked gene: VSX2 as ready
Prepair 500+ v1.881 VSX2 Seb Lunke Gene: vsx2 has been classified as Green List (High Evidence).
Prepair 500+ v1.881 VSX2 Seb Lunke Phenotypes for gene: VSX2 were changed from Microphthalmia with coloboma 3, 610092 (3) to Microphthalmia with coloboma 3, MIM# 610092; Microphthalmia, isolated 2, MIM# 610093
Prepair 500+ v1.880 VSX2 Seb Lunke Publications for gene: VSX2 were set to
Prepair 500+ v1.879 WAS Seb Lunke Marked gene: WAS as ready
Prepair 500+ v1.879 WAS Seb Lunke Gene: was has been classified as Green List (High Evidence).
Prepair 500+ v1.879 WAS Seb Lunke Phenotypes for gene: WAS were changed from Wiskott-Aldrich syndrome, 301000 (3) to Neutropenia, severe congenital, X-linked, MIM#300299; Thrombocytopenia, X-linked, MIM#313900; Wiskott-Aldrich syndrome, MIM#301000
Prepair 500+ v1.878 WAS Seb Lunke Publications for gene: WAS were set to
Prepair 500+ v1.877 WDR34 Seb Lunke Marked gene: WDR34 as ready
Prepair 500+ v1.877 WDR34 Seb Lunke Gene: wdr34 has been classified as Green List (High Evidence).
Prepair 500+ v1.877 WDR34 Seb Lunke Phenotypes for gene: WDR34 were changed from Short-rib thoracic dysplasia 11 with or without polydactyly, 615633 (3) to Short-rib thoracic dysplasia 11 with or without polydactyly MIM# 615633, MONDO:0014287
Prepair 500+ v1.876 WDR34 Seb Lunke Publications for gene: WDR34 were set to
Prepair 500+ v1.875 WDR62 Seb Lunke Marked gene: WDR62 as ready
Prepair 500+ v1.875 WDR62 Seb Lunke Gene: wdr62 has been classified as Green List (High Evidence).
Prepair 500+ v1.875 WDR62 Seb Lunke Phenotypes for gene: WDR62 were changed from Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, 604317 (3) to Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM #604317
Prepair 500+ v1.874 WDR62 Seb Lunke Publications for gene: WDR62 were set to
Prepair 500+ v1.873 WDR81 Seb Lunke Marked gene: WDR81 as ready
Prepair 500+ v1.873 WDR81 Seb Lunke Gene: wdr81 has been classified as Green List (High Evidence).
Prepair 500+ v1.873 WDR81 Seb Lunke Phenotypes for gene: WDR81 were changed from Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185 (3) to Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2 MIM#610185, MONDO:0012430; Hydrocephalus, congenital, 3, with brain anomalies MIM#617967, MONDO:0054794
Prepair 500+ v1.872 WDR81 Seb Lunke Publications for gene: WDR81 were set to
Prepair 500+ v1.871 WHRN Seb Lunke Marked gene: WHRN as ready
Prepair 500+ v1.871 WHRN Seb Lunke Gene: whrn has been classified as Green List (High Evidence).
Prepair 500+ v1.871 WHRN Seb Lunke Phenotypes for gene: WHRN were changed from Usher syndrome, type 2D, 611383 (3) to Usher syndrome, type 2D MIM#611383
Prepair 500+ v1.870 WHRN Seb Lunke Publications for gene: WHRN were set to
Prepair 500+ v1.869 WISP3 Seb Lunke Marked gene: WISP3 as ready
Prepair 500+ v1.869 WISP3 Seb Lunke Gene: wisp3 has been classified as Green List (High Evidence).
Prepair 500+ v1.869 WISP3 Seb Lunke Phenotypes for gene: WISP3 were changed from Arthropathy, progressive pseudorheumatoid, of childhood, 208230 (3) to Progressive pseudorheumatoid dysplasia MIM#208230
Prepair 500+ v1.868 WISP3 Seb Lunke Publications for gene: WISP3 were set to
Prepair 500+ v1.867 WRN Seb Lunke Marked gene: WRN as ready
Prepair 500+ v1.867 WRN Seb Lunke Gene: wrn has been classified as Green List (High Evidence).
Prepair 500+ v1.867 WRN Seb Lunke Phenotypes for gene: WRN were changed from Werner syndrome, 277700 (3) to Werner syndrome, MIM#277700
Prepair 500+ v1.866 WRN Seb Lunke Publications for gene: WRN were set to
Prepair 500+ v1.865 WWOX Seb Lunke Marked gene: WWOX as ready
Prepair 500+ v1.865 WWOX Seb Lunke Gene: wwox has been classified as Green List (High Evidence).
Prepair 500+ v1.865 WWOX Seb Lunke Phenotypes for gene: WWOX were changed from Epileptic encephalopathy, early infantile, 28, 616211 (3) to Spinocerebellar ataxia, autosomal recessive 12, MIM# 614322; Developmental and epileptic encephalopathy 28, MIM# 616211
Prepair 500+ v1.864 WWOX Seb Lunke Publications for gene: WWOX were set to
Prepair 500+ v1.863 XIAP Seb Lunke Marked gene: XIAP as ready
Prepair 500+ v1.863 XIAP Seb Lunke Gene: xiap has been classified as Green List (High Evidence).
Prepair 500+ v1.863 XIAP Seb Lunke Phenotypes for gene: XIAP were changed from Lymphoproliferative syndrome, X-linked, 2, 300635 (3) to Lymphoproliferative syndorme, X-linked, 2 MIM#300635
Prepair 500+ v1.862 XIAP Seb Lunke Publications for gene: XIAP were set to
Prepair 500+ v1.861 XPA Seb Lunke Marked gene: XPA as ready
Prepair 500+ v1.861 XPA Seb Lunke Gene: xpa has been classified as Green List (High Evidence).
Prepair 500+ v1.861 XPA Seb Lunke Phenotypes for gene: XPA were changed from Xeroderma pigmentosum, group A, 278700 (3) to Xeroderma pigmentosum, group A , MIM#278700
Prepair 500+ v1.860 XPC Seb Lunke Marked gene: XPC as ready
Prepair 500+ v1.860 XPC Seb Lunke Gene: xpc has been classified as Green List (High Evidence).
Prepair 500+ v1.860 XPC Seb Lunke Phenotypes for gene: XPC were changed from Xeroderma pigmentosum, group C, 278720 (3) to Xeroderma pigmentosum, group C, MIM#278720
Prepair 500+ v1.859 XPC Seb Lunke Publications for gene: XPC were set to
Prepair 500+ v1.858 YARS2 Seb Lunke Marked gene: YARS2 as ready
Prepair 500+ v1.858 YARS2 Seb Lunke Gene: yars2 has been classified as Green List (High Evidence).
Prepair 500+ v1.858 YARS2 Seb Lunke Phenotypes for gene: YARS2 were changed from Myopathy, lactic acidosis, and sideroblastic anemia 2, 613561 (3) to Myopathy, lactic acidosis, and sideroblastic anemia 2 MIM#613561
Prepair 500+ v1.857 YARS2 Seb Lunke Publications for gene: YARS2 were set to
Prepair 500+ v1.856 ZBTB24 Seb Lunke Marked gene: ZBTB24 as ready
Prepair 500+ v1.856 ZBTB24 Seb Lunke Gene: zbtb24 has been classified as Green List (High Evidence).
Prepair 500+ v1.856 ZBTB24 Seb Lunke Phenotypes for gene: ZBTB24 were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome-2, 614069 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069; MONDO:0013553
Prepair 500+ v1.855 ZBTB24 Seb Lunke Publications for gene: ZBTB24 were set to
Intellectual disability syndromic and non-syndromic v1.148 PIP5K1C Sarah Pantaleo reviewed gene: PIP5K1C: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder (MONDO:0700092), PIP5K1C-related; Mode of inheritance: None
Mendeliome v1.2599 DNAH12 Zornitza Stark Marked gene: DNAH12 as ready
Mendeliome v1.2599 DNAH12 Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence).
Mendeliome v1.2599 DNAH12 Zornitza Stark Classified gene: DNAH12 as Green List (high evidence)
Mendeliome v1.2599 DNAH12 Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence).
Mendeliome v1.2598 DNAH12 Zornitza Stark gene: DNAH12 was added
gene: DNAH12 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DNAH12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAH12 were set to 39071892; 40146200
Phenotypes for gene: DNAH12 were set to Spermatogenic failure 100, MIM# 621209
Review for gene: DNAH12 was set to GREEN
Added comment: Twelve individuals from 7 families and two mouse models support this association
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.82 DNAH12 Zornitza Stark Marked gene: DNAH12 as ready
Infertility and Recurrent Pregnancy Loss v0.82 DNAH12 Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.82 DNAH12 Zornitza Stark Classified gene: DNAH12 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.82 DNAH12 Zornitza Stark Gene: dnah12 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.81 DNAH12 Zornitza Stark gene: DNAH12 was added
gene: DNAH12 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: DNAH12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAH12 were set to 39071892; 40146200
Phenotypes for gene: DNAH12 were set to Spermatogenic failure 100, MIM# 621209
Review for gene: DNAH12 was set to GREEN
Added comment: Twelve individuals from 7 families and two mouse models support this association.
Sources: Literature
Fetal anomalies v1.362 TTC26 Zornitza Stark Marked gene: TTC26 as ready
Fetal anomalies v1.362 TTC26 Zornitza Stark Gene: ttc26 has been classified as Green List (High Evidence).
Fetal anomalies v1.362 TTC26 Zornitza Stark Classified gene: TTC26 as Green List (high evidence)
Fetal anomalies v1.362 TTC26 Zornitza Stark Gene: ttc26 has been classified as Green List (High Evidence).
Fetal anomalies v1.361 TTC26 Zornitza Stark gene: TTC26 was added
gene: TTC26 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: TTC26 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TTC26 were set to 34177428; 32617964; 31595528; 24596149; 22718903
Phenotypes for gene: TTC26 were set to Biliary, renal, neurologic, and skeletal syndrome, MIM# 619534
Review for gene: TTC26 was set to GREEN
Added comment: 9 families and functional data including zebrafish model. Multiple congenital anomalies likely identifiable by US.
Sources: Literature
Fetal anomalies v1.360 TOGARAM1 Zornitza Stark Phenotypes for gene: TOGARAM1 were changed from Cerebral dysgenesis; Cleft of the lip and palate; Hydrocephalus; Microphthalmia to Joubert syndrome 37, MIM# 619185
Fetal anomalies v1.359 TOGARAM1 Zornitza Stark Classified gene: TOGARAM1 as Green List (high evidence)
Fetal anomalies v1.359 TOGARAM1 Zornitza Stark Gene: togaram1 has been classified as Green List (High Evidence).
Fetal anomalies v1.358 TOGARAM1 Zornitza Stark edited their review of gene: TOGARAM1: Added comment: PMID 32453716: 5 unrelated individuals with Joubert syndrome.; Changed rating: GREEN; Changed publications: 32747439, 32453716; Changed phenotypes: Joubert syndrome 37, MIM# 619185
Fetal anomalies v1.358 KIF3B Zornitza Stark Marked gene: KIF3B as ready
Fetal anomalies v1.358 KIF3B Zornitza Stark Gene: kif3b has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.358 KIF3B Zornitza Stark Classified gene: KIF3B as Amber List (moderate evidence)
Fetal anomalies v1.358 KIF3B Zornitza Stark Gene: kif3b has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.357 KIF3B Zornitza Stark gene: KIF3B was added
gene: KIF3B was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: KIF3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF3B were set to 32386558; 38665936
Phenotypes for gene: KIF3B were set to Retinitis pigmentosa 89, MIM#618955; polydactyly
Review for gene: KIF3B was set to AMBER
Added comment: Two families reported with supportive functional data. Predominant phenotype is RP, however polydactyly reported, which would be detectable by US.
Sources: Literature
Skeletal dysplasia v0.310 IFT81 Zornitza Stark Marked gene: IFT81 as ready
Skeletal dysplasia v0.310 IFT81 Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.310 IFT81 Zornitza Stark Classified gene: IFT81 as Green List (high evidence)
Skeletal dysplasia v0.310 IFT81 Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 IFT81 Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357
Skeletal Dysplasia_Fetal v0.232 IFT81 Zornitza Stark Publications for gene: IFT81 were set to 27666822; 30080953
Skeletal Dysplasia_Fetal v0.231 IFT81 Zornitza Stark Classified gene: IFT81 as Green List (high evidence)
Skeletal Dysplasia_Fetal v0.231 IFT81 Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence).
Skeletal Dysplasia_Fetal v0.230 IFT81 Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357
Fetal anomalies v1.356 IFT81 Zornitza Stark Classified gene: IFT81 as Green List (high evidence)
Fetal anomalies v1.356 IFT81 Zornitza Stark Gene: ift81 has been classified as Green List (High Evidence).
Fetal anomalies v1.355 IFT81 Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed rating: GREEN; Changed publications: 27666822, 37427975, 32783357
Ciliopathies v1.71 IFT81 Zornitza Stark edited their review of gene: IFT81: Changed rating: GREEN
Ciliopathies v1.71 IFT81 Zornitza Stark edited their review of gene: IFT81: Added comment: More than 5 families reported with a skeletal ciliopathy.; Changed publications: 27666822, 37427975, 32783357
Fetal anomalies v1.355 FGF4 Zornitza Stark Marked gene: FGF4 as ready
Fetal anomalies v1.355 FGF4 Zornitza Stark Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.355 FGF4 Zornitza Stark Classified gene: FGF4 as Amber List (moderate evidence)
Fetal anomalies v1.355 FGF4 Zornitza Stark Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.354 FGF4 Zornitza Stark gene: FGF4 was added
gene: FGF4 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF4 were set to 40259859
Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770
Review for gene: FGF4 was set to AMBER
Added comment: Two families with three affected individuals reported with homozygous variants in FGF4.

Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased.
Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings.
Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1)

Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy)
Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1)
Sources: Literature
Fetal anomalies v1.353 DCDC2 Zornitza Stark Publications for gene: DCDC2 were set to 25557784; 31821705
Fetal anomalies v1.352 DCDC2 Zornitza Stark Classified gene: DCDC2 as Green List (high evidence)
Fetal anomalies v1.352 DCDC2 Zornitza Stark Gene: dcdc2 has been classified as Green List (High Evidence).
Fetal anomalies v1.351 DCDC2 Zornitza Stark edited their review of gene: DCDC2: Added comment: DEFINITIVE by ClinGen.; Changed rating: GREEN; Changed publications: 27469900, 25557784, 31821705
Fetal anomalies v1.351 CEP76 Zornitza Stark Marked gene: CEP76 as ready
Fetal anomalies v1.351 CEP76 Zornitza Stark Gene: cep76 has been classified as Green List (High Evidence).
Fetal anomalies v1.351 CEP76 Zornitza Stark Classified gene: CEP76 as Green List (high evidence)
Fetal anomalies v1.351 CEP76 Zornitza Stark Gene: cep76 has been classified as Green List (High Evidence).
Fetal anomalies v1.350 CEP76 Zornitza Stark gene: CEP76 was added
gene: CEP76 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: CEP76 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP76 were set to complex neurodevelopmental disorder MONDO:0100038
Review for gene: CEP76 was set to GREEN
Added comment: Erica Davis, Stanley Manne Children’s research institute, Chicago
ESHG presentation 4/6/24, unpublished

CEP76 associated with syndromic ciliopathy

CEP76 localizes to centrioles and basal body primary cilia
Role in normal centriolar duplication

Index case
Bardet Biedl syndrome
Compound heterozygous pLoF variants in CEP76

Via Gene matcher
7 cases in 7 families- biallelic CEP76 and various clinical features within ciliopathy spectrum:
Obesity
Ocular phenotype
Structural brain anomalies
Renal?

3/7 families clinical Dx Joubert syndrome
1/7 BBS
1/7 GDD/ID NOS
2/7 retinitis pigmentosa (1 of these with learning difficulties)

Mixture of biallelic pLOF and missense variant

CEP76 knockout zebrafish model shows retinal phenotype w photoreceptor loss, similar to homozygous known BBS4 pathogenic variant

Cell based fx studies with missense variants above, consistent with centriolar duplication dysfunction
Sources: Literature
Fetal anomalies v1.349 CCDC32 Zornitza Stark Marked gene: CCDC32 as ready
Fetal anomalies v1.349 CCDC32 Zornitza Stark Gene: ccdc32 has been classified as Green List (High Evidence).
Fetal anomalies v1.349 CCDC32 Zornitza Stark Classified gene: CCDC32 as Green List (high evidence)
Fetal anomalies v1.349 CCDC32 Zornitza Stark Gene: ccdc32 has been classified as Green List (High Evidence).
Fetal anomalies v1.348 CCDC32 Zornitza Stark gene: CCDC32 was added
gene: CCDC32 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: CCDC32 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC32 were set to 32307552
Phenotypes for gene: CCDC32 were set to Cardiofacioneurodevelopmental syndrome (CFNDS), MIM#619123
Review for gene: CCDC32 was set to GREEN
Added comment: Two unrelated consanguineous families with probands with homozygous frameshift variants reported. Phenotype is a congenital syndrome characterized by craniofacial, cardiac and neurodevelopmental anomalies. Functional studies in zebrafish show that ccdc32 depletion impairs cilia formation and shows a role for ccdc32 in craniofacial, brain and left/right axis development.
Sources: Literature
Fetal anomalies v1.347 CBY1 Zornitza Stark Marked gene: CBY1 as ready
Fetal anomalies v1.347 CBY1 Zornitza Stark Gene: cby1 has been classified as Green List (High Evidence).
Fetal anomalies v1.347 CBY1 Zornitza Stark Classified gene: CBY1 as Green List (high evidence)
Fetal anomalies v1.347 CBY1 Zornitza Stark Gene: cby1 has been classified as Green List (High Evidence).
Fetal anomalies v1.346 CBY1 Zornitza Stark gene: CBY1 was added
gene: CBY1 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: CBY1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CBY1 were set to 33131181; 25103236; 25220153
Phenotypes for gene: CBY1 were set to Joubert syndrome, MONDO:0018772, CBY1-related
Review for gene: CBY1 was set to GREEN
Added comment: Two unrelated consanguineous families with LoF variants and multiple animal models.
Sources: Literature
Fetal anomalies v1.345 ADAMTS9 Zornitza Stark Marked gene: ADAMTS9 as ready
Fetal anomalies v1.345 ADAMTS9 Zornitza Stark Gene: adamts9 has been classified as Red List (Low Evidence).
Fetal anomalies v1.345 ADAMTS9 Zornitza Stark gene: ADAMTS9 was added
gene: ADAMTS9 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: ADAMTS9 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADAMTS9 were set to 30609407
Phenotypes for gene: ADAMTS9 were set to Nephropathy-related ciliopathy, MONDO:0022409, ADAMTS9-related
Review for gene: ADAMTS9 was set to RED
Added comment: LIMITED by ClinGen, several families reported with bi-allelic variants and variable features of a ciliopathy. However, evidence presented deemed of poor quality due to a variety of factors. RED on this panel.
Sources: Literature
Severe early-onset obesity v1.17 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985
Severe early-onset obesity v1.16 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Severe early-onset obesity v1.16 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Severe early-onset obesity v1.15 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Intellectual disability syndromic and non-syndromic v1.148 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985
Intellectual disability syndromic and non-syndromic v1.147 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.147 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.146 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported.; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Renal Ciliopathies and Nephronophthisis v1.31 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034
Renal Ciliopathies and Nephronophthisis v1.30 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Renal Ciliopathies and Nephronophthisis v1.30 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Renal Ciliopathies and Nephronophthisis v1.29 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Mendeliome v1.2597 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Mendeliome v1.2597 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Mendeliome v1.2596 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Bardet Biedl syndrome v1.14 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034
Bardet Biedl syndrome v1.13 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Bardet Biedl syndrome v1.13 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Bardet Biedl syndrome v1.12 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Ciliopathies v1.71 BBIP1 Zornitza Stark Publications for gene: BBIP1 were set to 24026985; 32055034
Ciliopathies v1.70 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Ciliopathies v1.70 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Ciliopathies v1.69 BBIP1 Zornitza Stark edited their review of gene: BBIP1: Added comment: Third family with homozygous LoF variant reported; Changed rating: GREEN; Changed publications: 24026985, 32055034, 37239474
Fetal anomalies v1.344 BBIP1 Zornitza Stark Marked gene: BBIP1 as ready
Fetal anomalies v1.344 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Fetal anomalies v1.344 BBIP1 Zornitza Stark Classified gene: BBIP1 as Green List (high evidence)
Fetal anomalies v1.344 BBIP1 Zornitza Stark Gene: bbip1 has been classified as Green List (High Evidence).
Fetal anomalies v1.343 BBIP1 Zornitza Stark gene: BBIP1 was added
gene: BBIP1 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: BBIP1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BBIP1 were set to 24026985; 32055034; 37239474
Phenotypes for gene: BBIP1 were set to Bardet-Biedl syndrome 18, MIM#615995
Review for gene: BBIP1 was set to GREEN
Added comment: PMID: 24026985 - Single patient with BBS described with bi-allelic variants in this gene.

PMID: 32055034 - An additional patient with classic BBS with a homozygous splice variant confirmed by RT-PCR to result in NMD

PMID 37239474: third family with homozygous LoF variant
Sources: Literature
Fetal anomalies v1.342 SLC30A7 Zornitza Stark Marked gene: SLC30A7 as ready
Fetal anomalies v1.342 SLC30A7 Zornitza Stark Gene: slc30a7 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.342 SLC30A7 Zornitza Stark Classified gene: SLC30A7 as Amber List (moderate evidence)
Fetal anomalies v1.342 SLC30A7 Zornitza Stark Gene: slc30a7 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.341 SLC30A7 Zornitza Stark gene: SLC30A7 was added
gene: SLC30A7 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: SLC30A7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SLC30A7 were set to 35751429
Phenotypes for gene: SLC30A7 were set to Joubert syndrome (MONDO:0018772), SLC30A7-related
Review for gene: SLC30A7 was set to AMBER
Added comment: PMID: 35751429: Two individuals reported with de novo variants, one missense and one delins resulting in missense. The first individual is a female with history of unilateral postaxial polydactyly, classic molar tooth sign on MRI, macrocephaly, ataxia, ocular motor apraxia, neurodevelopmental delay, and precocious puberty. The second individual had bilateral postaxial polydactyly, molar tooth sign, macrocephaly, developmental delay, and an extra oral frenulum. No functional studies reported.
Sources: Literature
Fetal anomalies v1.340 SCNM1 Zornitza Stark Marked gene: SCNM1 as ready
Fetal anomalies v1.340 SCNM1 Zornitza Stark Gene: scnm1 has been classified as Green List (High Evidence).
Fetal anomalies v1.340 SCNM1 Zornitza Stark Classified gene: SCNM1 as Green List (high evidence)
Fetal anomalies v1.340 SCNM1 Zornitza Stark Gene: scnm1 has been classified as Green List (High Evidence).
Fetal anomalies v1.339 SCNM1 Zornitza Stark gene: SCNM1 was added
gene: SCNM1 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: SCNM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SCNM1 were set to 36084634
Phenotypes for gene: SCNM1 were set to Orofaciodigital syndrome XIX, MIM# 620107
Review for gene: SCNM1 was set to GREEN
Added comment: Iturrate (2022): three unrelated families (4 affected) w/ OFD, polydactyly, syndactyly and brachydactyly. All had biallelic variants (fs, missense, AluYc1 sequence insertion) and were consanguinous
- the missense variant was shown to have a splice outcome
Sources: Literature
Fetal anomalies v1.338 LEF1 Zornitza Stark Marked gene: LEF1 as ready
Fetal anomalies v1.338 LEF1 Zornitza Stark Gene: lef1 has been classified as Green List (High Evidence).
Fetal anomalies v1.338 LEF1 Zornitza Stark Classified gene: LEF1 as Green List (high evidence)
Fetal anomalies v1.338 LEF1 Zornitza Stark Gene: lef1 has been classified as Green List (High Evidence).
Fetal anomalies v1.337 LEF1 Zornitza Stark gene: LEF1 was added
gene: LEF1 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: LEF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: LEF1 were set to 32022899; 35583550
Phenotypes for gene: LEF1 were set to Syndromic disease, MONDO:0002254, LEF1-related
Review for gene: LEF1 was set to GREEN
Added comment: Monoallelic variants in LEF1 reported in 11 affected individuals from 4 unrelated families, and a biallelic variant reported in an affected individual from a consanguineous family. The phenotypic spectrum included various limb malformations, such as radial ray defects, polydactyly or split hand/foot, and ectodermal dysplasia. Haploinsufficiency or loss of DNA binding postulated to be responsible for a mild to moderate phenotype, whereas loss of β-catenin binding caused by biallelic variants postulated to be associated with a severe phenotype.
Sources: Literature
Fetal anomalies v1.336 IFT57 Zornitza Stark Marked gene: IFT57 as ready
Fetal anomalies v1.336 IFT57 Zornitza Stark Gene: ift57 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.336 IFT57 Zornitza Stark Classified gene: IFT57 as Amber List (moderate evidence)
Fetal anomalies v1.336 IFT57 Zornitza Stark Gene: ift57 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.335 IFT57 Zornitza Stark gene: IFT57 was added
gene: IFT57 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to 40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308, IFT57-related
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Learning difficulties
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Congenital ophthalmoplegia v1.10 MAFB Zornitza Stark Marked gene: MAFB as ready
Congenital ophthalmoplegia v1.10 MAFB Zornitza Stark Gene: mafb has been classified as Green List (High Evidence).
Congenital ophthalmoplegia v1.10 MAFB Zornitza Stark Classified gene: MAFB as Green List (high evidence)
Congenital ophthalmoplegia v1.10 MAFB Zornitza Stark Gene: mafb has been classified as Green List (High Evidence).
Congenital ophthalmoplegia v1.9 MAFB Zornitza Stark gene: MAFB was added
gene: MAFB was added to Congenital ophthalmoplegia. Sources: Literature
Mode of inheritance for gene: MAFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: MAFB were set to 27181683; 34964110; 29779709
Phenotypes for gene: MAFB were set to Duane retraction syndrome 3, MIM# 617041
Review for gene: MAFB was set to GREEN
Added comment: At least 5 families reported with variants in this gene and Duane anomaly, supportive functional data. Some individuals also had inner ear agenesis and glomerular disease.
Sources: Literature
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark Deleted their review
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark commented on gene: ACADM
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark Marked gene: ACADM as ready
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark Gene: acadm has been classified as Green List (High Evidence).
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark Classified gene: ACADM as Green List (high evidence)
Genomic newborn screening: ICoNS v0.3 ACADM Zornitza Stark Gene: acadm has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.146 FAM177A1 Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177a1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152
Intellectual disability syndromic and non-syndromic v1.145 FAM177A1 Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2596 FAM177A1 Zornitza Stark Phenotypes for gene: FAM177A1 were changed from Neurodevelopmental disorder, MONDO_0100500, FAM177A1-related to Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152
Mendeliome v1.2595 FAM177A1 Zornitza Stark reviewed gene: FAM177A1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genomic newborn screening: ICoNS v0.2 ACADVL Lilian Downie gene: ACADVL was added
gene: ACADVL was added to Genomic newborn screening: ICoNS. Sources: Expert list
Mode of inheritance for gene: ACADVL was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ACADVL were set to PMID: 20301763; 32885845; 31372341
Phenotypes for gene: ACADVL were set to VLCAD deficiency MIM#201475
Review for gene: ACADVL was set to GREEN
Added comment: Well established gene-disease association.

VLCAD deficiency can be classified clinically into 3 forms: a severe early-onset form with high incidence of cardiomyopathy and high mortality; an intermediate form with childhood onset, usually with hypoketotic hypoglycemia and more favorable outcome; and an adult-onset, myopathic form with isolated skeletal muscle involvement, rhabdomyolysis, and myoglobinuria after exercise or fasting.

- Severe disease is associated with no residual enzyme activity, often resulting from null variants. Approximately 81% of pathogenic truncating variants in ACADVL are associated with the severe early-onset form [Andresen et al 1999].
- A specific homozygous missense pathogenic variant (c.709T>C;p.Cys237Arg) leading to low long-chain fatty acid oxidation flux may also be associated with cardiac disease [Diekman et al 2015].
- Milder childhood and adult forms are often associated with residual enzyme activity. The common p.Val283Ala variant, in both homozygous and compound heterozygous genotypes, is typically associated with the non-cardiac phenotypes [Spiekerkoetter et al 2009, Diekman et al 2015, Miller et al 2015].

Treatment: avoid fasting, carnitine, restrict LCFA, bezafibrate, triheptanoin

On BabyScreen+, BabySeq, BeginNGS, Guardian, Generation and EarlyCheck
Sources: Expert list
Genomic newborn screening: ICoNS v0.1 ACADM Lilian Downie gene: ACADM was added
gene: ACADM was added to Genomic newborn screening: ICoNS. Sources: Expert list
Mode of inheritance for gene: ACADM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADM were set to Acyl-CoA dehydrogenase, medium chain, deficiency of MIM# 201450
Review for gene: ACADM was set to GREEN
Added comment: Well established gene-disease association.

Inherited deficiency of medium-chain acyl-CoA dehydrogenase is characterized by intolerance to prolonged fasting, recurrent episodes of hypoglycemic coma with medium-chain dicarboxylic aciduria, impaired ketogenesis, and low plasma and tissue carnitine levels. Can be severe, potentially fatal.

Typical presentation is between 3 and 24 months.

More than 98% of cases of MCAD deficiency have a pathogenic variant in ACADM, with the c.985A>G variant accounting for between 56-91% of cases.

Treatment: management plan to avoid fasting.

ClinGen: Strong Actionability in paediatric patients.

Non-genetic confirmatory tests: Urine acylglycine analysis

Included in BabyScreen+, BabySeq, BeginNGS, Guardian, Generation, EarlyCheck
Sources: Expert list
Infertility and Recurrent Pregnancy Loss v0.80 NLRP14 Jasmine Chew gene: NLRP14 was added
gene: NLRP14 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: NLRP14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NLRP14 were set to 38060382
Phenotypes for gene: NLRP14 were set to Oocyte maturation defect and early embryo arrest
Review for gene: NLRP14 was set to AMBER
Added comment: PMID: 38060382- Compound heterozygous variants (p.Cys428Profs∗28/p.Leu887delinsArgTyr) reported in an infertile woman with oocyte maturation defects and early embryo arrest (EEA).
- Functional analysis showed comparable protein levels compared with the wild-type control, although a truncated band of the expected size (47 kDa) was observed for the p.Cys428Profs∗28 variant.
-The truncated variant, p.Cys428Profs∗28, is lacking the LRR domain and, hence, completely loses the ability to bind with UHRF1. The p.Leu887delinsArgTyr variant results in significant alteration in binding modes with decreased binding area and binding free energy, which introduced regional instability in the NLRP14-UHRF1 interaction. The interaction of both variants and UHRF1 was disrupted and might lead to increased UHRF1 protein degradation in oocytes.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.80 OOEP Jasmine Chew edited their review of gene: OOEP: Changed phenotypes: Recurrent preimplantation embryonic arrest, Female infertility due to oocyte meiotic arrest, MONDO:0044626
Infertility and Recurrent Pregnancy Loss v0.80 OOEP Jasmine Chew gene: OOEP was added
gene: OOEP was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: OOEP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OOEP were set to 35946397
Phenotypes for gene: OOEP were set to Recurrent preimplantation embryonic arrest
Review for gene: OOEP was set to AMBER
Added comment: i) PMID: 35946397- Compound heterozygous missense variants (p.Arg37Gly and p.Arg37Pro) identified in a patient who experienced recurrent preimplantation embryonic arrest.
- Immunofluorescence and western blot analysis showed that both variants lead to reduced OOEP protein expression compared with that in the wild type.
- Transcriptomic analysis showed that mutant OOEP‐affected embryos had downregulation of gene transcripts, indicating that substantial number of mRNAs were not transcribed or were decayed in the affected embryo. The GO analysis results revealed that these downregulated genes were mainly enriched in protein binding, translation, mRNA processing, and mitochondrial function.

ii) PMID: 39379527- showed functionally that the two reported variants result in significantly destabilizing intercomponent interactions among the subcortical maternal complex (SCMC) subunits.
Sources: Literature
Retinitis pigmentosa v0.159 PDE6B Sangavi Sivagnanasundram reviewed gene: PDE6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 8394174, 7599633, 18854872, 33177553, 33673512, 25827439; Phenotypes: inherited retinal dystrophy MONDO:0019118; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 NR2E3 Sangavi Sivagnanasundram reviewed gene: NR2E3: Rating: GREEN; Mode of pathogenicity: None; Publications: 10655056, 11071390, 18294254, 40317544, 38444285, 22605927; Phenotypes: Enhanced S-cone syndrome MONDO:0100288, retinitis pigmentosa 37 MONDO:0012625; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Deafness_IsolatedAndComplex v1.215 GJB6 Sarah Leigh reviewed gene: GJB6: Rating: GREEN; Mode of pathogenicity: None; Publications: 19416251, 24522190, 29921236, 40369851; Phenotypes: ; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v1.145 GTF3C3 Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Genetic Epilepsy v1.150 GTF3C3 Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Genetic Epilepsy v1.149 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Mendeliome v1.2595 GTF3C3 Zornitza Stark Phenotypes for gene: GTF3C3 were changed from Neurodevelopmental disorder MONDO:0700092, GTF3C3-related to Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Mendeliome v1.2594 GTF3C3 Zornitza Stark edited their review of gene: GTF3C3: Changed phenotypes: Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201
Intellectual disability syndromic and non-syndromic v1.144 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Intellectual disability syndromic and non-syndromic v1.143 PTPMT1 Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.975 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Mitochondrial disease v0.975 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Mitochondrial disease v0.974 PTPMT1 Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2594 PTPMT1 Zornitza Stark Phenotypes for gene: PTPMT1 were changed from inborn mitochondrial metabolism disorder MONDO:0004069 to Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199
Mendeliome v1.2593 PTPMT1 Zornitza Stark reviewed gene: PTPMT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 CRB1 Sangavi Sivagnanasundram reviewed gene: CRB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11231775, 11389483, 16543197; Phenotypes: Leber congenital amaurosis 8 MONDO:0013453; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 BEST1 Sangavi Sivagnanasundram reviewed gene: BEST1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29668979, 39803400, 39259030; Phenotypes: autosomal recessive bestrophinopathy MONDO:0012733; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Fetal anomalies v1.334 WNT3 Zornitza Stark reviewed gene: WNT3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Tetra-amelia syndrome 1, OMIM #273395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hand and foot malformations v0.76 WNT3 Zornitza Stark commented on gene: WNT3: LIMITED by ClinGen.
Mendeliome v1.2593 WNT3 Zornitza Stark commented on gene: WNT3: LIMITED by ClinGen.
Fetal anomalies v1.334 PPP2R5C Zornitza Stark Phenotypes for gene: PPP2R5C were changed from macrocephaly; overgrowth to Houge-Janssens syndrome 4, MIM# 621185
Fetal anomalies v1.333 PPP2R5C Zornitza Stark reviewed gene: PPP2R5C: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.143 PPP2R5C Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185
Intellectual disability syndromic and non-syndromic v1.142 PPP2R5C Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2593 PPP2R5C Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185
Mendeliome v1.2592 PPP2R5C Zornitza Stark reviewed gene: PPP2R5C: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Houge-Janssens syndrome 4, MIM# 621185; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Macrocephaly_Megalencephaly v0.150 PPP2R5C Zornitza Stark Phenotypes for gene: PPP2R5C were changed from Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092); macrocephaly; intellectual disability to Houge-Janssens syndrome 4, MIM# 621185
Macrocephaly_Megalencephaly v0.149 PPP2R5C Zornitza Stark edited their review of gene: PPP2R5C: Changed phenotypes: Houge-Janssens syndrome 4, MIM# 621185
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson Marked STR: RAI1_FAME8_TTTCA as ready
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson Str: rai1_fame8_tttca has been classified as Red List (Low Evidence).
Repeat Disorders v0.263 RAI1_FAME8_TTTCA Bryony Thompson STR: RAI1_FAME8_TTTCA was added
STR: RAI1_FAME8_TTTCA was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: RAI1_FAME8_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: RAI1_FAME8_TTTCA were set to 37994247
Phenotypes for STR: RAI1_FAME8_TTTCA were set to benign adult familial myoclonic epilepsy MONDO:0019448
Review for STR: RAI1_FAME8_TTTCA was set to RED
Added comment: A single family from Mali segregating TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1. Consistent with other FAME expansions. RNA toxicity is suggested to be the mechanism. Loss of function is the mechanism of disease of Smith-Magenis syndrome.
Sources: Literature
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Marked STR: NAXE_NME_GGGCC as ready
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Classified STR: NAXE_NME_GGGCC as Amber List (moderate evidence)
Repeat Disorders v0.262 NAXE_NME_GGGCC Bryony Thompson Str: naxe_nme_gggcc has been classified as Amber List (Moderate Evidence).
Repeat Disorders v0.261 NAXE_NME_GGGCC Bryony Thompson STR: NAXE_NME_GGGCC was added
STR: NAXE_NME_GGGCC was added to Repeat Disorders. Sources: Literature
Mode of inheritance for STR: NAXE_NME_GGGCC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: NAXE_NME_GGGCC were set to 39455596
Phenotypes for STR: NAXE_NME_GGGCC were set to encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781
Review for STR: NAXE_NME_GGGCC was set to AMBER
STR: NAXE_NME_GGGCC was marked as clinically relevant
STR: NAXE_NME_GGGCC was marked as current diagnostic
Added comment: A single case with a homozygous (result of UPD) repeat expansion in the promoter that leads to methylation of the promoter (identified by long-read sequencing). Biallelic loss of function variants in this gene cause a mitochondrial disease.
Sources: Literature
Repeat Disorders v0.260 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319; 37148549
Repeat Disorders v0.259 THAP11_SCA51_CAG Bryony Thompson Publications for STR: THAP11_SCA51_CAG were set to 15368101; 24677642; 34165550; 38113319
Repeat Disorders v0.258 AFF3_FRA2A_CGG Bryony Thompson Publications for STR: AFF3_FRA2A_CGG were set to 24763282
Repeat Disorders v0.257 DIP2B_FRA12A_CGG Bryony Thompson Publications for STR: DIP2B_FRA12A_CGG were set to 17236128
Syndromic Retinopathy v0.223 ARL2BP Sangavi Sivagnanasundram gene: ARL2BP was added
gene: ARL2BP was added to Syndromic Retinopathy. Sources: Expert Review
Mode of inheritance for gene: ARL2BP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARL2BP were set to 23849777; 31425546; 36507858; 38649918
Phenotypes for gene: ARL2BP were set to Ciliopathy MONDO:0005308
Review for gene: ARL2BP was set to GREEN
Added comment: Classified as Definitive by ClinGen Retina GCEP on 02/01/2025 - https://search.clinicalgenome.org/CCID:004172

Affected individuals present with different forms of ocular phenotypes along with other non-ocular phenotypes.
Sources: Expert Review
Retinitis pigmentosa v0.159 ARL2BP Sangavi Sivagnanasundram reviewed gene: ARL2BP: Rating: RED; Mode of pathogenicity: None; Publications: 27790702, 20301590; Phenotypes: Retinitis pigmentosa 82 with or without situs inversus MIM#615434; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 AHI1 Sangavi Sivagnanasundram reviewed gene: AHI1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28442542; Phenotypes: Joubert syndrome 3 MONDO:0012078, retinitis pigmentosa MONDO:0019200; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 AGBL5 Sangavi Sivagnanasundram reviewed gene: AGBL5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26720455, 26355662, 27842159; Phenotypes: retinitis pigmentosa 75, MONDO:0014871; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Retinitis pigmentosa v0.159 ABHD12 Sangavi Sivagnanasundram changed review comment from: 20797687 - only one individual presenting with nonsyndromic RP.

Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract (PHARC syndrome) is a form of syndromic RP. This association is green on syndromic RP.; to: 20797687 - only one individual presenting with nonsyndromic RP.

Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract (PHARC syndrome) is a form of syndromic RP. This association is green on syndromic RP.
Multiple individuals reported with syndromic RP.
Retinitis pigmentosa v0.159 ABHD12 Sangavi Sivagnanasundram reviewed gene: ABHD12: Rating: RED; Mode of pathogenicity: None; Publications: 20797687; Phenotypes: PHARC syndrome MONDO:0012984; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Syndromic Retinopathy v0.223 PANK2 Sangavi Sivagnanasundram reviewed gene: PANK2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11479594, 15911822, 1734303; Phenotypes: pantothenate kinase-associated neurodegeneration MONDO:0009319; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2592 SCO2 Zornitza Stark Mode of inheritance for gene: SCO2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Diamond Blackfan anaemia v1.9 GATA1 Zornitza Stark Mode of inheritance for gene: GATA1 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Diamond Blackfan anaemia v1.8 GATA1 Zornitza Stark reviewed gene: GATA1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Diamond-Blackfan anemia (MONDO:0015253); Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Pulmonary Arterial Hypertension v1.39 ATP13A3 Lilian Downie reviewed gene: ATP13A3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 34493544; Phenotypes: Pulmonary hypertension, primary, 5 MIM#265400; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v1.2591 MMAB Sangavi Sivagnanasundram reviewed gene: MMAB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24813872; Phenotypes: methylmalonic aciduria, cblB type MONDO:0009614; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Heterotaxy v1.37 NPHP4 Elena Savva Mode of inheritance for gene: NPHP4 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.80 PANX1 Zornitza Stark Marked gene: PANX1 as ready
Infertility and Recurrent Pregnancy Loss v0.80 PANX1 Zornitza Stark Gene: panx1 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.80 PANX1 Zornitza Stark Classified gene: PANX1 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.80 PANX1 Zornitza Stark Gene: panx1 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.79 SEPT4 Zornitza Stark Marked gene: SEPT4 as ready
Infertility and Recurrent Pregnancy Loss v0.79 SEPT4 Zornitza Stark Gene: sept4 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.79 SEPT4 Zornitza Stark Classified gene: SEPT4 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.79 SEPT4 Zornitza Stark Gene: sept4 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.78 SEPT4 Zornitza Stark gene: SEPT4 was added
gene: SEPT4 was added to Infertility and Pregnancy Loss. Sources: Expert Review
Mode of inheritance for gene: SEPT4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SEPT4 were set to 36135717; 15737931; 15737930
Phenotypes for gene: SEPT4 were set to Spermatogenic failure 99, MIM# 621194
Review for gene: SEPT4 was set to GREEN
Added comment: Two unrelated cases with primary male infertility (asthenoteratozoospermia) from consanguineous Chinsese families with 2 difference homozygous stopgain variants (Patient 1: c.721A>T, p.R241* and Patient 2: c.205C>T, p.R69*). Multiple supporting mouse models where the male mice are sterile.
Sources: Expert Review
Mendeliome v1.2591 SEPT4 Zornitza Stark reviewed gene: SEPT4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 99, MIM# 621194; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Monogenic Diabetes v0.140 ABCC8 Zornitza Stark Phenotypes for gene: ABCC8 were changed from permanent neonatal diabetes mellitus MONDO:0100164; transient neonatal diabetes mellitus MONDO:0020525 to Maturity-onset diabetes of the young, type 12, MIM# 621196; permanent neonatal diabetes mellitus MONDO:0100164; transient neonatal diabetes mellitus MONDO:0020525
Monogenic Diabetes v0.139 ABCC8 Zornitza Stark Publications for gene: ABCC8 were set to 21054355; 32027066; 32376986
Monogenic Diabetes v0.138 ABCC8 Zornitza Stark reviewed gene: ABCC8: Rating: GREEN; Mode of pathogenicity: None; Publications: 21989597, 34014594; Phenotypes: Maturity-onset diabetes of the young, type 12, MIM# 621196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2591 ABCC8 Zornitza Stark Phenotypes for gene: ABCC8 were changed from Diabetes mellitus, noninsulin-dependent MIM#125853; Diabetes mellitus, permanent neonatal 3, with or without neurologic features MIM#618857; Diabetes mellitus, transient neonatal 2 MIM#610374; Hyperinsulinemic hypoglycemia, familial, 1 MIM#256450; Hypoglycemia of infancy, leucine-sensitive MIM#240800 to Maturity-onset diabetes of the young, type 12, MIM# 621196; Diabetes mellitus, noninsulin-dependent MIM#125853; Diabetes mellitus, permanent neonatal 3, with or without neurologic features MIM#618857; Diabetes mellitus, transient neonatal 2 MIM#610374; Hyperinsulinemic hypoglycemia, familial, 1 MIM#256450; Hypoglycemia of infancy, leucine-sensitive MIM#240800
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.348 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Intellectual disability syndromic and non-syndromic v1.142 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Intellectual disability syndromic and non-syndromic v1.141 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Deafness_IsolatedAndComplex v1.215 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Deafness_IsolatedAndComplex v1.214 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Mitochondrial disease v0.974 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Mitochondrial disease v0.973 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Mendeliome v1.2590 MRPL49 Zornitza Stark Phenotypes for gene: MRPL49 were changed from Mitochondrial disease, MONDO:0044970, MRPL49-related to Combined oxidative phosphorylation deficiency 60, MIM# 621195
Mendeliome v1.2589 MRPL49 Zornitza Stark edited their review of gene: MRPL49: Changed phenotypes: Combined oxidative phosphorylation deficiency 60, MIM# 621195
Retinitis pigmentosa v0.159 IDH3G Zornitza Stark Phenotypes for gene: IDH3G were changed from X-linked retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa 99, MIM# 301148
Retinitis pigmentosa v0.158 IDH3G Zornitza Stark reviewed gene: IDH3G: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 99, MIM# 301148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2589 IDH3G Zornitza Stark Phenotypes for gene: IDH3G were changed from X-linked retinitis pigmentosa, MONDO:0019200 to Retinitis pigmentosa 99, MIM# 301148
Mendeliome v1.2588 IDH3G Zornitza Stark reviewed gene: IDH3G: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Retinitis pigmentosa 99, MIM# 301148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren changed review comment from: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature; to: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606) and 11/15 had neurodevelopmental delay in Timberlake et al. (PMID: 27606499)
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.141 SMAD6 Boris Keren gene: SMAD6 was added
gene: SMAD6 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: SMAD6 were set to PMID: 32499606
Penetrance for gene: SMAD6 were set to Incomplete
Review for gene: SMAD6 was set to GREEN
Added comment: 7/28 patients had intellectual disability in Calpena et al. (PMID: 32499606).
Sources: Literature
Mendeliome v1.2588 MAN2B1 Sangavi Sivagnanasundram reviewed gene: MAN2B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18651971, 9158146, 9758606, 9915946, 22161967; Phenotypes: alpha-mannosidosis MONDO:0009561; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2588 LYST Sangavi Sivagnanasundram edited their review of gene: LYST: Changed publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517
Mendeliome v1.2588 LYST Sangavi Sivagnanasundram reviewed gene: LYST: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517); Phenotypes: Chediak-Higashi syndrome MONDO:0008963; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2588 LYRM7 Sangavi Sivagnanasundram reviewed gene: LYRM7: Rating: GREEN; Mode of pathogenicity: None; Publications: 24014394, 26912632; Phenotypes: mitochondrial disease, LYRM7-related MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2588 LPAR6 Sangavi Sivagnanasundram reviewed gene: LPAR6: Rating: GREEN; Mode of pathogenicity: None; Publications: 18297072, 18297070, 18461368; Phenotypes: LPAR6-related hypotrichosis/woolly hair with or without hypotrichosis, MONDO:MONDO:0800312; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Prepair 500+ v1.854 QDPR Zornitza Stark Marked gene: QDPR as ready
Prepair 500+ v1.854 QDPR Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence).
Prepair 500+ v1.854 QDPR Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 to Hyperphenylalaninaemia, BH4-deficient, C, MIM# 261630
Prepair 500+ v1.853 QDPR Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, 261630 (3) to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630
Prepair 500+ v1.852 QDPR Zornitza Stark Publications for gene: QDPR were set to
Prepair 500+ v1.851 PUS1 Zornitza Stark Marked gene: PUS1 as ready
Prepair 500+ v1.851 PUS1 Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence).
Prepair 500+ v1.851 PUS1 Zornitza Stark Phenotypes for gene: PUS1 were changed from Mitochondrial myopathy and sideroblastic anemia 1, 600462 (3) to Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462
Prepair 500+ v1.850 PUS1 Zornitza Stark Publications for gene: PUS1 were set to
Prepair 500+ v1.849 PTS Zornitza Stark Marked gene: PTS as ready
Prepair 500+ v1.849 PTS Zornitza Stark Gene: pts has been classified as Green List (High Evidence).
Prepair 500+ v1.849 PTS Zornitza Stark Phenotypes for gene: PTS were changed from Hyperphenylalaninemia, BH4-deficient, A, 261640 (3) to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; BH4-deficient hyperphenylalaninemia A, MONDO:0009863
Prepair 500+ v1.848 PTS Zornitza Stark Publications for gene: PTS were set to
Prepair 500+ v1.847 PSAP Zornitza Stark Marked gene: PSAP as ready
Prepair 500+ v1.847 PSAP Zornitza Stark Gene: psap has been classified as Green List (High Evidence).
Prepair 500+ v1.847 PSAP Zornitza Stark Phenotypes for gene: PSAP were changed from Metachromatic leukodystrophy due to SAP-b deficiency, 249900 (3) to Metachromatic leukodystrophy due to SAP-b deficiency, MIM #249900; Combined SAP deficiency, MIM #611721; Gaucher disease, atypical, MIM #610539; Krabbe disease, atypical, MIM #611722
Prepair 500+ v1.846 PSAP Zornitza Stark Publications for gene: PSAP were set to
Prepair 500+ v1.845 PRPS1 Zornitza Stark Marked gene: PRPS1 as ready
Prepair 500+ v1.845 PRPS1 Zornitza Stark Gene: prps1 has been classified as Green List (High Evidence).
Prepair 500+ v1.845 PRPS1 Zornitza Stark Phenotypes for gene: PRPS1 were changed from Arts syndrome, 301835 (3) to PRPS1 deficiency disorder MONDO:0100061; Phosphoribosylpyrophosphate synthetase superactivity MIM#300661 MONDO:0010395
Prepair 500+ v1.844 PROP1 Zornitza Stark Marked gene: PROP1 as ready
Prepair 500+ v1.844 PROP1 Zornitza Stark Gene: prop1 has been classified as Green List (High Evidence).
Prepair 500+ v1.844 PROP1 Zornitza Stark Phenotypes for gene: PROP1 were changed from Pituitary hormone deficiency, combined, 2, 262600 (3) to Pituitary hormone deficiency, combined, 2, MIM#262600
Prepair 500+ v1.843 PRF1 Zornitza Stark Marked gene: PRF1 as ready
Prepair 500+ v1.843 PRF1 Zornitza Stark Gene: prf1 has been classified as Green List (High Evidence).
Prepair 500+ v1.843 PRF1 Zornitza Stark Phenotypes for gene: PRF1 were changed from Hemophagocytic lymphohistiocytosis, familial, 2, 603553 (3) to Haemophagocytic lymphohistiocytosis, familial, 2 MIM#603553
Prepair 500+ v1.842 PRF1 Zornitza Stark Publications for gene: PRF1 were set to
Prepair 500+ v1.841 PRDM5 Zornitza Stark Marked gene: PRDM5 as ready
Prepair 500+ v1.841 PRDM5 Zornitza Stark Gene: prdm5 has been classified as Green List (High Evidence).
Prepair 500+ v1.841 PRDM5 Zornitza Stark Phenotypes for gene: PRDM5 were changed from Brittle cornea syndrome 2, 614170 (3) to Brittle cornea syndrome 2, MIM#614170
Prepair 500+ v1.840 PRDM5 Zornitza Stark Publications for gene: PRDM5 were set to
Prepair 500+ v1.839 PQBP1 Zornitza Stark Marked gene: PQBP1 as ready
Prepair 500+ v1.839 PQBP1 Zornitza Stark Gene: pqbp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.839 PQBP1 Zornitza Stark Phenotypes for gene: PQBP1 were changed from Renpenning syndrome, 309500 (3) to Renpenning syndrome MIM#309500
Prepair 500+ v1.838 PQBP1 Zornitza Stark Publications for gene: PQBP1 were set to
Prepair 500+ v1.837 PPT1 Zornitza Stark Marked gene: PPT1 as ready
Prepair 500+ v1.837 PPT1 Zornitza Stark Gene: ppt1 has been classified as Green List (High Evidence).
Prepair 500+ v1.837 PPT1 Zornitza Stark Phenotypes for gene: PPT1 were changed from Ceroid lipofuscinosis, neuronal, 1, 256730 (3) to Ceroid lipofuscinosis, neuronal, 1, MIM# 256730
Prepair 500+ v1.836 PPT1 Zornitza Stark Publications for gene: PPT1 were set to
Prepair 500+ v1.835 POU1F1 Zornitza Stark Marked gene: POU1F1 as ready
Prepair 500+ v1.835 POU1F1 Zornitza Stark Gene: pou1f1 has been classified as Green List (High Evidence).
Prepair 500+ v1.835 POU1F1 Zornitza Stark Phenotypes for gene: POU1F1 were changed from Pituitary hormone deficiency, combined, 1, 613038 (3) to Pituitary hormone deficiency, combined or isolated, 1, MIM#613038
Prepair 500+ v1.834 POU1F1 Zornitza Stark Publications for gene: POU1F1 were set to
Prepair 500+ v1.833 POR Zornitza Stark Marked gene: POR as ready
Prepair 500+ v1.833 POR Zornitza Stark Gene: por has been classified as Green List (High Evidence).
Prepair 500+ v1.833 POR Zornitza Stark Phenotypes for gene: POR were changed from Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis, 201750 (3) to Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis (MIM#201750)
Prepair 500+ v1.832 POR Zornitza Stark Publications for gene: POR were set to
Prepair 500+ v1.831 POMT2 Zornitza Stark Marked gene: POMT2 as ready
Prepair 500+ v1.831 POMT2 Zornitza Stark Gene: pomt2 has been classified as Green List (High Evidence).
Prepair 500+ v1.831 POMT2 Zornitza Stark Phenotypes for gene: POMT2 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 2, MIM# 613156
Prepair 500+ v1.830 POMT2 Zornitza Stark Publications for gene: POMT2 were set to
Prepair 500+ v1.829 POMT1 Zornitza Stark Marked gene: POMT1 as ready
Prepair 500+ v1.829 POMT1 Zornitza Stark Gene: pomt1 has been classified as Green List (High Evidence).
Prepair 500+ v1.829 POMT1 Zornitza Stark Phenotypes for gene: POMT1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, 236670 (3) to Myopathy caused by variation in POMT1 MONDO:0700070
Prepair 500+ v1.828 POMT1 Zornitza Stark Publications for gene: POMT1 were set to
Prepair 500+ v1.827 POMGNT1 Zornitza Stark Marked gene: POMGNT1 as ready
Prepair 500+ v1.827 POMGNT1 Zornitza Stark Gene: pomgnt1 has been classified as Green List (High Evidence).
Prepair 500+ v1.827 POMGNT1 Zornitza Stark Phenotypes for gene: POMGNT1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3, 253280 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A3, MIM#253280; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B3, MIM#61315
Prepair 500+ v1.826 POMGNT1 Zornitza Stark Publications for gene: POMGNT1 were set to
Prepair 500+ v1.825 POLR3B Zornitza Stark Marked gene: POLR3B as ready
Prepair 500+ v1.825 POLR3B Zornitza Stark Gene: polr3b has been classified as Green List (High Evidence).
Prepair 500+ v1.825 POLR3B Zornitza Stark Phenotypes for gene: POLR3B were changed from Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381 (3) to Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism,MIM#614381
Prepair 500+ v1.824 POLR3B Zornitza Stark Publications for gene: POLR3B were set to
Prepair 500+ v1.823 POLR1C Zornitza Stark Marked gene: POLR1C as ready
Prepair 500+ v1.823 POLR1C Zornitza Stark Gene: polr1c has been classified as Green List (High Evidence).
Prepair 500+ v1.823 POLR1C Zornitza Stark Phenotypes for gene: POLR1C were changed from Treacher Collins syndrome 3, 248390 (3) to Leukodystrophy, hypomyelinating, 11 MIM#616494; Treacher Collins syndrome 3 MIM#248390
Prepair 500+ v1.822 POLR1C Zornitza Stark Publications for gene: POLR1C were set to
Prepair 500+ v1.821 POLG Zornitza Stark Marked gene: POLG as ready
Prepair 500+ v1.821 POLG Zornitza Stark Gene: polg has been classified as Green List (High Evidence).
Prepair 500+ v1.821 POLG Zornitza Stark Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type), 203700 (3) to Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662
Prepair 500+ v1.820 PNPO Zornitza Stark Marked gene: PNPO as ready
Prepair 500+ v1.820 PNPO Zornitza Stark Gene: pnpo has been classified as Green List (High Evidence).
Prepair 500+ v1.820 PNPO Zornitza Stark Phenotypes for gene: PNPO were changed from Pyridoxamine 5'-phosphate oxidase deficiency, 610090 (3) to Pyridoxamine 5'-phosphate oxidase deficiency MIM#610090
Prepair 500+ v1.819 PNPO Zornitza Stark Publications for gene: PNPO were set to
Prepair 500+ v1.818 PNKP Zornitza Stark Marked gene: PNKP as ready
Prepair 500+ v1.818 PNKP Zornitza Stark Gene: pnkp has been classified as Green List (High Evidence).
Prepair 500+ v1.818 PNKP Zornitza Stark Phenotypes for gene: PNKP were changed from Microcephaly, seizures, and developmental delay, 613402 (3) to Ataxia-oculomotor apraxia 4, MIM# 616267; Microcephaly, seizures, and developmental delay, MIM# 613402
Prepair 500+ v1.817 PNKP Zornitza Stark Publications for gene: PNKP were set to
Prepair 500+ v1.816 PMM2 Zornitza Stark Marked gene: PMM2 as ready
Prepair 500+ v1.816 PMM2 Zornitza Stark Gene: pmm2 has been classified as Green List (High Evidence).
Prepair 500+ v1.816 PMM2 Zornitza Stark Phenotypes for gene: PMM2 were changed from Congenital disorder of glycosylation, type Ia, 212065 (3) to Congenital disorder of glycosylation, type Ia (MIM#212065)
Prepair 500+ v1.815 PLPBP Zornitza Stark Marked gene: PLPBP as ready
Prepair 500+ v1.815 PLPBP Zornitza Stark Gene: plpbp has been classified as Green List (High Evidence).
Prepair 500+ v1.815 PLPBP Zornitza Stark Phenotypes for gene: PLPBP were changed from Epilepsy, early-onset, vitamin B6-dependent, 617290 (3), Autosomal recessive to Epilepsy, early-onset, vitamin B6-dependent, MIM#617290
Prepair 500+ v1.814 PLPBP Zornitza Stark Publications for gene: PLPBP were set to
Prepair 500+ v1.813 PLP1 Zornitza Stark Marked gene: PLP1 as ready
Prepair 500+ v1.813 PLP1 Zornitza Stark Gene: plp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.813 PLP1 Zornitza Stark Phenotypes for gene: PLP1 were changed from Pelizaeus-Merzbacher disease, 312080 (3) to Pelizaeus-Merzbacher disease MIM#312080, Pelizeaus-Merzbacher spectrum disorder MONDO:0010714; Spastic paraplegia 2, X-linked MIM#312920, hereditary spastic paraplegia 2 MONDO:0010733
Prepair 500+ v1.812 PLP1 Zornitza Stark Publications for gene: PLP1 were set to
Prepair 500+ v1.811 PLOD1 Zornitza Stark Marked gene: PLOD1 as ready
Prepair 500+ v1.811 PLOD1 Zornitza Stark Gene: plod1 has been classified as Green List (High Evidence).
Prepair 500+ v1.811 PLOD1 Zornitza Stark Phenotypes for gene: PLOD1 were changed from Ehlers-Danlos syndrome, type VI, 225400 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 1, MIM# 225400
Prepair 500+ v1.810 PLOD1 Zornitza Stark Publications for gene: PLOD1 were set to
Prepair 500+ v1.809 PLA2G6 Zornitza Stark Marked gene: PLA2G6 as ready
Prepair 500+ v1.809 PLA2G6 Zornitza Stark Gene: pla2g6 has been classified as Green List (High Evidence).
Prepair 500+ v1.809 PKHD1 Zornitza Stark Marked gene: PKHD1 as ready
Prepair 500+ v1.809 PKHD1 Zornitza Stark Gene: pkhd1 has been classified as Green List (High Evidence).
Prepair 500+ v1.809 PKHD1 Zornitza Stark Phenotypes for gene: PKHD1 were changed from Polycystic kidney and hepatic disease, 263200 (3) to Polycystic kidney disease 4, with or without hepatic disease MIM#263200
Prepair 500+ v1.808 PKHD1 Zornitza Stark Publications for gene: PKHD1 were set to
Prepair 500+ v1.807 PIGT Zornitza Stark Marked gene: PIGT as ready
Prepair 500+ v1.807 PIGT Zornitza Stark Gene: pigt has been classified as Green List (High Evidence).
Prepair 500+ v1.807 PIGT Zornitza Stark Phenotypes for gene: PIGT were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 3 to Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165
Prepair 500+ v1.806 PIGT Zornitza Stark Publications for gene: PIGT were set to
Prepair 500+ v1.805 PIGN Zornitza Stark Marked gene: PIGN as ready
Prepair 500+ v1.805 PIGN Zornitza Stark Gene: pign has been classified as Green List (High Evidence).
Prepair 500+ v1.805 PIGN Zornitza Stark Phenotypes for gene: PIGN were changed from Multiple congenital anomalies-hypotonia-seizures syndrome 1, 614080 (3) to Multiple congenital anomalies-hypotonia-seizures syndrome 1,MIM#614080
Prepair 500+ v1.804 PIGN Zornitza Stark Publications for gene: PIGN were set to
Prepair 500+ v1.803 PIGG Zornitza Stark Marked gene: PIGG as ready
Prepair 500+ v1.803 PIGG Zornitza Stark Gene: pigg has been classified as Green List (High Evidence).
Prepair 500+ v1.803 PIGG Zornitza Stark Publications for gene: PIGG were set to
Prepair 500+ v1.802 PIBF1 Zornitza Stark Marked gene: PIBF1 as ready
Prepair 500+ v1.802 PIBF1 Zornitza Stark Gene: pibf1 has been classified as Green List (High Evidence).
Prepair 500+ v1.802 PHYH Zornitza Stark Marked gene: PHYH as ready
Prepair 500+ v1.802 PHYH Zornitza Stark Gene: phyh has been classified as Green List (High Evidence).
Prepair 500+ v1.802 PHYH Zornitza Stark Phenotypes for gene: PHYH were changed from Refsum disease, 266500 (3) to Refsum disease MIM#266500
Prepair 500+ v1.801 PHYH Zornitza Stark Publications for gene: PHYH were set to
Prepair 500+ v1.800 PHGDH Zornitza Stark Marked gene: PHGDH as ready
Prepair 500+ v1.800 PHGDH Zornitza Stark Gene: phgdh has been classified as Green List (High Evidence).
Prepair 500+ v1.800 PHGDH Zornitza Stark Phenotypes for gene: PHGDH were changed from Neu-Laxova syndrome1, 256520 (3) to Neu-Laxova syndrome 1 MIM#256520; Phosphoglycerate dehydrogenase deficiency MIM#601815
Prepair 500+ v1.799 PHGDH Zornitza Stark Publications for gene: PHGDH were set to
Prepair 500+ v1.798 PHF8 Zornitza Stark Marked gene: PHF8 as ready
Prepair 500+ v1.798 PHF8 Zornitza Stark Gene: phf8 has been classified as Green List (High Evidence).
Prepair 500+ v1.798 PHF8 Zornitza Stark Phenotypes for gene: PHF8 were changed from Mental retardation syndrome, X-linked, Siderius type, 300263 (3) to Intellectual developmental disorder, X-linked syndromic, Siderius type, MIM# 300263
Prepair 500+ v1.797 PHF8 Zornitza Stark Publications for gene: PHF8 were set to
Prepair 500+ v1.796 PGM3 Zornitza Stark Marked gene: PGM3 as ready
Prepair 500+ v1.796 PGM3 Zornitza Stark Gene: pgm3 has been classified as Green List (High Evidence).
Prepair 500+ v1.796 PGM3 Zornitza Stark Phenotypes for gene: PGM3 were changed from Immunodeficiency 23, 615816 (3) to Immunodeficiency 23, MIM# 615816
Prepair 500+ v1.795 PGM3 Zornitza Stark Publications for gene: PGM3 were set to
Prepair 500+ v1.794 PGM1 Zornitza Stark Marked gene: PGM1 as ready
Prepair 500+ v1.794 PGM1 Zornitza Stark Gene: pgm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.794 PGM1 Zornitza Stark Phenotypes for gene: PGM1 were changed from Congenital disorder of glycosylation, type It, 614921 (3) to Congenital disorder of glycosylation, type It (MIM#614921)
Prepair 500+ v1.793 PGM1 Zornitza Stark Publications for gene: PGM1 were set to
Prepair 500+ v1.792 PGK1 Zornitza Stark Marked gene: PGK1 as ready
Prepair 500+ v1.792 PGK1 Zornitza Stark Gene: pgk1 has been classified as Green List (High Evidence).
Prepair 500+ v1.792 PGK1 Zornitza Stark Phenotypes for gene: PGK1 were changed from Phosphoglycerate kinase 1 deficiency, 300653 (3) to Phosphoglycerate kinase 1 deficiency (MIM#300653)
Prepair 500+ v1.791 PGAP2 Zornitza Stark Marked gene: PGAP2 as ready
Prepair 500+ v1.791 PGAP2 Zornitza Stark Gene: pgap2 has been classified as Green List (High Evidence).
Prepair 500+ v1.791 PGAP2 Zornitza Stark Phenotypes for gene: PGAP2 were changed from Hyperphosphatasia with mental retardation syndrome 3, 614207 (3) to Hyperphosphatasia with impaired intellectual development syndrome 3, MIM#614207
Prepair 500+ v1.790 PGAP2 Zornitza Stark Publications for gene: PGAP2 were set to
Prepair 500+ v1.789 PFKM Zornitza Stark Marked gene: PFKM as ready
Prepair 500+ v1.789 PFKM Zornitza Stark Gene: pfkm has been classified as Green List (High Evidence).
Prepair 500+ v1.789 PFKM Zornitza Stark Phenotypes for gene: PFKM were changed from Glycogen storage disease VII, 232800 (3) to Glycogen storage disease VII MIM#232800
Prepair 500+ v1.788 PFKM Zornitza Stark Publications for gene: PFKM were set to
Prepair 500+ v1.787 PEX7 Zornitza Stark Marked gene: PEX7 as ready
Prepair 500+ v1.787 PEX7 Zornitza Stark Gene: pex7 has been classified as Green List (High Evidence).
Prepair 500+ v1.787 PEX7 Zornitza Stark Phenotypes for gene: PEX7 were changed from Chondrodysplasia punctata, rhizomelic, type 1, 215100 (3) to Peroxisome biogenesis disorder 9B, MIM# 614879; Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100
Prepair 500+ v1.786 PEX7 Zornitza Stark Publications for gene: PEX7 were set to
Prepair 500+ v1.785 PEX6 Zornitza Stark Marked gene: PEX6 as ready
Prepair 500+ v1.785 PEX6 Zornitza Stark Gene: pex6 has been classified as Green List (High Evidence).
Prepair 500+ v1.785 PEX6 Zornitza Stark Phenotypes for gene: PEX6 were changed from Peroxisome biogenesis disorder 4A (Zellweger), 614862 to Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862; Peroxisome biogenesis disorder-4B, MIM# 614863
Prepair 500+ v1.784 PEX6 Zornitza Stark Publications for gene: PEX6 were set to
Prepair 500+ v1.783 PEX5 Zornitza Stark Marked gene: PEX5 as ready
Prepair 500+ v1.783 PEX5 Zornitza Stark Gene: pex5 has been classified as Green List (High Evidence).
Prepair 500+ v1.783 PEX5 Zornitza Stark Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger), 214110 to Peroxisome biogenesis disorder 2A (Zellweger), MIM#214110
Prepair 500+ v1.782 PEX5 Zornitza Stark Publications for gene: PEX5 were set to
Prepair 500+ v1.781 PEX26 Zornitza Stark Marked gene: PEX26 as ready
Prepair 500+ v1.781 PEX26 Zornitza Stark Gene: pex26 has been classified as Green List (High Evidence).
Prepair 500+ v1.781 PEX26 Zornitza Stark Phenotypes for gene: PEX26 were changed from Peroxisome biogenesis disorder 7A (Zellweger), 614872 to Peroxisome biogenesis disorder 7A (Zellweger) - MIM#614872, MONDO:0013938; Peroxisome biogenesis disorder 7B - MIM#614873, MONDO:0013939
Prepair 500+ v1.780 PEX26 Zornitza Stark Publications for gene: PEX26 were set to
Prepair 500+ v1.779 PEX2 Zornitza Stark Marked gene: PEX2 as ready
Prepair 500+ v1.779 PEX2 Zornitza Stark Gene: pex2 has been classified as Green List (High Evidence).
Prepair 500+ v1.779 PEX2 Zornitza Stark Phenotypes for gene: PEX2 were changed from Peroxisome biogenesis disorder 5A (Zellweger), 614866 to Peroxisome biogenesis disorder 5A (Zellweger), MIM#614866; Peroxisome biogenesis disorder 5B, MIM#614867
Prepair 500+ v1.778 PEX2 Zornitza Stark Publications for gene: PEX2 were set to
Prepair 500+ v1.777 PEX16 Zornitza Stark Marked gene: PEX16 as ready
Prepair 500+ v1.777 PEX16 Zornitza Stark Gene: pex16 has been classified as Green List (High Evidence).
Prepair 500+ v1.777 PEX16 Zornitza Stark Phenotypes for gene: PEX16 were changed from Peroxisome biogenesis disorder 8A, (Zellweger), 614876 to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876; Peroxisome biogenesis disorder 8B MIM#614877
Prepair 500+ v1.776 PEX16 Zornitza Stark Publications for gene: PEX16 were set to
Prepair 500+ v1.775 PEX13 Zornitza Stark Marked gene: PEX13 as ready
Prepair 500+ v1.775 PEX13 Zornitza Stark Gene: pex13 has been classified as Green List (High Evidence).
Prepair 500+ v1.775 PEX13 Zornitza Stark Phenotypes for gene: PEX13 were changed from Peroxisome biogenesis disorder 11A (Zellweger), 614883 to Peroxisome biogenesis disorder 11A (Zellweger), MIM#614883; Peroxisome biogenesis disorder 11B, MIM#614885
Prepair 500+ v1.774 PEX12 Zornitza Stark Marked gene: PEX12 as ready
Prepair 500+ v1.774 PEX12 Zornitza Stark Gene: pex12 has been classified as Green List (High Evidence).
Prepair 500+ v1.774 PEX12 Zornitza Stark Phenotypes for gene: PEX12 were changed from Peroxisome biogenesis disorder 3A (Zellweger), 614859 to Peroxisome biogenesis disorder 3A (Zellweger), MIM#614859; Peroxisome biogenesis disorder 3B, MIM#266510
Prepair 500+ v1.773 PEX10 Zornitza Stark Marked gene: PEX10 as ready
Prepair 500+ v1.773 PEX10 Zornitza Stark Gene: pex10 has been classified as Green List (High Evidence).
Prepair 500+ v1.773 PEX10 Zornitza Stark Phenotypes for gene: PEX10 were changed from Peroxisome biogenesis disorder 6A (Zellweger), 614870 to Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870; Peroxisome biogenesis disorder 6B MIM#614871
Prepair 500+ v1.772 PEX10 Zornitza Stark Publications for gene: PEX10 were set to
Prepair 500+ v1.771 PEX1 Zornitza Stark Marked gene: PEX1 as ready
Prepair 500+ v1.771 PEX1 Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence).
Prepair 500+ v1.771 PEX1 Zornitza Stark Phenotypes for gene: PEX1 were changed from Peroxisome biogenesis disorder 1A (Zellweger), 214100 to Peroxisome biogenesis disorder 1A (Zellweger), MIM #214100; Heimler syndrome 1, MIM #234580; Peroxisome biogenesis disorder 1B (NALD/IRD), MIM #601539; MONDO:0100259
Prepair 500+ v1.770 PEX1 Zornitza Stark Publications for gene: PEX1 were set to
Prepair 500+ v1.769 PET100 Zornitza Stark Marked gene: PET100 as ready
Prepair 500+ v1.769 PET100 Zornitza Stark Gene: pet100 has been classified as Green List (High Evidence).
Prepair 500+ v1.769 PET100 Zornitza Stark Phenotypes for gene: PET100 were changed from Mitochondrial complex IV deficiency, 220110 (3) to Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055
Prepair 500+ v1.768 PEPD Zornitza Stark Marked gene: PEPD as ready
Prepair 500+ v1.768 PEPD Zornitza Stark Gene: pepd has been classified as Green List (High Evidence).
Prepair 500+ v1.768 PEPD Zornitza Stark Phenotypes for gene: PEPD were changed from Prolidase deficiency, 170100 (3) to Prolidase deficiency, MIM# 170100
Prepair 500+ v1.767 PEPD Zornitza Stark Publications for gene: PEPD were set to
Prepair 500+ v1.766 PDHB Zornitza Stark Marked gene: PDHB as ready
Prepair 500+ v1.766 PDHB Zornitza Stark Gene: pdhb has been classified as Green List (High Evidence).
Prepair 500+ v1.766 PDHB Zornitza Stark Phenotypes for gene: PDHB were changed from Pyruvate dehydrogenase E1-beta deficiency, 614111 (3) to Pyruvate dehydrogenase E1-beta deficiency, MIM #614111
Prepair 500+ v1.765 PDHB Zornitza Stark Publications for gene: PDHB were set to
Prepair 500+ v1.764 PDHA1 Zornitza Stark Marked gene: PDHA1 as ready
Prepair 500+ v1.764 PDHA1 Zornitza Stark Gene: pdha1 has been classified as Green List (High Evidence).
Prepair 500+ v1.764 PCNT Zornitza Stark Marked gene: PCNT as ready
Prepair 500+ v1.764 PCNT Zornitza Stark Gene: pcnt has been classified as Green List (High Evidence).
Prepair 500+ v1.764 PCNT Zornitza Stark Phenotypes for gene: PCNT were changed from Microcephalic osteodysplastic primordial dwarfism, type II, 210720 (3) to Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720; MONDO:0008872
Prepair 500+ v1.763 PCNT Zornitza Stark Publications for gene: PCNT were set to
Prepair 500+ v1.762 PCDH19 Zornitza Stark changed review comment from: Severe condition meets criteria for screening. Note it needs special filtering.; to: Severe condition meets criteria for screening. Note it needs special filtering to detect male carriers at risk of having affected female children.
Prepair 500+ v1.762 PCDH19 Zornitza Stark Marked gene: PCDH19 as ready
Prepair 500+ v1.762 PCDH19 Zornitza Stark Gene: pcdh19 has been classified as Green List (High Evidence).
Prepair 500+ v1.762 PCDH15 Zornitza Stark Marked gene: PCDH15 as ready
Prepair 500+ v1.762 PCDH15 Zornitza Stark Gene: pcdh15 has been classified as Green List (High Evidence).
Prepair 500+ v1.762 PCDH15 Zornitza Stark Phenotypes for gene: PCDH15 were changed from Usher syndrome, type 1F, 602083 (3) to Usher syndrome, type 1F, MIM# 602083
Prepair 500+ v1.761 PCDH15 Zornitza Stark Publications for gene: PCDH15 were set to
Prepair 500+ v1.760 PCCB Zornitza Stark Marked gene: PCCB as ready
Prepair 500+ v1.760 PCCB Zornitza Stark Gene: pccb has been classified as Green List (High Evidence).
Prepair 500+ v1.760 PCCB Zornitza Stark Phenotypes for gene: PCCB were changed from Propionicacidemia, 606054 (3) to Propionicacidemia MIM#606054; propionic acidemia MONDO:0011628
Prepair 500+ v1.759 PCCB Zornitza Stark Publications for gene: PCCB were set to
Prepair 500+ v1.758 PCCA Zornitza Stark Marked gene: PCCA as ready
Prepair 500+ v1.758 PCCA Zornitza Stark Gene: pcca has been classified as Green List (High Evidence).
Prepair 500+ v1.758 PCCA Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, MIM#606054 to Propionicacidaemia, MIM#606054
Prepair 500+ v1.757 PCCA Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, 606054 (3) to Propionicacidemia, MIM#606054
Prepair 500+ v1.756 PCCA Zornitza Stark Publications for gene: PCCA were set to
Prepair 500+ v1.755 PC Zornitza Stark Marked gene: PC as ready
Prepair 500+ v1.755 PC Zornitza Stark Gene: pc has been classified as Green List (High Evidence).
Prepair 500+ v1.755 PC Zornitza Stark Phenotypes for gene: PC were changed from Pyruvate carboxylase deficiency, 266150 (3) to Pyruvate carboxylase deficiency (MIM#266150)
Prepair 500+ v1.754 PC Zornitza Stark Publications for gene: PC were set to
Prepair 500+ v1.753 PANK2 Zornitza Stark Marked gene: PANK2 as ready
Prepair 500+ v1.753 PANK2 Zornitza Stark Gene: pank2 has been classified as Green List (High Evidence).
Prepair 500+ v1.753 PANK2 Zornitza Stark Phenotypes for gene: PANK2 were changed from Neurodegeneration with brain iron accumulation 1, MIM#234200 to HARP syndrome (MIM#607236); Neurodegeneration with brain iron accumulation 1 (MIM#234200)
Prepair 500+ v1.752 PAK3 Zornitza Stark Marked gene: PAK3 as ready
Prepair 500+ v1.752 PAK3 Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence).
Prepair 500+ v1.752 PAK3 Zornitza Stark Phenotypes for gene: PAK3 were changed from Mental retardation, X-linked 30/47, 300558 (3) to Intellectual developmental disorder, X-linked 30 MIM#300558
Prepair 500+ v1.751 PAK3 Zornitza Stark Publications for gene: PAK3 were set to
Prepair 500+ v1.750 PAH Zornitza Stark Marked gene: PAH as ready
Prepair 500+ v1.750 PAH Zornitza Stark Gene: pah has been classified as Green List (High Evidence).
Prepair 500+ v1.750 PAH Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria,MIM#261600 to Phenylketonuria, MIM#261600
Prepair 500+ v1.749 PAH Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria, 261600 (3) to Phenylketonuria,MIM#261600
Prepair 500+ v1.748 PAH Zornitza Stark Publications for gene: PAH were set to
Prepair 500+ v1.747 P3H1 Zornitza Stark Marked gene: P3H1 as ready
Prepair 500+ v1.747 P3H1 Zornitza Stark Gene: p3h1 has been classified as Green List (High Evidence).
Prepair 500+ v1.747 P3H1 Zornitza Stark Phenotypes for gene: P3H1 were changed from Osteogenesis imperfecta, type VIII, 610915 (3) to Osteogenesis imperfecta, type VIII, MIM#610915
Prepair 500+ v1.746 P3H1 Zornitza Stark Publications for gene: P3H1 were set to
Genomic newborn screening: BabyScreen+ v1.121 TRPM4 Zornitza Stark Phenotypes for gene: TRPM4 were changed from Progressive familial heart block, type IB 604559 to Progressive familial heart block, type IB, MIM# 604559
Genomic newborn screening: BabyScreen+ v1.120 TRPM4 Zornitza Stark Classified gene: TRPM4 as Red List (low evidence)
Genomic newborn screening: BabyScreen+ v1.120 TRPM4 Zornitza Stark Gene: trpm4 has been classified as Red List (Low Evidence).
Genomic newborn screening: BabyScreen+ v1.119 TRPM4 Zornitza Stark reviewed gene: TRPM4: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Progressive familial heart block, type IB, MIM# 604559; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genomic newborn screening: BabyScreen+ v1.119 KCNE2 Zornitza Stark Marked gene: KCNE2 as ready
Genomic newborn screening: BabyScreen+ v1.119 KCNE2 Zornitza Stark Gene: kcne2 has been classified as Red List (Low Evidence).
Genomic newborn screening: BabyScreen+ v1.119 KCNE2 Zornitza Stark Phenotypes for gene: KCNE2 were changed from Long QT syndrome-6 to Long QT syndrome 6, MIM# 613693
Genomic newborn screening: BabyScreen+ v1.118 KCNE2 Zornitza Stark Classified gene: KCNE2 as Red List (low evidence)
Genomic newborn screening: BabyScreen+ v1.118 KCNE2 Zornitza Stark Gene: kcne2 has been classified as Red List (Low Evidence).
Genomic newborn screening: BabyScreen+ v1.117 KCNE2 Zornitza Stark edited their review of gene: KCNE2: Changed phenotypes: Long QT syndrome 6, MIM# 613693
Genomic newborn screening: BabyScreen+ v1.117 KCNE2 Zornitza Stark reviewed gene: KCNE2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 500+ v1.745 OTC Zornitza Stark Marked gene: OTC as ready
Prepair 500+ v1.745 OTC Zornitza Stark Gene: otc has been classified as Green List (High Evidence).
Prepair 500+ v1.745 OTC Zornitza Stark Phenotypes for gene: OTC were changed from Ornithine transcarbamylase deficiency, 311250 (3) to Ornithine transcarbamylase deficiency, MIM# 311250
Prepair 500+ v1.744 OTC Zornitza Stark Publications for gene: OTC were set to
Prepair 500+ v1.743 OSTM1 Zornitza Stark Marked gene: OSTM1 as ready
Prepair 500+ v1.743 OSTM1 Zornitza Stark Gene: ostm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.743 OSTM1 Zornitza Stark Phenotypes for gene: OSTM1 were changed from Osteopetrosis, autosomal recessive 5, 259720 (3) to Osteopetrosis, autosomal recessive 5, MIM#259720
Prepair 500+ v1.742 OSTM1 Zornitza Stark Publications for gene: OSTM1 were set to
Prepair 500+ v1.741 OPHN1 Zornitza Stark Marked gene: OPHN1 as ready
Prepair 500+ v1.741 OPHN1 Zornitza Stark Gene: ophn1 has been classified as Green List (High Evidence).
Prepair 500+ v1.741 OPHN1 Zornitza Stark Phenotypes for gene: OPHN1 were changed from Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) to Intellectual developmental disorder, X-linked syndromic, Billuart type MIM#300486; X-linked intellectual disability-cerebellar hypoplasia syndrome MONDO:0010337
Prepair 500+ v1.740 OPHN1 Zornitza Stark Publications for gene: OPHN1 were set to
Prepair 500+ v1.739 OPA3 Zornitza Stark Marked gene: OPA3 as ready
Prepair 500+ v1.739 OPA3 Zornitza Stark Gene: opa3 has been classified as Green List (High Evidence).
Prepair 500+ v1.739 OPA3 Zornitza Stark Phenotypes for gene: OPA3 were changed from 3-methylglutaconic aciduria, type III, 258501 (3) to 3-methylglutaconic aciduria, type III MIM#258501; 3-methylglutaconic aciduria type 3 MONDO:0009787
Prepair 500+ v1.738 OPA3 Zornitza Stark Publications for gene: OPA3 were set to
Prepair 500+ v1.737 OPA1 Zornitza Stark Marked gene: OPA1 as ready
Prepair 500+ v1.737 OPA1 Zornitza Stark Gene: opa1 has been classified as Green List (High Evidence).
Prepair 500+ v1.737 OPA1 Zornitza Stark Phenotypes for gene: OPA1 were changed from Behr syndrome, 210000 (3), Autosomal recessive to Behr syndrome, MIM#210000
Prepair 500+ v1.736 OPA1 Zornitza Stark Publications for gene: OPA1 were set to
Prepair 500+ v1.735 OFD1 Zornitza Stark Marked gene: OFD1 as ready
Prepair 500+ v1.735 OFD1 Zornitza Stark Gene: ofd1 has been classified as Green List (High Evidence).
Prepair 500+ v1.735 OFD1 Zornitza Stark Phenotypes for gene: OFD1 were changed from Joubert syndrome 10, 300804 (3) to Joubert syndrome 10 MIM#300804; Simpson-Golabi-Behmel syndrome, type 2 MIM#300209; Retinitis pigmentosa 23 MIM#300424
Prepair 500+ v1.734 OFD1 Zornitza Stark Publications for gene: OFD1 were set to
Prepair 500+ v1.733 OCRL Zornitza Stark Marked gene: OCRL as ready
Prepair 500+ v1.733 OCRL Zornitza Stark Gene: ocrl has been classified as Green List (High Evidence).
Prepair 500+ v1.733 OCRL Zornitza Stark Phenotypes for gene: OCRL were changed from Lowe syndrome, 309000 (3) to Dent disease 2 MIM#300555; Lowe syndrome MIM#309000
Prepair 500+ v1.732 OCRL Zornitza Stark Publications for gene: OCRL were set to
Prepair 500+ v1.731 NTRK1 Zornitza Stark Marked gene: NTRK1 as ready
Prepair 500+ v1.731 NTRK1 Zornitza Stark Gene: ntrk1 has been classified as Green List (High Evidence).
Prepair 500+ v1.731 NTRK1 Zornitza Stark Phenotypes for gene: NTRK1 were changed from Insensitivity to pain, congenital, with anhidrosis, 256800 (3) to Insensitivity to pain, congenital, with anhidrosis MIM#256800
Prepair 500+ v1.730 NTRK1 Zornitza Stark Publications for gene: NTRK1 were set to
Prepair 500+ v1.729 NR0B1 Zornitza Stark Marked gene: NR0B1 as ready
Prepair 500+ v1.729 NR0B1 Zornitza Stark Gene: nr0b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.729 NR0B1 Zornitza Stark Phenotypes for gene: NR0B1 were changed from 46XY sex reversal 2, dosage-sensitive, 300018 (3) to Adrenal hypoplasia, congenital, MIM#300200
Prepair 500+ v1.728 NR0B1 Zornitza Stark Publications for gene: NR0B1 were set to
Prepair 500+ v1.727 NPHS2 Zornitza Stark Marked gene: NPHS2 as ready
Prepair 500+ v1.727 NPHS2 Zornitza Stark Gene: nphs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.727 NPHS2 Zornitza Stark Phenotypes for gene: NPHS2 were changed from Nephrotic syndrome, type 2, 600995 (3) to Nephrotic syndrome, type 2 MIM#600995
Prepair 500+ v1.726 NPHS2 Zornitza Stark Publications for gene: NPHS2 were set to
Prepair 500+ v1.725 NPHS1 Zornitza Stark Marked gene: NPHS1 as ready
Prepair 500+ v1.725 NPHS1 Zornitza Stark Gene: nphs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.725 NPHS1 Zornitza Stark Phenotypes for gene: NPHS1 were changed from Nephrotic syndrome, type 1, 256300 (3) to Nephrotic syndrome, type 1, MIM# 256300; congenital nephrotic syndrome, Finnish type MONDO:0009732
Prepair 500+ v1.724 NPHS1 Zornitza Stark Publications for gene: NPHS1 were set to
Prepair 500+ v1.723 NPHP3 Zornitza Stark Marked gene: NPHP3 as ready
Prepair 500+ v1.723 NPHP3 Zornitza Stark Gene: nphp3 has been classified as Green List (High Evidence).
Prepair 500+ v1.723 NPHP3 Zornitza Stark Phenotypes for gene: NPHP3 were changed from Meckel syndrome 7, 267010 (3) to Renal-hepatic-pancreatic dysplasia 1 MIM#208540; Meckel syndrome 7 MIM#267010; Nephronophthisis 3 MIM#604387
Prepair 500+ v1.722 NPHP1 Zornitza Stark Marked gene: NPHP1 as ready
Prepair 500+ v1.722 NPHP1 Zornitza Stark Gene: nphp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.722 NPHP1 Zornitza Stark Phenotypes for gene: NPHP1 were changed from Joubert syndrome 4, 609583 (3) to Nephronophthisis 1, juvenile MIM#256100; Joubert syndrome 4 MIM#609583; Senior-Loken syndrome-1 MIM#266900
Prepair 500+ v1.721 NPC2 Zornitza Stark Marked gene: NPC2 as ready
Prepair 500+ v1.721 NPC2 Zornitza Stark Gene: npc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.721 NPC1 Zornitza Stark Marked gene: NPC1 as ready
Prepair 500+ v1.721 NPC1 Zornitza Stark Gene: npc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.721 NPC1 Zornitza Stark Publications for gene: NPC1 were set to 11333381; 26910362
Prepair 500+ v1.720 NNT Zornitza Stark Marked gene: NNT as ready
Prepair 500+ v1.720 NNT Zornitza Stark Gene: nnt has been classified as Green List (High Evidence).
Prepair 500+ v1.720 NNT Zornitza Stark Phenotypes for gene: NNT were changed from Glucocorticoid deficiency 4, 614736 (3) to Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency MIM#614736; MONDO:0013874
Prepair 500+ v1.719 NNT Zornitza Stark Publications for gene: NNT were set to
Prepair 500+ v1.718 NGLY1 Zornitza Stark Marked gene: NGLY1 as ready
Prepair 500+ v1.718 NGLY1 Zornitza Stark Gene: ngly1 has been classified as Green List (High Evidence).
Prepair 500+ v1.718 NGLY1 Zornitza Stark Phenotypes for gene: NGLY1 were changed from Congenital disorder of deglycosylation, 615273 (3) to Congenital disorder of deglycosylation, MIM#615273
Prepair 500+ v1.717 NGLY1 Zornitza Stark Publications for gene: NGLY1 were set to
Prepair 500+ v1.716 NEU1 Zornitza Stark Marked gene: NEU1 as ready
Prepair 500+ v1.716 NEU1 Zornitza Stark Gene: neu1 has been classified as Green List (High Evidence).
Prepair 500+ v1.716 NEU1 Zornitza Stark Phenotypes for gene: NEU1 were changed from Sialidosis, type I, 256550 (3) to Sialidosis, type I, MIM #256550; Sialidosis, type II, MIM #256550
Prepair 500+ v1.715 NEU1 Zornitza Stark Publications for gene: NEU1 were set to
Prepair 500+ v1.714 NEB Zornitza Stark Marked gene: NEB as ready
Prepair 500+ v1.714 NEB Zornitza Stark Gene: neb has been classified as Green List (High Evidence).
Prepair 500+ v1.714 NEB Zornitza Stark Publications for gene: NEB were set to 27228465
Prepair 500+ v1.713 NDUFV1 Zornitza Stark Marked gene: NDUFV1 as ready
Prepair 500+ v1.713 NDUFV1 Zornitza Stark Gene: ndufv1 has been classified as Green List (High Evidence).
Prepair 500+ v1.713 NDUFV1 Zornitza Stark Phenotypes for gene: NDUFV1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 4 MIM#618225
Prepair 500+ v1.712 NDUFV1 Zornitza Stark Publications for gene: NDUFV1 were set to
Prepair 500+ v1.711 NDUFS7 Zornitza Stark Marked gene: NDUFS7 as ready
Prepair 500+ v1.711 NDUFS7 Zornitza Stark Gene: ndufs7 has been classified as Green List (High Evidence).
Prepair 500+ v1.711 NDUFS7 Zornitza Stark Phenotypes for gene: NDUFS7 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 3 MIM#618224
Prepair 500+ v1.710 NDUFS7 Zornitza Stark Publications for gene: NDUFS7 were set to
Prepair 500+ v1.709 NDUFS6 Zornitza Stark Marked gene: NDUFS6 as ready
Prepair 500+ v1.709 NDUFS6 Zornitza Stark Gene: ndufs6 has been classified as Green List (High Evidence).
Prepair 500+ v1.709 NDUFS6 Zornitza Stark Phenotypes for gene: NDUFS6 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 9 (MIM#618232)
Prepair 500+ v1.708 NDUFS6 Zornitza Stark Publications for gene: NDUFS6 were set to
Prepair 500+ v1.707 NDUFS4 Zornitza Stark Marked gene: NDUFS4 as ready
Prepair 500+ v1.707 NDUFS4 Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence).
Prepair 500+ v1.707 NDUFS4 Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 1, MIM#252010
Prepair 500+ v1.706 NDUFAF5 Zornitza Stark Marked gene: NDUFAF5 as ready
Prepair 500+ v1.706 NDUFAF5 Zornitza Stark Gene: ndufaf5 has been classified as Green List (High Evidence).
Prepair 500+ v1.706 NDUFAF5 Zornitza Stark Phenotypes for gene: NDUFAF5 were changed from Mitochondrial complex 1 deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 16 MIM#618238
Prepair 500+ v1.705 NDUFAF2 Zornitza Stark Marked gene: NDUFAF2 as ready
Prepair 500+ v1.705 NDUFAF2 Zornitza Stark Gene: ndufaf2 has been classified as Green List (High Evidence).
Prepair 500+ v1.705 NDUFAF2 Zornitza Stark Phenotypes for gene: NDUFAF2 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 10, MIM#618233
Prepair 500+ v1.704 NDUFAF2 Zornitza Stark Publications for gene: NDUFAF2 were set to
Prepair 500+ v1.703 NDRG1 Zornitza Stark Marked gene: NDRG1 as ready
Prepair 500+ v1.703 NDRG1 Zornitza Stark Gene: ndrg1 has been classified as Green List (High Evidence).
Prepair 500+ v1.703 NDRG1 Zornitza Stark Phenotypes for gene: NDRG1 were changed from Charcot-Marie-Tooth disease, type 4D, 601455 (3) to Charcot-Marie-Tooth disease, type 4D MIM#601455
Prepair 500+ v1.702 NDP Zornitza Stark Marked gene: NDP as ready
Prepair 500+ v1.702 NDP Zornitza Stark Gene: ndp has been classified as Green List (High Evidence).
Prepair 500+ v1.702 NDP Zornitza Stark Phenotypes for gene: NDP were changed from Norrie disease, 310600 (3) to Norrie disease, MIM# 310600
Prepair 500+ v1.701 NDP Zornitza Stark Publications for gene: NDP were set to
Prepair 500+ v1.700 NDE1 Zornitza Stark Marked gene: NDE1 as ready
Prepair 500+ v1.700 NDE1 Zornitza Stark Gene: nde1 has been classified as Green List (High Evidence).
Prepair 500+ v1.700 NDE1 Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), 614019 (3) to Lissencephaly 4 (with microcephaly), MIM#614019
Prepair 500+ v1.699 NDE1 Zornitza Stark Publications for gene: NDE1 were set to
Prepair 500+ v1.698 NCF2 Zornitza Stark Marked gene: NCF2 as ready
Prepair 500+ v1.698 NCF2 Zornitza Stark Gene: ncf2 has been classified as Green List (High Evidence).
Prepair 500+ v1.698 NCF2 Zornitza Stark Phenotypes for gene: NCF2 were changed from Chronic granulomatous disease due to deficiency of NCF-2, 233710 (3) to Chronic granulomatous disease 2, autosomal recessive, MIM# 233710
Prepair 500+ v1.697 NCF2 Zornitza Stark Publications for gene: NCF2 were set to
Prepair 500+ v1.696 NBN Zornitza Stark Marked gene: NBN as ready
Prepair 500+ v1.696 NBN Zornitza Stark Gene: nbn has been classified as Green List (High Evidence).
Prepair 500+ v1.696 NBN Zornitza Stark Phenotypes for gene: NBN were changed from Nijmegen breakage syndrome, 251260 (3) to Nijmegen breakage syndrome (MIM#251260)
Prepair 500+ v1.695 NBN Zornitza Stark Publications for gene: NBN were set to
Prepair 500+ v1.694 NARS2 Zornitza Stark Marked gene: NARS2 as ready
Prepair 500+ v1.694 NARS2 Zornitza Stark Gene: nars2 has been classified as Green List (High Evidence).
Prepair 500+ v1.694 NARS2 Zornitza Stark Phenotypes for gene: NARS2 were changed from Combined oxidative phosphorylation deficiency 24, 616239 (3) to Combined oxidative phosphorylation deficiency 24 - MIM#616239, MONDO:0014547
Prepair 500+ v1.693 NARS2 Zornitza Stark Publications for gene: NARS2 were set to
Prepair 500+ v1.692 NALCN Zornitza Stark Marked gene: NALCN as ready
Prepair 500+ v1.692 NALCN Zornitza Stark Gene: nalcn has been classified as Green List (High Evidence).
Prepair 500+ v1.692 NALCN Zornitza Stark Phenotypes for gene: NALCN were changed from Hypotonia, infantile, with psychomotor retardation and characteristic facies, 615419 (3) to Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 (MIM#615419)
Prepair 500+ v1.691 NALCN Zornitza Stark Publications for gene: NALCN were set to
Prepair 500+ v1.690 NAGS Zornitza Stark Marked gene: NAGS as ready
Prepair 500+ v1.690 NAGS Zornitza Stark Gene: nags has been classified as Green List (High Evidence).
Prepair 500+ v1.690 NAGS Zornitza Stark Phenotypes for gene: NAGS were changed from N-acetylglutamate synthase deficiency, 237310 (3) to N-acetylglutamate synthase deficiency MIM#237310
Prepair 500+ v1.689 NAGS Zornitza Stark Publications for gene: NAGS were set to
Prepair 500+ v1.688 NAGLU Zornitza Stark Marked gene: NAGLU as ready
Prepair 500+ v1.688 NAGLU Zornitza Stark Gene: naglu has been classified as Green List (High Evidence).
Prepair 500+ v1.688 NAGLU Zornitza Stark Phenotypes for gene: NAGLU were changed from Mucopolysaccharidosis type IIIB (Sanfilippo B), 252920 (3) to Mucopolysaccharidosis type IIIB (Sanfilippo B) MIM#252920
Prepair 500+ v1.687 NAGLU Zornitza Stark Publications for gene: NAGLU were set to
Prepair 500+ v1.686 NAGA Zornitza Stark Marked gene: NAGA as ready
Prepair 500+ v1.686 NAGA Zornitza Stark Gene: naga has been classified as Green List (High Evidence).
Prepair 500+ v1.686 NAGA Zornitza Stark Phenotypes for gene: NAGA were changed from Schindler disease, type I, 609241 (3) to Schindler disease, type I MIM#609241; Schindler disease, type III MIM#609241
Prepair 500+ v1.685 NAGA Zornitza Stark Publications for gene: NAGA were set to
Prepair 500+ v1.684 MYO7A Zornitza Stark Marked gene: MYO7A as ready
Prepair 500+ v1.684 MYO7A Zornitza Stark Gene: myo7a has been classified as Green List (High Evidence).
Prepair 500+ v1.684 MYO7A Zornitza Stark Phenotypes for gene: MYO7A were changed from Usher syndrome, type 1B, 276900 (3) to Usher syndrome, type 1B, MIM# 276900
Prepair 500+ v1.683 MYO7A Zornitza Stark Publications for gene: MYO7A were set to
Prepair 500+ v1.682 MYO5B Zornitza Stark Marked gene: MYO5B as ready
Prepair 500+ v1.682 MYO5B Zornitza Stark Gene: myo5b has been classified as Green List (High Evidence).
Prepair 500+ v1.682 MYO5B Zornitza Stark Phenotypes for gene: MYO5B were changed from Microvillus inclusion disease, 251850 (3) to Cholestasis, progressive familial intrahepatic, 10, MIM#619868; Diarrhea 2, with microvillus atrophy, with or without cholestasis, MIM#251850
Prepair 500+ v1.681 MYO5B Zornitza Stark Publications for gene: MYO5B were set to
Prepair 500+ v1.680 MVK Zornitza Stark Marked gene: MVK as ready
Prepair 500+ v1.680 MVK Zornitza Stark Gene: mvk has been classified as Green List (High Evidence).
Prepair 500+ v1.680 MVK Zornitza Stark Phenotypes for gene: MVK were changed from Mevalonic aciduria, 610377 (3) to Mevalonic aciduria, MIM#610377; Hyper-IgD syndrome, MIM#260920
Prepair 500+ v1.679 MVK Zornitza Stark Publications for gene: MVK were set to
Prepair 500+ v1.678 MUT Zornitza Stark Marked gene: MUT as ready
Prepair 500+ v1.678 MUT Zornitza Stark Gene: mut has been classified as Green List (High Evidence).
Prepair 500+ v1.678 MUT Zornitza Stark Phenotypes for gene: MUT were changed from Methylmalonic aciduria, mut(0) type, 251000 (3) to Methylmalonic aciduria, mut(0) type, MIM# 251000
Prepair 500+ v1.677 MUSK Zornitza Stark Marked gene: MUSK as ready
Prepair 500+ v1.677 MUSK Zornitza Stark Gene: musk has been classified as Green List (High Evidence).
Prepair 500+ v1.677 MUSK Zornitza Stark Phenotypes for gene: MUSK were changed from Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 (3) to Fetal akinesia deformation sequence 1 MIM#208150; Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325
Prepair 500+ v1.676 MUSK Zornitza Stark Publications for gene: MUSK were set to
Prepair 500+ v1.675 MTTP Zornitza Stark Marked gene: MTTP as ready
Prepair 500+ v1.675 MTTP Zornitza Stark Gene: mttp has been classified as Green List (High Evidence).
Prepair 500+ v1.675 MTTP Zornitza Stark Phenotypes for gene: MTTP were changed from Abetalipoproteinemia, 200100 (3) to Abetalipoproteinaemia MIM#200100
Prepair 500+ v1.674 MTTP Zornitza Stark Publications for gene: MTTP were set to
Prepair 500+ v1.673 MTRR Zornitza Stark Marked gene: MTRR as ready
Prepair 500+ v1.673 MTRR Zornitza Stark Gene: mtrr has been classified as Green List (High Evidence).
Prepair 500+ v1.673 MTRR Zornitza Stark Phenotypes for gene: MTRR were changed from Homocystinuria-megaloblastic anemia, cbl E type, 236270 (3) to Homocystinuria-megaloblastic anemia, cbl E type, MIM #236270
Prepair 500+ v1.672 MTRR Zornitza Stark Publications for gene: MTRR were set to
Prepair 500+ v1.671 MTR Zornitza Stark Marked gene: MTR as ready
Prepair 500+ v1.671 MTR Zornitza Stark Gene: mtr has been classified as Green List (High Evidence).
Prepair 500+ v1.671 MTR Zornitza Stark Phenotypes for gene: MTR were changed from Homocystinuria-megaloblastic anemia, cblG complementation type, 250940 (3) to Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940
Prepair 500+ v1.670 MTR Zornitza Stark Publications for gene: MTR were set to
Prepair 500+ v1.669 MTMR2 Zornitza Stark Marked gene: MTMR2 as ready
Prepair 500+ v1.669 MTMR2 Zornitza Stark Gene: mtmr2 has been classified as Green List (High Evidence).
Prepair 500+ v1.669 MTMR2 Zornitza Stark Phenotypes for gene: MTMR2 were changed from Charcot-Marie-Tooth disease, type 4B1, 601382 (3) to Charcot-Marie-Tooth disease, type 4B1, MIM#601382
Prepair 500+ v1.668 MTM1 Zornitza Stark Marked gene: MTM1 as ready
Prepair 500+ v1.668 MTM1 Zornitza Stark Gene: mtm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.668 MTM1 Zornitza Stark Phenotypes for gene: MTM1 were changed from Myotubular myopathy, X-linked, 310400 (3) to Myopathy, centronuclear, X-linked MIM#310400
Prepair 500+ v1.667 MTM1 Zornitza Stark Publications for gene: MTM1 were set to
Prepair 500+ v1.666 MTHFR Zornitza Stark Marked gene: MTHFR as ready
Prepair 500+ v1.666 MTHFR Zornitza Stark Gene: mthfr has been classified as Green List (High Evidence).
Prepair 500+ v1.666 MTHFR Zornitza Stark Phenotypes for gene: MTHFR were changed from Homocystinuria due to MTHFR deficiency, 236250 (3) to Homocystinuria due to MTHFR deficiency, MIM# 236250
Prepair 500+ v1.665 MTHFR Zornitza Stark Publications for gene: MTHFR were set to
Prepair 500+ v1.664 MTFMT Zornitza Stark Marked gene: MTFMT as ready
Prepair 500+ v1.664 MTFMT Zornitza Stark Gene: mtfmt has been classified as Green List (High Evidence).
Prepair 500+ v1.664 MTFMT Zornitza Stark Phenotypes for gene: MTFMT were changed from Combined oxidative phosphorylation deficiency 15, 614947 (3) to Combined oxidative phosphorylation deficiency 15, MIM#614947
Prepair 500+ v1.663 MTFMT Zornitza Stark Publications for gene: MTFMT were set to
Prepair 500+ v1.662 MRE11 Zornitza Stark Marked gene: MRE11 as ready
Prepair 500+ v1.662 MRE11 Zornitza Stark Gene: mre11 has been classified as Green List (High Evidence).
Prepair 500+ v1.662 MRE11 Zornitza Stark Phenotypes for gene: MRE11 were changed from Ataxia-telangiectasia-like disorder, 604391 (3) to Ataxia-telangiectasia-like disorder, MIM#604391
Prepair 500+ v1.661 MRE11 Zornitza Stark Publications for gene: MRE11 were set to
Prepair 500+ v1.660 MPV17 Zornitza Stark Marked gene: MPV17 as ready
Prepair 500+ v1.660 MPV17 Zornitza Stark Gene: mpv17 has been classified as Green List (High Evidence).
Prepair 500+ v1.660 MPV17 Zornitza Stark Phenotypes for gene: MPV17 were changed from Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), 256810 (3) to Charcot-Marie-Tooth disease, axonal, type 2EE, MIM#618400; Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), MIM#256810
Prepair 500+ v1.659 MPV17 Zornitza Stark Publications for gene: MPV17 were set to
Prepair 500+ v1.658 MPL Zornitza Stark Marked gene: MPL as ready
Prepair 500+ v1.658 MPL Zornitza Stark Gene: mpl has been classified as Green List (High Evidence).
Prepair 500+ v1.658 MPL Zornitza Stark Phenotypes for gene: MPL were changed from Thrombocytopenia, congenital amegakaryocytic, 604498 (3) to Amegakaryocytic thrombocytopenia, congenital, 1, MIM# 604498
Prepair 500+ v1.657 MPL Zornitza Stark Publications for gene: MPL were set to
Prepair 500+ v1.656 MPI Zornitza Stark Marked gene: MPI as ready
Prepair 500+ v1.656 MPI Zornitza Stark Gene: mpi has been classified as Green List (High Evidence).
Prepair 500+ v1.656 MPI Zornitza Stark Phenotypes for gene: MPI were changed from Congenital disorder of glycosylation, type Ib, 602579 (3) to Congenital disorder of glycosylation, type Ib, MIM# 602579
Prepair 500+ v1.655 MPI Zornitza Stark Publications for gene: MPI were set to
Prepair 500+ v1.654 MOCS2 Zornitza Stark Marked gene: MOCS2 as ready
Prepair 500+ v1.654 MOCS2 Zornitza Stark Gene: mocs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.654 MOCS2 Zornitza Stark Phenotypes for gene: MOCS2 were changed from Molybdenum cofactor deficiency B, 252160 (3) to Molybdenum cofactor deficiency B (MIM#252160)
Prepair 500+ v1.653 MOCS2 Zornitza Stark Publications for gene: MOCS2 were set to
Prepair 500+ v1.652 MOCS1 Zornitza Stark Marked gene: MOCS1 as ready
Prepair 500+ v1.652 MOCS1 Zornitza Stark Gene: mocs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.652 MOCS1 Zornitza Stark Phenotypes for gene: MOCS1 were changed from Molybdenum cofactor deficiency A, 252150 (3) to Molybdenum cofactor deficiency A (MIM#252150)
Prepair 500+ v1.651 MOCS1 Zornitza Stark Publications for gene: MOCS1 were set to
Prepair 500+ v1.650 MMADHC Zornitza Stark Marked gene: MMADHC as ready
Prepair 500+ v1.650 MMADHC Zornitza Stark Gene: mmadhc has been classified as Green List (High Evidence).
Prepair 500+ v1.650 MMADHC Zornitza Stark Phenotypes for gene: MMADHC were changed from Methylmalonic aciduria and homocystinuria, cblD type, 277410 (3) to Homocystinuria, cblD type, variant 1 MIM#277410; Methylmalonic aciduria and homocystinuria, cblD type MIM#277410; Methylmalonic aciduria, cblD type, variant 2 MIM#277410; Disorders of cobalamin absorption, transport and metabolism
Prepair 500+ v1.649 MMADHC Zornitza Stark Publications for gene: MMADHC were set to
Prepair 500+ v1.648 MMACHC Zornitza Stark Marked gene: MMACHC as ready
Prepair 500+ v1.648 MMACHC Zornitza Stark Gene: mmachc has been classified as Green List (High Evidence).
Prepair 500+ v1.648 MMACHC Zornitza Stark Phenotypes for gene: MMACHC were changed from Methylmalonic aciduria and homocystinuria, cblC type, 277400 (3) to Methylmalonic aciduria and homocystinuria, cblC type MIM#277400
Prepair 500+ v1.647 MMACHC Zornitza Stark Publications for gene: MMACHC were set to
Prepair 500+ v1.646 MMAB Zornitza Stark Marked gene: MMAB as ready
Prepair 500+ v1.646 MMAB Zornitza Stark Gene: mmab has been classified as Green List (High Evidence).
Prepair 500+ v1.646 MMAB Zornitza Stark Phenotypes for gene: MMAB were changed from Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type, 251110 (3) to Methylmalonic aciduria, vitamin B12-responsive, cblB type MIM#251110
Prepair 500+ v1.645 MMAB Zornitza Stark Publications for gene: MMAB were set to
Prepair 500+ v1.644 MMAA Zornitza Stark Marked gene: MMAA as ready
Prepair 500+ v1.644 MMAA Zornitza Stark Gene: mmaa has been classified as Green List (High Evidence).
Prepair 500+ v1.644 MMAA Zornitza Stark Phenotypes for gene: MMAA were changed from Methylmalonic aciduria, vitamin B12-responsive, 251100 (3) to Methylmalonic aciduria, vitamin B12-responsive, MIM#251100
Prepair 500+ v1.643 MLYCD Zornitza Stark Marked gene: MLYCD as ready
Prepair 500+ v1.643 MLYCD Zornitza Stark Gene: mlycd has been classified as Green List (High Evidence).
Prepair 500+ v1.643 MLYCD Zornitza Stark Phenotypes for gene: MLYCD were changed from Malonyl-CoA decarboxylase deficiency, 248360 (3) to Malonyl-CoA decarboxylase deficiency, MIM#248360
Prepair 500+ v1.642 MLC1 Zornitza Stark Marked gene: MLC1 as ready
Prepair 500+ v1.642 MLC1 Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.642 MLC1 Zornitza Stark Phenotypes for gene: MLC1 were changed from Megalencephalic leukoencephalopathy with subcortical cysts, 604004 (3) to Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004
Prepair 500+ v1.641 MLC1 Zornitza Stark Publications for gene: MLC1 were set to
Prepair 500+ v1.640 MKS1 Zornitza Stark Marked gene: MKS1 as ready
Prepair 500+ v1.640 MKS1 Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence).
Prepair 500+ v1.640 MKS1 Zornitza Stark Phenotypes for gene: MKS1 were changed from Meckel syndrome 1, 249000 (3) to Bardet-Biedl syndrome 13 MIM#615990; Joubert syndrome 28 MIM#617121; Meckel syndrome 1 MIM#249000; Ciliopathy MONDO:0005308
Prepair 500+ v1.639 MKS1 Zornitza Stark Publications for gene: MKS1 were set to
Prepair 500+ v1.638 MKKS Zornitza Stark Marked gene: MKKS as ready
Prepair 500+ v1.638 MKKS Zornitza Stark Gene: mkks has been classified as Green List (High Evidence).
Prepair 500+ v1.638 MKKS Zornitza Stark Phenotypes for gene: MKKS were changed from McKusick-Kaufman syndrome, 236700 (3) to Bardet-Biedl syndrome 6 MIM#605231; McKusick-Kaufman syndrome MIM#236700; MKKS-related ciliopathy MONDO:1040050
Prepair 500+ v1.637 MKKS Zornitza Stark Publications for gene: MKKS were set to
Prepair 500+ v1.636 MID1 Zornitza Stark Marked gene: MID1 as ready
Prepair 500+ v1.636 MID1 Zornitza Stark Gene: mid1 has been classified as Green List (High Evidence).
Prepair 500+ v1.636 MID1 Zornitza Stark Phenotypes for gene: MID1 were changed from Opitz GBBB syndrome, type I, 300000 (3) to Opitz GBBB syndrome MIM#300000; MONDO:0017138
Prepair 500+ v1.635 MID1 Zornitza Stark Publications for gene: MID1 were set to
Prepair 500+ v1.634 MFSD8 Zornitza Stark Marked gene: MFSD8 as ready
Prepair 500+ v1.634 MFSD8 Zornitza Stark Gene: mfsd8 has been classified as Green List (High Evidence).
Prepair 500+ v1.634 MFSD8 Zornitza Stark Phenotypes for gene: MFSD8 were changed from Ceroid lipofuscinosis, neuronal, 7, 610951 (3) to Ceroid lipofuscinosis, neuronal, 7, MIM# 610951; MONDO:0012588
Prepair 500+ v1.633 MFSD8 Zornitza Stark Publications for gene: MFSD8 were set to
Prepair 500+ v1.632 MFN2 Zornitza Stark Marked gene: MFN2 as ready
Prepair 500+ v1.632 MFN2 Zornitza Stark Gene: mfn2 has been classified as Green List (High Evidence).
Prepair 500+ v1.632 MFN2 Zornitza Stark Phenotypes for gene: MFN2 were changed from Charcot-Marie-Tooth disease, axonal, type 2A2B, 617087 (3), Autosomal recessive to Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800
Prepair 500+ v1.631 MFN2 Zornitza Stark Publications for gene: MFN2 were set to
Prepair 500+ v1.630 METTL23 Zornitza Stark Marked gene: METTL23 as ready
Prepair 500+ v1.630 METTL23 Zornitza Stark Gene: mettl23 has been classified as Green List (High Evidence).
Prepair 500+ v1.630 METTL23 Zornitza Stark Phenotypes for gene: METTL23 were changed from Mental retardation, autosomal recessive 44, 615942 (3) to Intellectual developmental disorder, autosomal recessive 44, MIM #615942
Prepair 500+ v1.629 METTL23 Zornitza Stark Publications for gene: METTL23 were set to
Prepair 500+ v1.628 MESP2 Zornitza Stark Marked gene: MESP2 as ready
Prepair 500+ v1.628 MESP2 Zornitza Stark Gene: mesp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.628 MESP2 Zornitza Stark Phenotypes for gene: MESP2 were changed from Spondylocostal dysostosis 2, autosomal recessive, 608681 (3) to Spondylocostal dysostosis 2, MIM #608681
Prepair 500+ v1.627 MESP2 Zornitza Stark Publications for gene: MESP2 were set to
Prepair 500+ v1.626 MED17 Zornitza Stark Marked gene: MED17 as ready
Prepair 500+ v1.626 MED17 Zornitza Stark Gene: med17 has been classified as Green List (High Evidence).
Prepair 500+ v1.626 MED17 Zornitza Stark Phenotypes for gene: MED17 were changed from Microcephaly, postnatal progressive, with seizures and brain atrophy, 613668 (3) to Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668
Prepair 500+ v1.625 MED17 Zornitza Stark Publications for gene: MED17 were set to
Prepair 500+ v1.624 MED12 Zornitza Stark Marked gene: MED12 as ready
Prepair 500+ v1.624 MED12 Zornitza Stark Gene: med12 has been classified as Green List (High Evidence).
Prepair 500+ v1.624 MED12 Zornitza Stark Phenotypes for gene: MED12 were changed from Lujan-Fryns syndrome, 309520 (3) to MED12-related intellectual disability syndrome, MONDO:0100000
Prepair 500+ v1.623 MED12 Zornitza Stark Publications for gene: MED12 were set to
Prepair 500+ v1.622 MECP2 Zornitza Stark Marked gene: MECP2 as ready
Prepair 500+ v1.622 MECP2 Zornitza Stark Gene: mecp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.622 MECP2 Zornitza Stark Phenotypes for gene: MECP2 were changed from Encephalopathy, neonatal severe, 300673 (3) to Encephalopathy, neonatal severe MIM#300673; Intellectual developmental disorder, X-linked syndromic 13 MIM#300055; Intellectual developmental disorder, X-linked syndromic, Lubs type MIM#300260
Prepair 500+ v1.621 MECP2 Zornitza Stark Publications for gene: MECP2 were set to
Prepair 500+ v1.620 MCPH1 Zornitza Stark Marked gene: MCPH1 as ready
Prepair 500+ v1.620 MCPH1 Zornitza Stark Gene: mcph1 has been classified as Green List (High Evidence).
Prepair 500+ v1.620 MCPH1 Zornitza Stark Phenotypes for gene: MCPH1 were changed from Microcephaly 1, primary, autosomal recessive, 251200 (3) to Microcephaly 1, primary, autosomal recessive, MIM#251200
Prepair 500+ v1.619 MCPH1 Zornitza Stark Publications for gene: MCPH1 were set to
Prepair 500+ v1.618 MCOLN1 Zornitza Stark Marked gene: MCOLN1 as ready
Prepair 500+ v1.618 MCOLN1 Zornitza Stark Gene: mcoln1 has been classified as Green List (High Evidence).
Prepair 500+ v1.618 MCOLN1 Zornitza Stark Phenotypes for gene: MCOLN1 were changed from Mucolipidosis IV, 252650 (3) to Mucolipidosis IV MIM#252650
Prepair 500+ v1.617 MCOLN1 Zornitza Stark Publications for gene: MCOLN1 were set to
Prepair 500+ v1.616 MASP1 Zornitza Stark Marked gene: MASP1 as ready
Prepair 500+ v1.616 MASP1 Zornitza Stark Gene: masp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.616 MASP1 Zornitza Stark Phenotypes for gene: MASP1 were changed from 3MC syndrome 1, 257920 (3) to 3MC syndrome 1, MIM# 257920
Prepair 500+ v1.615 MASP1 Zornitza Stark Publications for gene: MASP1 were set to
Prepair 500+ v1.614 MANBA Zornitza Stark Marked gene: MANBA as ready
Prepair 500+ v1.614 MANBA Zornitza Stark Gene: manba has been classified as Green List (High Evidence).
Prepair 500+ v1.614 MANBA Zornitza Stark Phenotypes for gene: MANBA were changed from Mannosidosis, beta, 248510 (3) to Mannosidosis, beta, MIM#248510
Prepair 500+ v1.613 MAN2B1 Zornitza Stark Marked gene: MAN2B1 as ready
Prepair 500+ v1.613 MAN2B1 Zornitza Stark Gene: man2b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.613 MAN2B1 Zornitza Stark Phenotypes for gene: MAN2B1 were changed from Mannosidosis, alpha-, types I and II, 248500 (3) to Mannosidosis, alpha-, types I and II, MIM# 248500; MONDO:0009561
Intellectual disability syndromic and non-syndromic v1.141 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193
Intellectual disability syndromic and non-syndromic v1.140 LSM1 Zornitza Stark reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: FICUS syndrome, MIM# 621193; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2588 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from Neurodevelopmental disorder, MONDO:0700092, LSM1-related to FICUS syndrome, MIM# 621193
Mendeliome v1.2587 LSM1 Zornitza Stark edited their review of gene: LSM1: Changed phenotypes: FICUS syndrome, MIM# 621193
Prepair 500+ v1.612 ZDHHC9 Seb Lunke Marked gene: ZDHHC9 as ready
Prepair 500+ v1.612 ZDHHC9 Seb Lunke Gene: zdhhc9 has been classified as Green List (High Evidence).
Prepair 500+ v1.612 ZDHHC9 Seb Lunke Tag SV/CNV tag was added to gene: ZDHHC9.
Prepair 500+ v1.612 ZDHHC9 Seb Lunke Phenotypes for gene: ZDHHC9 were changed from Mental retardation, X-linked syndromic, Raymond type, 300799 (3) to Syndromic X-linked intellectual disability, Raymond type MIM#300799 MONDO:0010427
Prepair 500+ v1.611 ZDHHC9 Seb Lunke Publications for gene: ZDHHC9 were set to
Prepair 500+ v1.610 ZFYVE26 Seb Lunke Marked gene: ZFYVE26 as ready
Prepair 500+ v1.610 ZFYVE26 Seb Lunke Gene: zfyve26 has been classified as Green List (High Evidence).
Prepair 500+ v1.610 ZFYVE26 Seb Lunke Phenotypes for gene: ZFYVE26 were changed from Spastic paraplegia 15, autosomal recessive, 270700 (3) to Spastic paraplegia 15, autosomal recessive MIM#270700
Prepair 500+ v1.609 ZFYVE26 Seb Lunke Publications for gene: ZFYVE26 were set to
Prepair 500+ v1.608 ZNF711 Seb Lunke Marked gene: ZNF711 as ready
Prepair 500+ v1.608 ZNF711 Seb Lunke Gene: znf711 has been classified as Green List (High Evidence).
Prepair 500+ v1.608 ZNF711 Seb Lunke Phenotypes for gene: ZNF711 were changed from Mental retardation, X-linked 97, 300803 (3) to Intellectual developmental disorder, X-linked 97, MIM# 300803
Prepair 1000+ v2.12 PUS7 Zornitza Stark Tag for review was removed from gene: PUS7.
Prepair 1000+ v2.12 PEX19 Zornitza Stark Tag for review was removed from gene: PEX19.
Prepair 1000+ v2.12 ZNF469 Zornitza Stark Classified gene: ZNF469 as Green List (high evidence)
Prepair 1000+ v2.12 ZNF469 Zornitza Stark Gene: znf469 has been classified as Green List (High Evidence).
Prepair 1000+ v2.11 ZNF469 Zornitza Stark Tag for review was removed from gene: ZNF469.
Prepair 1000+ v2.11 TRAPPC12 Zornitza Stark Classified gene: TRAPPC12 as Green List (high evidence)
Prepair 1000+ v2.11 TRAPPC12 Zornitza Stark Gene: trappc12 has been classified as Green List (High Evidence).
Prepair 1000+ v2.10 TRAPPC12 Zornitza Stark Tag for review was removed from gene: TRAPPC12.
Prepair 1000+ v2.10 PUS7 Zornitza Stark Classified gene: PUS7 as Green List (high evidence)
Prepair 1000+ v2.10 PUS7 Zornitza Stark Gene: pus7 has been classified as Green List (High Evidence).
Prepair 1000+ v2.9 PTPN23 Zornitza Stark Tag for review was removed from gene: PTPN23.
Prepair 1000+ v2.9 PTPN23 Zornitza Stark Classified gene: PTPN23 as Green List (high evidence)
Prepair 1000+ v2.9 PTPN23 Zornitza Stark Gene: ptpn23 has been classified as Green List (High Evidence).
Prepair 1000+ v2.8 GPR143 Zornitza Stark Tag for review was removed from gene: GPR143.
Prepair 500+ v1.607 LZTFL1 Zornitza Stark Marked gene: LZTFL1 as ready
Prepair 500+ v1.607 LZTFL1 Zornitza Stark Gene: lztfl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.607 LZTFL1 Zornitza Stark Phenotypes for gene: LZTFL1 were changed from Bardet-Biedl syndrome 17, 615994 (3) to Bardet-Biedl syndrome 17 MIM#615994; MONDO:0014445
Prepair 500+ v1.606 LZTFL1 Zornitza Stark Publications for gene: LZTFL1 were set to
Prepair 500+ v1.605 LYST Zornitza Stark Marked gene: LYST as ready
Prepair 500+ v1.605 LYST Zornitza Stark Gene: lyst has been classified as Green List (High Evidence).
Prepair 500+ v1.605 LYST Zornitza Stark Phenotypes for gene: LYST were changed from Chediak-Higashi syndrome, 214500 (3) to Chediak-Higashi syndrome MIM#214500
Prepair 500+ v1.604 LYST Zornitza Stark Publications for gene: LYST were set to
Prepair 500+ v1.603 LRPPRC Zornitza Stark Marked gene: LRPPRC as ready
Prepair 500+ v1.603 LRPPRC Zornitza Stark Gene: lrpprc has been classified as Green List (High Evidence).
Prepair 500+ v1.603 LRPPRC Zornitza Stark Phenotypes for gene: LRPPRC were changed from Leigh syndrome, French-Canadian type, 220111 (3) to Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) 220111 (3)
Prepair 500+ v1.602 LRPPRC Zornitza Stark Publications for gene: LRPPRC were set to
Prepair 500+ v1.601 LRP2 Zornitza Stark Marked gene: LRP2 as ready
Prepair 500+ v1.601 LRP2 Zornitza Stark Gene: lrp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.601 LRP2 Zornitza Stark Phenotypes for gene: LRP2 were changed from Donnai-Barrow syndrome, 222448 (3) to Donnai-Barrow syndrome, MIM #222448
Prepair 500+ v1.600 LRP2 Zornitza Stark Publications for gene: LRP2 were set to
Prepair 500+ v1.599 LRAT Zornitza Stark Marked gene: LRAT as ready
Prepair 500+ v1.599 LRAT Zornitza Stark Gene: lrat has been classified as Green List (High Evidence).
Prepair 500+ v1.599 LRAT Zornitza Stark Phenotypes for gene: LRAT were changed from Leber congenital amaurosis 14, 613341 (3) to Retinal dystrophy, early-onset severe; Leber congenital amaurosis 14; Retinitis pigmentosa, juvenile, all under MIM #613341
Prepair 500+ v1.598 LRAT Zornitza Stark Publications for gene: LRAT were set to
Prepair 500+ v1.597 LPL Zornitza Stark Marked gene: LPL as ready
Prepair 500+ v1.597 LPL Zornitza Stark Gene: lpl has been classified as Green List (High Evidence).
Prepair 500+ v1.597 LPL Zornitza Stark Phenotypes for gene: LPL were changed from Lipoprotein lipase deficiency, 238600 (3) to Lipoprotein lipase deficiency MIM#238600
Prepair 500+ v1.596 LMNA Zornitza Stark Marked gene: LMNA as ready
Prepair 500+ v1.596 LMNA Zornitza Stark Gene: lmna has been classified as Green List (High Evidence).
Prepair 500+ v1.596 LMNA Zornitza Stark Phenotypes for gene: LMNA were changed from Restrictive dermopathy, lethal, 275210 (3) to Restrictive dermopathy, lethal, MIM#275210; Mandibuloacral dysplasia, MIM# 248370
Prepair 500+ v1.595 LMBRD1 Zornitza Stark Marked gene: LMBRD1 as ready
Prepair 500+ v1.595 LMBRD1 Zornitza Stark Gene: lmbrd1 has been classified as Green List (High Evidence).
Prepair 500+ v1.595 LMBRD1 Zornitza Stark Phenotypes for gene: LMBRD1 were changed from Methylmalonic aciduria and homocystinuria, cblF type, 277380 (3) to Methylmalonic aciduria and homocystinuria, cblF type, MIM#277380
Prepair 500+ v1.594 LMBRD1 Zornitza Stark Publications for gene: LMBRD1 were set to
Prepair 500+ v1.593 LIPA Zornitza Stark Marked gene: LIPA as ready
Prepair 500+ v1.593 LIPA Zornitza Stark Gene: lipa has been classified as Green List (High Evidence).
Prepair 500+ v1.593 LIPA Zornitza Stark Phenotypes for gene: LIPA were changed from Cholesteryl ester storage disease, 278000 (3) to Wolman disease, MIM#620151; Cholesteryl ester storage disease, MIM#278000
Prepair 500+ v1.592 LIPA Zornitza Stark Publications for gene: LIPA were set to
Prepair 500+ v1.591 LIG4 Zornitza Stark Marked gene: LIG4 as ready
Prepair 500+ v1.591 LIG4 Zornitza Stark Gene: lig4 has been classified as Green List (High Evidence).
Prepair 500+ v1.591 LIG4 Zornitza Stark Phenotypes for gene: LIG4 were changed from LIG4 syndrome, 606593 (3) to LIG4 syndrome, MIM# 606593 DNA ligase IV deficiency, MONDO:0011686
Prepair 500+ v1.590 LIG4 Zornitza Stark Publications for gene: LIG4 were set to
Prepair 500+ v1.589 LIFR Zornitza Stark Marked gene: LIFR as ready
Prepair 500+ v1.589 LIFR Zornitza Stark Gene: lifr has been classified as Green List (High Evidence).
Prepair 500+ v1.589 LIFR Zornitza Stark Phenotypes for gene: LIFR were changed from Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, 601559 (3) to Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, MIM#601559
Prepair 500+ v1.588 LIFR Zornitza Stark Publications for gene: LIFR were set to
Prepair 500+ v1.587 LHX3 Zornitza Stark Marked gene: LHX3 as ready
Prepair 500+ v1.587 LHX3 Zornitza Stark Gene: lhx3 has been classified as Green List (High Evidence).
Prepair 500+ v1.587 LHX3 Zornitza Stark Phenotypes for gene: LHX3 were changed from Pituitary hormone deficiency, combined, 3, 221750 (3) to Pituitary hormone deficiency, combined, 3 (MIM# 221750)
Prepair 500+ v1.586 LHX3 Zornitza Stark Publications for gene: LHX3 were set to
Prepair 500+ v1.585 LDLRAP1 Zornitza Stark Marked gene: LDLRAP1 as ready
Prepair 500+ v1.585 LDLRAP1 Zornitza Stark Gene: ldlrap1 has been classified as Green List (High Evidence).
Prepair 500+ v1.585 LDLRAP1 Zornitza Stark Phenotypes for gene: LDLRAP1 were changed from Hypercholesterolemia, familial, autosomal recessive, 603813 (3) to Familial hypercholesterolemia 4, MIM#603813
Prepair 500+ v1.584 LDLRAP1 Zornitza Stark Publications for gene: LDLRAP1 were set to
Prepair 500+ v1.583 LDLR Zornitza Stark Marked gene: LDLR as ready
Prepair 500+ v1.583 LDLR Zornitza Stark Gene: ldlr has been classified as Green List (High Evidence).
Prepair 500+ v1.583 LDLR Zornitza Stark Phenotypes for gene: LDLR were changed from LDL cholesterol level QTL2/Hypercholesterolemia, familial to Hypercholesterolaemia, familial, 1, MIM# 143890
Prepair 500+ v1.582 LCA5 Zornitza Stark Marked gene: LCA5 as ready
Prepair 500+ v1.582 LCA5 Zornitza Stark Gene: lca5 has been classified as Green List (High Evidence).
Prepair 500+ v1.582 LCA5 Zornitza Stark Phenotypes for gene: LCA5 were changed from Leber congenital amaurosis 5, 604537 (3) to Leber congenital amaurosis 5, MIM# 604537
Prepair 500+ v1.581 LCA5 Zornitza Stark Publications for gene: LCA5 were set to
Prepair 500+ v1.580 LARS Zornitza Stark Tag new gene name tag was added to gene: LARS.
Prepair 500+ v1.580 LARS Zornitza Stark Marked gene: LARS as ready
Prepair 500+ v1.580 LARS Zornitza Stark Gene: lars has been classified as Green List (High Evidence).
Prepair 500+ v1.580 LARGE1 Zornitza Stark Marked gene: LARGE1 as ready
Prepair 500+ v1.580 LARGE1 Zornitza Stark Gene: large1 has been classified as Green List (High Evidence).
Prepair 500+ v1.580 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, 613154 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, MIM #613154; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 6, MIM #608840
Prepair 500+ v1.579 LARGE1 Zornitza Stark Publications for gene: LARGE1 were set to
Prepair 500+ v1.578 LAMC2 Zornitza Stark Marked gene: LAMC2 as ready
Prepair 500+ v1.578 LAMC2 Zornitza Stark Gene: lamc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.578 LAMC2 Zornitza Stark Phenotypes for gene: LAMC2 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 3B, severe MIM #619786; Epidermolysis bullosa, junctional 3A, intermediate MIM #619785
Prepair 500+ v1.577 LAMC2 Zornitza Stark Publications for gene: LAMC2 were set to
Prepair 500+ v1.576 LAMB3 Zornitza Stark Marked gene: LAMB3 as ready
Prepair 500+ v1.576 LAMB3 Zornitza Stark Gene: lamb3 has been classified as Green List (High Evidence).
Prepair 500+ v1.576 LAMB3 Zornitza Stark Phenotypes for gene: LAMB3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 1A, intermediate MIM#226650; Epidermolysis bullosa, junctional 1B, severe MIM#226700
Prepair 500+ v1.575 LAMB3 Zornitza Stark Publications for gene: LAMB3 were set to
Prepair 500+ v1.574 LAMB2 Zornitza Stark Marked gene: LAMB2 as ready
Prepair 500+ v1.574 LAMB2 Zornitza Stark Gene: lamb2 has been classified as Green List (High Evidence).
Prepair 500+ v1.574 LAMB2 Zornitza Stark Phenotypes for gene: LAMB2 were changed from Pierson syndrome, 609049 (3) to Pierson syndrome, MIM# 609049; Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199
Prepair 500+ v1.573 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Prepair 500+ v1.573 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.573 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from Lissencephaly 5, 615191 (3) to Lissencephaly 5 MIM#615191
Prepair 500+ v1.572 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Prepair 500+ v1.571 LAMA3 Zornitza Stark Marked gene: LAMA3 as ready
Prepair 500+ v1.571 LAMA3 Zornitza Stark Gene: lama3 has been classified as Green List (High Evidence).
Prepair 500+ v1.571 LAMA3 Zornitza Stark Phenotypes for gene: LAMA3 were changed from Epidermolysis bullosa, junctional, Herlitz type, 226700 (3) to Epidermolysis bullosa, junctional 2B, severe (MIM#619784); 3. Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous (MIM#245660); Epidermolysis bullosa, junctional 2A, intermediate (MIM#619783)
Prepair 500+ v1.570 LAMA3 Zornitza Stark Publications for gene: LAMA3 were set to
Mendeliome v1.2587 CERS1 Zornitza Stark Marked gene: CERS1 as ready
Mendeliome v1.2587 CERS1 Zornitza Stark Gene: cers1 has been classified as Green List (High Evidence).
Mendeliome v1.2587 CERS1 Zornitza Stark Classified gene: CERS1 as Green List (high evidence)
Mendeliome v1.2587 CERS1 Zornitza Stark Gene: cers1 has been classified as Green List (High Evidence).
Mendeliome v1.2586 DBF4 Zornitza Stark Marked gene: DBF4 as ready
Mendeliome v1.2586 DBF4 Zornitza Stark Gene: dbf4 has been classified as Red List (Low Evidence).
Mendeliome v1.2586 DBF4 Zornitza Stark Classified gene: DBF4 as Red List (low evidence)
Mendeliome v1.2586 DBF4 Zornitza Stark Gene: dbf4 has been classified as Red List (Low Evidence).
Mendeliome v1.2585 GINS4 Zornitza Stark Marked gene: GINS4 as ready
Mendeliome v1.2585 GINS4 Zornitza Stark Gene: gins4 has been classified as Red List (Low Evidence).
Mendeliome v1.2585 GINS4 Zornitza Stark Classified gene: GINS4 as Red List (low evidence)
Mendeliome v1.2585 GINS4 Zornitza Stark Gene: gins4 has been classified as Red List (Low Evidence).
Mendeliome v1.2584 ARSI Zornitza Stark Marked gene: ARSI as ready
Mendeliome v1.2584 ARSI Zornitza Stark Gene: arsi has been classified as Red List (Low Evidence).
Mendeliome v1.2584 ARSI Zornitza Stark Classified gene: ARSI as Red List (low evidence)
Mendeliome v1.2584 ARSI Zornitza Stark Gene: arsi has been classified as Red List (Low Evidence).
Mendeliome v1.2583 ADGRB3 Zornitza Stark Marked gene: ADGRB3 as ready
Mendeliome v1.2583 ADGRB3 Zornitza Stark Gene: adgrb3 has been classified as Red List (Low Evidence).
Mendeliome v1.2583 ADGRB3 Zornitza Stark Classified gene: ADGRB3 as Red List (low evidence)
Mendeliome v1.2583 ADGRB3 Zornitza Stark Gene: adgrb3 has been classified as Red List (Low Evidence).
Cerebral vascular malformations v1.9 BRCC3 Zornitza Stark Phenotypes for gene: BRCC3 were changed from Moyamoya disease to MoyaMoya Disease, syndromic, MONDO:0016820
Cerebral vascular malformations v1.8 BRCC3 Zornitza Stark Mode of inheritance for gene: BRCC3 was changed from X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Cerebral vascular malformations v1.7 BRCC3 Zornitza Stark Classified gene: BRCC3 as Amber List (moderate evidence)
Cerebral vascular malformations v1.7 BRCC3 Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v1.6 BRCC3 Zornitza Stark Tag SV/CNV tag was added to gene: BRCC3.
Cerebral vascular malformations v1.6 BRCC3 Zornitza Stark edited their review of gene: BRCC3: Changed rating: AMBER
Mendeliome v1.2582 BRCC3 Zornitza Stark Marked gene: BRCC3 as ready
Mendeliome v1.2582 BRCC3 Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2582 BRCC3 Zornitza Stark Classified gene: BRCC3 as Amber List (moderate evidence)
Mendeliome v1.2582 BRCC3 Zornitza Stark Gene: brcc3 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2581 BRCC3 Zornitza Stark Tag SV/CNV tag was added to gene: BRCC3.
Mendeliome v1.2581 SH3BP4 Zornitza Stark Marked gene: SH3BP4 as ready
Mendeliome v1.2581 SH3BP4 Zornitza Stark Gene: sh3bp4 has been classified as Red List (Low Evidence).
Mendeliome v1.2581 SH3BP4 Zornitza Stark Classified gene: SH3BP4 as Red List (low evidence)
Mendeliome v1.2581 SH3BP4 Zornitza Stark Gene: sh3bp4 has been classified as Red List (Low Evidence).
Mendeliome v1.2580 WDR48 Zornitza Stark Marked gene: WDR48 as ready
Mendeliome v1.2580 WDR48 Zornitza Stark Gene: wdr48 has been classified as Red List (Low Evidence).
Mendeliome v1.2580 WDR48 Zornitza Stark Classified gene: WDR48 as Red List (low evidence)
Mendeliome v1.2580 WDR48 Zornitza Stark Gene: wdr48 has been classified as Red List (Low Evidence).
Mendeliome v1.2579 SNRPA Zornitza Stark Marked gene: SNRPA as ready
Mendeliome v1.2579 SNRPA Zornitza Stark Gene: snrpa has been classified as Red List (Low Evidence).
Mendeliome v1.2579 SNRPA Zornitza Stark Classified gene: SNRPA as Red List (low evidence)
Mendeliome v1.2579 SNRPA Zornitza Stark Gene: snrpa has been classified as Red List (Low Evidence).
Mendeliome v1.2578 ZFR Zornitza Stark Marked gene: ZFR as ready
Mendeliome v1.2578 ZFR Zornitza Stark Gene: zfr has been classified as Red List (Low Evidence).
Mendeliome v1.2578 ZFR Zornitza Stark Classified gene: ZFR as Red List (low evidence)
Mendeliome v1.2578 ZFR Zornitza Stark Gene: zfr has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.140 ZNF674 Zornitza Stark Phenotypes for gene: ZNF674 were changed from to X-linked intellectual disability MONDO:0100284
Mendeliome v1.2577 ZNF674 Zornitza Stark Marked gene: ZNF674 as ready
Mendeliome v1.2577 ZNF674 Zornitza Stark Gene: znf674 has been classified as Red List (Low Evidence).
Mendeliome v1.2577 ZNF674 Zornitza Stark Classified gene: ZNF674 as Red List (low evidence)
Mendeliome v1.2577 ZNF674 Zornitza Stark Gene: znf674 has been classified as Red List (Low Evidence).
Mendeliome v1.2576 ZNF674 Zornitza Stark Tag disputed tag was added to gene: ZNF674.
Mendeliome v1.2576 FAAHP1 Zornitza Stark Marked gene: FAAHP1 as ready
Mendeliome v1.2576 FAAHP1 Zornitza Stark Gene: faahp1 has been classified as Red List (Low Evidence).
Mendeliome v1.2576 FAAHP1 Zornitza Stark Classified gene: FAAHP1 as Red List (low evidence)
Mendeliome v1.2576 FAAHP1 Zornitza Stark Gene: faahp1 has been classified as Red List (Low Evidence).
Mendeliome v1.2575 ERN1 Zornitza Stark Marked gene: ERN1 as ready
Mendeliome v1.2575 ERN1 Zornitza Stark Gene: ern1 has been classified as Red List (Low Evidence).
Mendeliome v1.2575 ERN1 Zornitza Stark Classified gene: ERN1 as Red List (low evidence)
Mendeliome v1.2575 ERN1 Zornitza Stark Gene: ern1 has been classified as Red List (Low Evidence).
Incidentalome v0.321 GLT8D1 Zornitza Stark Marked gene: GLT8D1 as ready
Incidentalome v0.321 GLT8D1 Zornitza Stark Gene: glt8d1 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.321 GLT8D1 Zornitza Stark Classified gene: GLT8D1 as Amber List (moderate evidence)
Incidentalome v0.321 GLT8D1 Zornitza Stark Gene: glt8d1 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.320 TAF15 Zornitza Stark Marked gene: TAF15 as ready
Incidentalome v0.320 TAF15 Zornitza Stark Gene: taf15 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.320 TAF15 Zornitza Stark Classified gene: TAF15 as Amber List (moderate evidence)
Incidentalome v0.320 TAF15 Zornitza Stark Gene: taf15 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.319 UBQLN4 Zornitza Stark Marked gene: UBQLN4 as ready
Incidentalome v0.319 UBQLN4 Zornitza Stark Gene: ubqln4 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.319 UBQLN4 Zornitza Stark Classified gene: UBQLN4 as Amber List (moderate evidence)
Incidentalome v0.319 UBQLN4 Zornitza Stark Gene: ubqln4 has been classified as Amber List (Moderate Evidence).
Incidentalome v0.318 TMEM230 Zornitza Stark Marked gene: TMEM230 as ready
Incidentalome v0.318 TMEM230 Zornitza Stark Gene: tmem230 has been classified as Red List (Low Evidence).
Incidentalome v0.318 TMEM230 Zornitza Stark Classified gene: TMEM230 as Red List (low evidence)
Incidentalome v0.318 TMEM230 Zornitza Stark Gene: tmem230 has been classified as Red List (Low Evidence).
Incidentalome v0.317 LGALSL Zornitza Stark Marked gene: LGALSL as ready
Incidentalome v0.317 LGALSL Zornitza Stark Gene: lgalsl has been classified as Amber List (Moderate Evidence).
Incidentalome v0.317 LGALSL Zornitza Stark Classified gene: LGALSL as Amber List (moderate evidence)
Incidentalome v0.317 LGALSL Zornitza Stark Gene: lgalsl has been classified as Amber List (Moderate Evidence).
Nucleotide metabolism disorders v0.8 AGXT2 Zornitza Stark Marked gene: AGXT2 as ready
Nucleotide metabolism disorders v0.8 AGXT2 Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence).
Mendeliome v1.2574 AGXT2 Zornitza Stark Marked gene: AGXT2 as ready
Mendeliome v1.2574 AGXT2 Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence).
Mendeliome v1.2574 AGXT2 Zornitza Stark Classified gene: AGXT2 as Red List (low evidence)
Mendeliome v1.2574 AGXT2 Zornitza Stark Gene: agxt2 has been classified as Red List (Low Evidence).
Nucleotide metabolism disorders v0.8 SLC29A1 Zornitza Stark Marked gene: SLC29A1 as ready
Nucleotide metabolism disorders v0.8 SLC29A1 Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence).
Nucleotide metabolism disorders v0.8 SLC29A1 Zornitza Stark Phenotypes for gene: SLC29A1 were changed from to Disorders of ectonucleotide and nucleic acid metabolism; Equilibrative nucleoside transporter 1 deficiency MONDO:0019052
Nucleotide metabolism disorders v0.7 SLC29A1 Zornitza Stark Publications for gene: SLC29A1 were set to
Nucleotide metabolism disorders v0.6 SLC29A1 Zornitza Stark Mode of inheritance for gene: SLC29A1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2573 SLC29A1 Zornitza Stark Marked gene: SLC29A1 as ready
Mendeliome v1.2573 SLC29A1 Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence).
Mendeliome v1.2573 SLC29A1 Zornitza Stark Classified gene: SLC29A1 as Red List (low evidence)
Mendeliome v1.2573 SLC29A1 Zornitza Stark Gene: slc29a1 has been classified as Red List (Low Evidence).
Fetal anomalies v1.333 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.139 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.138 PLK1 Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Genetic Epilepsy v1.149 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Genetic Epilepsy v1.148 PLK1 Zornitza Stark edited their review of gene: PLK1: Changed phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Microcephaly v1.311 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Mendeliome v1.2572 PLK1 Zornitza Stark Phenotypes for gene: PLK1 were changed from Epilepsy; microcephaly; intellectual disability to Neurodevelopmental disorder, PLK1-related, MONDO:0700092
Stickler Syndrome v1.10 PLOD3 Zornitza Stark Phenotypes for gene: PLOD3 were changed from Stickler-like phenotype with high myopia, midface hypoplasia, microretrognathia to Lysyl hydroxylase 3 deficiency, MIM#612394; Stickler-like phenotype with high myopia, midface hypoplasia, microretrognathia
Cataract v0.374 PLOD3 Zornitza Stark Phenotypes for gene: PLOD3 were changed from cataract to Lysyl hydroxylase 3 deficiency, MIM#612394
Mendeliome v1.2571 PLOD3 Zornitza Stark Phenotypes for gene: PLOD3 were changed from to Lysyl hydroxylase 3 deficiency, MIM#612394; Bone fragility with contractures, arterial rupture, and deafness (BCARD syndrome) MONDO:0012892
Mendeliome v1.2570 PLOD3 Zornitza Stark Publications for gene: PLOD3 were set to
Intellectual disability syndromic and non-syndromic v1.138 PLXNA2 Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038
Mendeliome v1.2569 PLXNA2 Zornitza Stark Phenotypes for gene: PLXNA2 were changed from Intellectual disability; Abnormality of the face; Failure to thrive; Abnormal heart morphology to Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038
Photosensitivity Syndromes v1.9 RECQL Zornitza Stark Phenotypes for gene: RECQL were changed from Photosensitivity; facial dysmorphism; xeropthalmia; skeletal abnormalities to RECON progeroid syndrome MONDO:0957266
Mendeliome v1.2568 RECQL Zornitza Stark Phenotypes for gene: RECQL were changed from Photosensitivity; facial dysmorphism; xeropthalmia; skeletal abnormalities to RECON progeroid syndrome MONDO:0957266
Intellectual disability syndromic and non-syndromic v1.137 RFX3 Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092
Mendeliome v1.2567 RFX3 Zornitza Stark Phenotypes for gene: RFX3 were changed from ID, ASD, ADHD to RFX3-related neurodevelopmental disorder MONDO:0700092
Intellectual disability syndromic and non-syndromic v1.136 RFX4 Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092
Mendeliome v1.2566 RFX4 Zornitza Stark Phenotypes for gene: RFX4 were changed from ID, ASD, ADHD to RFX4-related neurodevelopmental disorder, MONDO:0700092
Mendeliome v1.2565 ROBO4 Zornitza Stark Publications for gene: ROBO4 were set to 30455415; 32748548
Mendeliome v1.2564 ROBO4 Rylee Peters reviewed gene: ROBO4: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 36855159; Phenotypes: Aortic valve disease 8 MIM#618496; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 500+ v1.569 GPR143 Seb Lunke Classified gene: GPR143 as Red List (low evidence)
Prepair 500+ v1.569 GPR143 Seb Lunke Added comment: Comment on list classification: Marked red in line with LD comment
Prepair 500+ v1.569 GPR143 Seb Lunke Gene: gpr143 has been classified as Red List (Low Evidence).
Prepair 1000+ v2.8 GPR143 Seb Lunke Classified gene: GPR143 as Red List (low evidence)
Prepair 1000+ v2.8 GPR143 Seb Lunke Added comment: Comment on list classification: Marked red in line with LD comment
Prepair 1000+ v2.8 GPR143 Seb Lunke Gene: gpr143 has been classified as Red List (Low Evidence).
Fetal anomalies v1.332 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192
Fetal anomalies v1.331 AMOTL1 Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Clefting disorders v0.265 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192
Clefting disorders v0.264 AMOTL1 Zornitza Stark edited their review of gene: AMOTL1: Changed rating: GREEN; Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192
Intellectual disability syndromic and non-syndromic v1.135 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192
Intellectual disability syndromic and non-syndromic v1.134 AMOTL1 Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2564 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related to Craniofaciocardiohepatic syndrome, MIM# 621192
Mendeliome v1.2563 AMOTL1 Zornitza Stark edited their review of gene: AMOTL1: Changed phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192
Congenital Heart Defect v0.443 AMOTL1 Zornitza Stark Phenotypes for gene: AMOTL1 were changed from Orofacial clefting syndrome, MONDO:0015335, AMOTL1-related to Craniofaciocardiohepatic syndrome, MIM# 621192
Congenital Heart Defect v0.442 AMOTL1 Zornitza Stark reviewed gene: AMOTL1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Craniofaciocardiohepatic syndrome, MIM# 621192; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2563 LSM7 Zornitza Stark Phenotypes for gene: LSM7 were changed from leukodystrophy MONDO:0019046, LRM7-related to Leukodystrophy and cerebellar atrophy, MIM# 621191
Mendeliome v1.2562 LSM7 Zornitza Stark reviewed gene: LSM7: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Leukodystrophy and cerebellar atrophy, MIM# 621191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Leukodystrophy v0.321 LSM7 Zornitza Stark Phenotypes for gene: LSM7 were changed from leukodystrophy MONDO:0019046, LRM7-related to Leukodystrophy and cerebellar atrophy, MIM# 621191
Leukodystrophy v0.320 LSM7 Zornitza Stark edited their review of gene: LSM7: Changed phenotypes: Leukodystrophy and cerebellar atrophy, MIM# 621191
Mendeliome v1.2562 RFX4 Sangavi Sivagnanasundram reviewed gene: RFX4: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RFX4-related neurodevelopmental disorder, MONDO:0700092; Mode of inheritance: None
Mendeliome v1.2562 RFX3 Sangavi Sivagnanasundram reviewed gene: RFX3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RFX3-related neurodevelopmental disorder MONDO:0700092; Mode of inheritance: None
Mendeliome v1.2562 RECQL Sangavi Sivagnanasundram reviewed gene: RECQL: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: RECON progeroid syndrome MONDO:0957266; Mode of inheritance: None
Mendeliome v1.2562 PYCR1 Sangavi Sivagnanasundram reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: autosomal recessive cutis laxa type 2B MONDO:0013051; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2562 PLXNA2 Sangavi Sivagnanasundram reviewed gene: PLXNA2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038; Mode of inheritance: None
Mendeliome v1.2562 PLOD3 Sangavi Sivagnanasundram reviewed gene: PLOD3: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Bone fragility with contractures, arterial rupture, and deafness (BCARD syndrome) MONDO:0012892; Mode of inheritance: None
Mendeliome v1.2562 PLK1 Sangavi Sivagnanasundram reviewed gene: PLK1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, PLK1-related, MONDO:0700092; Mode of inheritance: None
Mendeliome v1.2562 SLC29A1 Sangavi Sivagnanasundram edited their review of gene: SLC29A1: Changed rating: RED
Nucleotide metabolism disorders v0.5 SLC29A1 Sangavi Sivagnanasundram changed review comment from: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. Not enough evidence to support the gene-disease association. - https://iembase.com/disorder/783

PMID: 35955904
Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population)

PMID: 25896650
3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene)
No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis.; to: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. More evidence is required to support the gene-disease association. - https://iembase.com/disorder/783

PMID: 35955904
Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population)

PMID: 25896650
3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene)
No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis.
Mendeliome v1.2562 SLC29A1 Sangavi Sivagnanasundram gene: SLC29A1 was added
gene: SLC29A1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: SLC29A1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SLC29A1 were set to 35955904; 25896650
Phenotypes for gene: SLC29A1 were set to Disorders of ectonucleotide and nucleic acid metabolism; Equilibrative nucleoside transporter 1 deficiency MONDO:0019052
Review for gene: SLC29A1 was set to AMBER
Added comment: This gene-disease association is an inborn error of metabolism known as disorders of ectonucleotide and nucleic acid metabolism. More evidence is required to support the gene-disease association. - https://iembase.com/disorder/783

PMID: 35955904
Homozygous Glu391Lys responsible for the A-negative blood time in people of African ancestry however is not shown to alter the protein function. Affected individuals will likely not have any phenotypes except the A- blood type. Missense variant is present in gnomAD v4.1 (GrpMax FAF - 1.159% in African/African American Population)

PMID: 25896650
3 sibs of European ancestry identified with homozygous c.589+1G>C (rare on gnomAD v4.1 for AR gene)
No severe phenotype was observed however periarticular and ectopic mineralization was observed which important regarding bone homeostasis.
Sources: Literature
Nucleotide metabolism disorders v0.5 SLC29A1 Sangavi Sivagnanasundram reviewed gene: SLC29A1: Rating: RED; Mode of pathogenicity: None; Publications: 35955904, 25896650; Phenotypes: Disorders of ectonucleotide and nucleic acid metabolism, Equilibrative nucleoside transporter 1 deficiency MONDO:0019052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2562 AGXT2 Sangavi Sivagnanasundram gene: AGXT2 was added
gene: AGXT2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: AGXT2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: AGXT2 were set to 21572414
Phenotypes for gene: AGXT2 were set to beta-aminoisobutyric acid, urinary excretion of MONDO:0008860
Review for gene: AGXT2 was set to RED
Added comment: This gene-disease association needs further evidence to support pathogenicity.

PMID: 21572414
GWAS study identified common SNP (V140I - https://gnomad.broadinstitute.org/variant/5-35037010-C-T?dataset=gnomad_r4) showing the strongest association with BAIB in the present study.
Sources: Literature
Nucleotide metabolism disorders v0.5 AGXT2 Sangavi Sivagnanasundram reviewed gene: AGXT2: Rating: RED; Mode of pathogenicity: None; Publications: 21572414; Phenotypes: beta-aminoisobutyric acid, urinary excretion of MONDO:0008860; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Incidentalome v0.316 LGALSL Sangavi Sivagnanasundram gene: LGALSL was added
gene: LGALSL was added to Incidentalome. Sources: ClinGen
Mode of inheritance for gene: LGALSL was set to Unknown
Publications for gene: LGALSL were set to 30940688
Phenotypes for gene: LGALSL were set to Amyotrophic lateral sclerosis MONDO:0004976
Review for gene: LGALSL was set to AMBER
Added comment: Classified as LIMITED by ClinGen ALS spectrum disorder GCEP on 14/02/2023 -https://search.clinicalgenome.org/CCID:005279.

Significant enrichment in a cohort of 3,239 ALS cases compared to 11,808 controls - OR = 14.63; P = 2.29e-6.
Sources: ClinGen
Incidentalome v0.316 TMEM230 Sangavi Sivagnanasundram edited their review of gene: TMEM230: Changed rating: RED
Incidentalome v0.316 TMEM230 Sangavi Sivagnanasundram gene: TMEM230 was added
gene: TMEM230 was added to Incidentalome. Sources: Expert Review
Mode of inheritance for gene: TMEM230 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TMEM230 were set to 30804554; 27270108; 28115417; 28017548; 30804555; 30804556; 31323517
Phenotypes for gene: TMEM230 were set to Parkinson disease 21, MONDO:0005180
Review for gene: TMEM230 was set to AMBER
Added comment: No new evidence/proband supportive of gene-disease association.

Review copied from Parkinson Panel:
"A single family segregating a heterozygous missense (p.Arg141Leu) and supporting functional evidence. However, another group found a DNAJC13 variant in the same family also with supporting functional evidence. A stoploss was also identified in 9 Chinese Parkinson disease probands, however it was identified homozygous in 7 of these with no difference in the severity of phenotype. A similar stop loss was identified in a North American PD case. Another missense was identified in an apparently sporadic PD case (p.Tyr92Cys), but was also present in the unaffected mother (age 57 yrs). Another rare missense has been reported in a case with familial PD. The missense reported in a family from Southern Italy is too common in gnomAD v2.1 for a dominant disease (PMID: 31323517 - p.Ile125Met)."
Sources: Expert Review
Incidentalome v0.316 UBQLN4 Sangavi Sivagnanasundram gene: UBQLN4 was added
gene: UBQLN4 was added to Incidentalome. Sources: Expert Review
Mode of inheritance for gene: UBQLN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: UBQLN4 were set to 28463112; 30804504
Phenotypes for gene: UBQLN4 were set to amyotrophic lateral sclerosis MONDO:0004976
Review for gene: UBQLN4 was set to AMBER
Added comment: No new evidence/proband supporting gene-disease association.
Review copied from MND panel:
"A single familial case and supporting functional studies and animal model."
Sources: Expert Review
Incidentalome v0.316 TAF15 Sangavi Sivagnanasundram gene: TAF15 was added
gene: TAF15 was added to Incidentalome. Sources: ClinGen
Mode of inheritance for gene: TAF15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: TAF15 were set to 28889094; 21438137; 22065782; 27810362; 28889094
Phenotypes for gene: TAF15 were set to amyotrophic lateral sclerosis MONDO:0004976; frontotemporal dementia MONDO:0017276
Review for gene: TAF15 was set to AMBER
Added comment: Classified as LIMITED by ClinGen ALS GCEP on 11/03/2021 - https://search.clinicalgenome.org/CCID:006311
Reported in individuals with sporadic and familial ALS and in individuals with behavourial FTD. The variants reported in the publications were reported in gnomAD non-neuro cohort including elderly individuals, therefore leading to ClinGen's limited classification.
Sources: ClinGen
Incidentalome v0.316 GLT8D1 Sangavi Sivagnanasundram gene: GLT8D1 was added
gene: GLT8D1 was added to Incidentalome. Sources: ClinGen
Mode of inheritance for gene: GLT8D1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GLT8D1 were set to 30811981; 35525134; 34746377; 33714647; 31653410; 35873773; 33581933
Phenotypes for gene: GLT8D1 were set to amyotrophic lateral sclerosis MONDO:0004976
Review for gene: GLT8D1 was set to AMBER
Added comment: Classified as LIMITED by ClinGen ALS GCEP on 14/01/2025 - https://search.clinicalgenome.org/CCID:004967

Variants have been reported in 22 probands however the variants identified had a high population frequency which led to ClinGen's limited classification
Sources: ClinGen
Mendeliome v1.2562 ERN1 Sangavi Sivagnanasundram gene: ERN1 was added
gene: ERN1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ERN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ERN1 were set to Immune Dysregulation, MONDO:0005046
Review for gene: ERN1 was set to RED
Added comment: No new evidence to support gene-disease association. Review copied from Disorders of immune dysregulation Panel:
"On the IUIS 2024 update for IEIs as a gene associated with an AD disease of immune dysregulation, I cannot find any evidence of Mendelian disease."
Sources: Expert Review
Mendeliome v1.2562 FAAHP1 Sangavi Sivagnanasundram gene: FAAHP1 was added
gene: FAAHP1 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: FAAHP1 was set to Unknown
Publications for gene: FAAHP1 were set to 30929760
Phenotypes for gene: FAAHP1 were set to Pain insensitivity
Review for gene: FAAHP1 was set to RED
Added comment: Review from Pain Syndromes Panel:
"This is a pseudogene. A single case with pain insensitivity has been reported with co-inheritance of a microdeletion in dorsal root ganglia and brain-expressed pseudogene and a common functional SNP in FAAH (rs324420 ) conferring reduced expression and activity."
Sources: Expert Review
Mendeliome v1.2562 ZNF674 Sangavi Sivagnanasundram gene: ZNF674 was added
gene: ZNF674 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: ZNF674 were set to https://search.clinicalgenome.org/CCID:006588
Phenotypes for gene: ZNF674 were set to X-linked intellectual disability MONDO:0100284
Review for gene: ZNF674 was set to RED
Added comment: Classified DISPUTED by ClinGen ID and Autism GCEP on 04/05/2021 - https://search.clinicalgenome.org/CCID:006588
Sources: Expert Review
Mendeliome v1.2562 ZFR Sangavi Sivagnanasundram gene: ZFR was added
gene: ZFR was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ZFR was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ZFR were set to 24482476
Phenotypes for gene: ZFR were set to hereditary spastic paraplegia, MONDO:0019064
Review for gene: ZFR was set to RED
Added comment: No new proband/evidence supporting gene-disease association.

Review copied from HSP paediatric panel:
"A single family reported with a homozygous variant."
Sources: Expert Review
Mendeliome v1.2562 SNRPA Sangavi Sivagnanasundram gene: SNRPA was added
gene: SNRPA was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: SNRPA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNRPA were set to 29437235
Phenotypes for gene: SNRPA were set to complex neurodevelopmental disorder, SNRPA-related MONDO:0100038
Review for gene: SNRPA was set to RED
Added comment: No new reported probands supporting the gene-disease association.

Review copied from ID panel:
"1 report of concurrence of intellectual disability, short stature, poor speech, and minor craniofacial and hand anomalies in 2 female siblings with 3 homozygous missense variants in SNRPA. Combined, c.97A>G, c.98T>C, and c.100T>A, in exon 2 of SNRPA lead to p.Ile33Ala and p.Phe34Ile exchanges, which were predicted in silico to be deleterious. No functional studies."
Sources: Expert Review
Mendeliome v1.2562 WDR48 Sangavi Sivagnanasundram gene: WDR48 was added
gene: WDR48 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: WDR48 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: WDR48 were set to 24482476
Phenotypes for gene: WDR48 were set to Hereditary spastic paraplegia MONDO:0015150
Review for gene: WDR48 was set to RED
Added comment: Gene Reviews - https://www.ncbi.nlm.nih.gov/books/NBK1509/
SPG60 - paediatric onset of complex HSP.
Polyneuropathy and DD are the typical onset of symptoms

No new reported probands - review copied from HSP paediatric panel:
"A single family reported with a homozygous in-frame deletion."
Sources: Expert Review
Mendeliome v1.2562 SH3BP4 Sangavi Sivagnanasundram gene: SH3BP4 was added
gene: SH3BP4 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: SH3BP4 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: SH3BP4 were set to 24627108
Phenotypes for gene: SH3BP4 were set to Peripheral neuropathy, MONDO:0005244
Review for gene: SH3BP4 was set to RED
Added comment: No new information supportive of gene-disease association.

Review copied from Hereditary Neuropathy_CMT - isolated Panel:
"A single family reported with inherited peripheral neuropathy, with no functional analyses."
Sources: Expert Review
Mendeliome v1.2562 BRCC3 Sangavi Sivagnanasundram gene: BRCC3 was added
gene: BRCC3 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: BRCC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: BRCC3 were set to 21596366; 33868155; 35815106; 39552268
Phenotypes for gene: BRCC3 were set to MoyaMoya Disease, syndromic, MONDO:0016820
Review for gene: BRCC3 was set to AMBER
Added comment: The same common ~26kb Xq28 deletion was identified in all affected individuals below. No other evidence of any SNVs.

Additional probands with MoyaMoya:
PMID: 35815106 & 39552268
Two unrelated individuals with MoyaMoya and other neurodevelopmental features.
A hemizygous ~26kb Xq28 deletion was identified in both individuals

------------------------------
Review from CVM panel:
“PMID 21596366: three unrelated families with multiple affected males segregating a deletion involving MTCP1 and BRCC3. Positional approach used. Supportive zebrafish model, knockdown of BRCC3; angiogenesis affected.

PMID 33868155, additional report of affected male, with similar deletion.

No reports of SNVs identified, including in ClinVar.”
Sources: Expert Review
Mendeliome v1.2562 ADGRB3 Sangavi Sivagnanasundram gene: ADGRB3 was added
gene: ADGRB3 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ADGRB3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ADGRB3 were set to 30659260; 18628273
Phenotypes for gene: ADGRB3 were set to Intellectual disability MONDO:0001071
Review for gene: ADGRB3 was set to RED
Added comment: No new information supportive of gene-disease association. Review copied from ID panel:

"Single family with intragenic bi-allelic duplications and ID reported; association studies with schizophrenia."
Sources: Expert Review
Mendeliome v1.2562 ARSI Sangavi Sivagnanasundram gene: ARSI was added
gene: ARSI was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: ARSI was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ARSI were set to 24482476
Phenotypes for gene: ARSI were set to Complex spastic paraplegia, MONDO:0015150
Review for gene: ARSI was set to RED
Added comment: No new information supporting gene-disease association.

Review from HSP paediatric panel - "Single family reported"
Sources: Expert Review
Mendeliome v1.2562 GINS4 Sangavi Sivagnanasundram gene: GINS4 was added
gene: GINS4 was added to Mendeliome. Sources: Expert Review
Mode of inheritance for gene: GINS4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GINS4 were set to 36345943
Phenotypes for gene: GINS4 were set to combined immunodeficiency MONDO:0015131
Review for gene: GINS4 was set to RED
Added comment: No further information has been published to support the gene-disease association.

Review copied from Combined Immunodeficiency panel:
"2 affected siblings with compound het variants are reported in a single family."
Sources: Expert Review
Mendeliome v1.2562 DBF4 Sangavi Sivagnanasundram changed review comment from: Review taken from Phagocyte Defects panel:

"A single case with a homozygous variant & some supporting in vitro functional assay."
Sources: Literature; to: No new information supporting gene-disease association. Review taken from Phagocyte Defects panel:

"A single case with a homozygous variant & some supporting in vitro functional assay."
Sources: Literature
Mendeliome v1.2562 DBF4 Sangavi Sivagnanasundram gene: DBF4 was added
gene: DBF4 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: DBF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DBF4 were set to 36841265
Phenotypes for gene: DBF4 were set to severe congenital neutropenia MONDO:0018542
Review for gene: DBF4 was set to RED
Added comment: Review taken from Phagocyte Defects panel:

"A single case with a homozygous variant & some supporting in vitro functional assay."
Sources: Literature
Mendeliome v1.2562 CERS1 Sangavi Sivagnanasundram gene: CERS1 was added
gene: CERS1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: CERS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CERS1 were set to 24782409; 21625621; 30800706
Phenotypes for gene: CERS1 were set to Epilepsy, progressive myoclonic, 8, MONDO:0020074
Review for gene: CERS1 was set to GREEN
Added comment: Addition of this gene to the Mendeliome - review taken from Genetic Epilepsy Panel

"Two unrelated families with PME identified, and functional assays in vitro and in patient cells demonstrating impaired ceramide biosynthesis. Mouse model shows neurodegeneration and lipofuscin accumulation"

Classified as MODERATE by ClinGen Epilepsy GCEP on 16/07/2024 - https://search.clinicalgenome.org/CCID:008331
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.134 NAV3 Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Intellectual disability syndromic and non-syndromic v1.133 NAV3 Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Mendeliome v1.2562 NAV3 Zornitza Stark Phenotypes for gene: NAV3 were changed from Neurodevelopmental disorder, MONDO:0700092, NAV3-related to Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Mendeliome v1.2561 NAV3 Zornitza Stark edited their review of gene: NAV3: Changed phenotypes: Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182
Fetal anomalies v1.331 GPKOW Zornitza Stark Publications for gene: GPKOW were set to 28612833
Fetal anomalies v1.330 GPKOW Zornitza Stark Phenotypes for gene: GPKOW were changed from male-lethal microcephaly with intrauterine growth restriction to syndromic disease, MONDO:0002254, GPKOW-related
Microcephaly v1.310 GPKOW Zornitza Stark Marked gene: GPKOW as ready
Microcephaly v1.310 GPKOW Zornitza Stark Gene: gpkow has been classified as Green List (High Evidence).
Microcephaly v1.310 GPKOW Zornitza Stark Phenotypes for gene: GPKOW were changed from microcephaly MONDO:0001149; fetal growth restriction MONDO:0005030 to syndromic disease, MONDO:0002254, GPKOW-related
Mendeliome v1.2561 GPKOW Zornitza Stark Phenotypes for gene: GPKOW were changed from male-lethal microcephaly with intrauterine growth restriction to syndromic disease, MONDO:0002254, GPKOW-related
Mendeliome v1.2560 GPKOW Zornitza Stark Publications for gene: GPKOW were set to 28612833
Mendeliome v1.2559 FBXO22 Zornitza Stark Marked gene: FBXO22 as ready
Mendeliome v1.2559 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Mendeliome v1.2559 FBXO22 Zornitza Stark Classified gene: FBXO22 as Green List (high evidence)
Mendeliome v1.2559 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Marked gene: FBXO22 as ready
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Classified gene: FBXO22 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.133 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Growth failure v1.77 FBXO22 Zornitza Stark Marked gene: FBXO22 as ready
Growth failure v1.77 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Growth failure v1.77 FBXO22 Zornitza Stark Classified gene: FBXO22 as Green List (high evidence)
Growth failure v1.77 FBXO22 Zornitza Stark Gene: fbxo22 has been classified as Green List (High Evidence).
Immunological disorders_SuperPanel v15.2 Bryony Thompson Changed child panels to: Autoinflammatory Disorders; Combined Immunodeficiency; Bone Marrow Failure; Phagocyte Defects; Defects of intrinsic and innate immunity; Disorders of immune dysregulation; Severe Combined Immunodeficiency (absent T present B cells); Severe Combined Immunodeficiency (absent T absent B cells); Hereditary angioedema; Predominantly Antibody Deficiency; Autoimmune Lymphoproliferative Syndrome; Susceptibility to Viral Infections; Complement Deficiencies; Inflammatory bowel disease
Susceptibility to Viral Infections v1.0 Bryony Thompson promoted panel to version 1.0
Susceptibility to Viral Infections v0.133 STAT2 Bryony Thompson Phenotypes for gene: STAT2 were changed from to Susceptibility to viral disease
Susceptibility to Viral Infections v0.132 STAT2 Bryony Thompson Mode of inheritance for gene: STAT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Immunological disorders_SuperPanel v14.1 Bryony Thompson Changed child panels to: Autoinflammatory Disorders; Combined Immunodeficiency; Bone Marrow Failure; Phagocyte Defects; Defects of intrinsic and innate immunity; Disorders of immune dysregulation; Severe Combined Immunodeficiency (absent T present B cells); Severe Combined Immunodeficiency (absent T absent B cells); Susceptibility to Fungal Infections; Hereditary angioedema; Predominantly Antibody Deficiency; Autoimmune Lymphoproliferative Syndrome; Complement Deficiencies; Susceptibility to Viral Infections; Inflammatory bowel disease
Growth failure v1.76 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Growth failure. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Mendeliome v1.2558 FBXO22 Sarah Milton gene: FBXO22 was added
gene: FBXO22 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: FBXO22 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FBXO22 were set to PMID: 40215970
Phenotypes for gene: FBXO22 were set to Neurodevelopmental disorder, MONDO:0700092, FBXO22-related
Review for gene: FBXO22 was set to GREEN
Added comment: Encodes substrate recognition component of SCF E3 ubiquitin ligase complex. Has role in post translational ubiquitination and degradation of certain substrates e.g. histone demethylases.

14 cases from 12 families published with affected individuals noted to have homozygous frameshift variants (FBXO22:c.159_162del,c.8_36del,c.719_722del - all rare/absent gnomad v4).

Phenotype included prenatal growth restriction/short stature, neurodevelopmental delay, microcephaly, hypotonia, seizures, craniofacial dysmorphisms (high forehead, depressed nasal bridge, hypertelorism), variable additional findings including cardiovascular and gastrointestinal anomalies.

Supportive functional studies - FBXO22 is involved of degradation of KDM4B, KDM4B protein levels in one affected individual were found to be higher than control. Unique genome wide episignature identified for FBXO22 in 3 individuals with the disorder (given loss of this protein results in increased levels of various histone demethylases).
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.132 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Genetic Epilepsy v1.148 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Mendeliome v1.2558 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors); to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(both absent from gnomad v4, should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors)
Mendeliome v1.2558 RNU2-2P Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v1.148 RNU2-2P Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v1.309 GPKOW Chirag Patel Classified gene: GPKOW as Green List (high evidence)
Microcephaly v1.309 GPKOW Chirag Patel Gene: gpkow has been classified as Green List (High Evidence).
Mendeliome v1.2558 GPKOW Chirag Patel Classified gene: GPKOW as Green List (high evidence)
Mendeliome v1.2558 GPKOW Chirag Patel Gene: gpkow has been classified as Green List (High Evidence).
Fetal anomalies v1.329 GPKOW Chirag Patel Classified gene: GPKOW as Green List (high evidence)
Fetal anomalies v1.329 GPKOW Chirag Patel Gene: gpkow has been classified as Green List (High Evidence).
Microcephaly v1.308 GPKOW Chirag Patel gene: GPKOW was added
gene: GPKOW was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: GPKOW was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for gene: GPKOW were set to PMID: 40221893, 28612833
Phenotypes for gene: GPKOW were set to microcephaly MONDO:0001149; fetal growth restriction MONDO:0005030
Review for gene: GPKOW was set to GREEN
Added comment: GPKOW, a gene on the X-chromosome, encodes a nuclear RNA-binding protein important in mRNA processing as a spliceosome subunit. It has been shown in numerous model organisms and in human cells to be essential for survival.

PMID: 40221893
2 unrelated families with 3 affected males (deceased) presenting with IUGR, microcephaly, congenital ichthyosis, eye anomalies (microphthalmia, coloboma, ON hypoplasia), brain anomalies (absent septum pellucidum, ventriculomegaly), and skeletal anomalies (platyspondyly, brachydactyly). Trio WES/WGS testing identified 2 hemizygous frameshift variants affecting the last exon of GPKOW [p.(Arg441SerfsTer30) and p.(Ser444GlufsTer28)]. Some heterozygote females presented with short stature, microcephaly, and vision problems. Sequencing of fibroblasts' mRNA showed that GPKOW mRNA escapes nonsense-mediated decay but protein expression is reduced, suggesting protein instability. Studies in Drosophila showed that Gpkow is broadly expressed and is enriched in neurons and glia in eyes and head of developing and adult flies. Knockdown and overexpression of Gpkow in the fly eye cause eyeless/headless phenotype suggesting that the gene is dosage sensitive. Overexpression of the p.(Ser444GlufsTer28) variant caused milder defects than the reference allele, indicating that the truncated protein behaves as a partial loss-of-function allele.

PMID: 28612833
1 family with 5 affected males (stillbirth/TOP) with severe microcephaly and intrauterine growth restriction. X-exome sequencing in an obligate carrier identified a potential splice variant in the GPKOW gene (c.331+5G>A). The variant segregated in 9 additional family members, including one affected male fetus. GPKOW transcripts, in lymphoblastoid cell lines of 3 carrier females, showed that the variant disrupts normal splicing of its pre-mRNAs. A clonal culture expressing only the c.331+5G>A allele isolated from one carrier female LCL, showed an 80% reduction in wild type GPKOW mRNA, 70% reduction in the full length GPKOW protein and the presence of a truncated GPKOW protein with possible dominant negative effect.
Sources: Literature
Fetal anomalies v1.328 GPKOW Chirag Patel reviewed gene: GPKOW: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40221893, 28612833; Phenotypes: microcephaly MONDO:0001149, fetal growth restriction MONDO:0005030; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Mendeliome v1.2557 GPKOW Chirag Patel reviewed gene: GPKOW: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40221893, 28612833; Phenotypes: microcephaly MONDO:0001149, fetal growth restriction MONDO:0005030; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Complement Deficiencies v1.0 Bryony Thompson promoted panel to version 1.0
Complement Deficiencies v0.87 Bryony Thompson Panel types changed to Melbourne Genomics; Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Complement Deficiencies v0.86 THBD Bryony Thompson Deleted their review
Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 THBD Bryony Thompson Classified gene: THBD as Red List (low evidence)
Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 THBD Bryony Thompson Added comment: Comment on list classification: Refuted gene-disease classification by ClinGen Complement-Mediated Kidney Diseases GCEP - https://search.clinicalgenome.org/CCID:008288
Atypical Haemolytic Uraemic Syndrome_MPGN v0.54 THBD Bryony Thompson Gene: thbd has been classified as Red List (Low Evidence).
Atypical Haemolytic Uraemic Syndrome_MPGN v0.53 THBD Bryony Thompson Deleted their review
Complement Deficiencies v0.86 CFHR5 Bryony Thompson Mode of inheritance for gene: CFHR5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Complement Deficiencies v0.85 CFHR5 Bryony Thompson Classified gene: CFHR5 as Green List (high evidence)
Complement Deficiencies v0.85 CFHR5 Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology
Complement Deficiencies v0.85 CFHR5 Bryony Thompson Gene: cfhr5 has been classified as Green List (High Evidence).
Complement Deficiencies v0.84 CFHR3 Bryony Thompson Publications for gene: CFHR3 were set to
Complement Deficiencies v0.83 CFHR3 Bryony Thompson Classified gene: CFHR3 as Green List (high evidence)
Complement Deficiencies v0.83 CFHR3 Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology
Complement Deficiencies v0.83 CFHR3 Bryony Thompson Gene: cfhr3 has been classified as Green List (High Evidence).
Complement Deficiencies v0.82 CFHR2 Bryony Thompson Classified gene: CFHR2 as Green List (high evidence)
Complement Deficiencies v0.82 CFHR2 Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology
Complement Deficiencies v0.82 CFHR2 Bryony Thompson Gene: cfhr2 has been classified as Green List (High Evidence).
Complement Deficiencies v0.81 CFHR1 Bryony Thompson Publications for gene: CFHR1 were set to
Complement Deficiencies v0.80 CFHR1 Bryony Thompson Mode of inheritance for gene: CFHR1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Complement Deficiencies v0.79 CFHR1 Bryony Thompson Classified gene: CFHR1 as Green List (high evidence)
Complement Deficiencies v0.79 CFHR1 Bryony Thompson Added comment: Comment on list classification: IUIS include this gene on their July 2024 list of inborn errors of immunology
Complement Deficiencies v0.79 CFHR1 Bryony Thompson Gene: cfhr1 has been classified as Green List (High Evidence).
Complement Deficiencies v0.78 CFB Bryony Thompson Phenotypes for gene: CFB were changed from Complement factor B deficiency, MIM# 615561 to complement factor b deficiency MONDO:0014255; Atypical hemolytic-uremic syndrome with B factor anomaly MONDO:0013042
Complement Deficiencies v0.77 CFB Bryony Thompson edited their review of gene: CFB: Changed phenotypes: complement factor b deficiency MONDO:0014255, Atypical hemolytic-uremic syndrome with B factor anomaly MONDO:0013042
Mendeliome v1.2557 CFB Bryony Thompson reviewed gene: CFB: Rating: AMBER; Mode of pathogenicity: None; Publications: 33165708, 24152280; Phenotypes: complement factor b deficiency MONDO:0014255; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Complement Deficiencies v0.77 CFB Bryony Thompson Publications for gene: CFB were set to 24152280
Complement Deficiencies v0.76 CFB Bryony Thompson Mode of inheritance for gene: CFB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Complement Deficiencies v0.75 CFB Bryony Thompson Classified gene: CFB as Green List (high evidence)
Complement Deficiencies v0.75 CFB Bryony Thompson Gene: cfb has been classified as Green List (High Evidence).
Complement Deficiencies v0.74 CFB Bryony Thompson reviewed gene: CFB: Rating: GREEN; Mode of pathogenicity: None; Publications: 33165708, 24152280, 17182750; Phenotypes: complement factor b deficiency MONDO:0014255; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v1.2557 SIRT1 Zornitza Stark Phenotypes for gene: SIRT1 were changed from autoimmune disease, MONDO:0007179 to autoimmune disease, MONDO:0007179; monogenic diabetes MONDO:0015967
Mendeliome v1.2556 SIRT1 Zornitza Stark Deleted their review
Mendeliome v1.2556 SIRT1 Zornitza Stark reviewed gene: SIRT1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: monogenic diabetes MONDO:0015967; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Monogenic Diabetes v0.138 SIRT1 Zornitza Stark Marked gene: SIRT1 as ready
Monogenic Diabetes v0.138 SIRT1 Zornitza Stark Gene: sirt1 has been classified as Red List (Low Evidence).
Monogenic Diabetes v0.138 SIRT1 Zornitza Stark Classified gene: SIRT1 as Red List (low evidence)
Monogenic Diabetes v0.138 SIRT1 Zornitza Stark Gene: sirt1 has been classified as Red List (Low Evidence).
Mendeliome v1.2556 NARS Zornitza Stark Phenotypes for gene: NARS were changed from Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091; Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092; Abnormal muscle tone; Microcephaly; Global developmental delay; Intellectual disability; Seizures; Ataxia; Abnormality of the face; Demyelinating peripheral neuropathy to Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091; Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092; Hereditary peripheral neuropathy, MONDO:0020127, NARS-related
Mendeliome v1.2555 NARS Zornitza Stark Publications for gene: NARS were set to 32738225
Mendeliome v1.2554 NARS Zornitza Stark edited their review of gene: NARS: Added comment: Three families with isolated neuropathy and missense variants in this gene. Segregation and functional evidence. Likely phone expansion into the milder end of the spectrum for NARS-related disorders.; Changed publications: 32738225, 38495304, 38769024; Changed phenotypes: Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091, Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092, Hereditary peripheral neuropathy, MONDO:0020127, NARS-related, Abnormal muscle tone, Microcephaly, Global developmental delay, Intellectual disability, Seizures, Ataxia, Abnormality of the face, Demyelinating peripheral neuropathy
Cerebral vascular malformations v1.6 NOS3 Zornitza Stark Marked gene: NOS3 as ready
Cerebral vascular malformations v1.6 NOS3 Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v1.6 NOS3 Zornitza Stark Classified gene: NOS3 as Amber List (moderate evidence)
Cerebral vascular malformations v1.6 NOS3 Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v1.5 NOS3 Zornitza Stark gene: NOS3 was added
gene: NOS3 was added to Cerebral vascular malformations. Sources: Literature
Mode of inheritance for gene: NOS3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: NOS3 were set to 36941667; 37383439
Phenotypes for gene: NOS3 were set to Moyamoya disease, MONDO:0016820
Review for gene: NOS3 was set to AMBER
Added comment: PMID:36941667 analysed six patients from a cohort of 126 consecutive unrelated probands with Moyamoya angiopathy (MMA) of unknown etiology. Two of these six patients were identified with homozygous NOS3 variants, of which one is missense (c.1942T> C, p.(Cys648Arg)) and the other is splice-site variant (c.1502 + 1G > C). Both probands with NOS3 variants suffered from an infant-onset and severe MMA associated with posterior cerebral artery steno-occlusive lesions. There is also some functional evidence available for both variants.

PMID:37383439 reported six patients with Moyamoya disease, of which one patient was identified with monoallelic missense NOS3 variant (c.1684G>A; p.Glu562Lys.

In summary, there are two unrelated cases and some functional evidence available for the association of biallelic variants with MMA. However, there is only one case with monoallelic NOS3 variant. The pathogenicity of this monoallelic variant was not explored in detail in the publication
Sources: Literature
Mendeliome v1.2554 NOS3 Zornitza Stark Phenotypes for gene: NOS3 were changed from {Hypertension, susceptibility to}, MIM#145500; {Ischemic stroke, susceptibility to}, MIM# 601367; {Hypertension, pregnancy-induced}, MIM# 189800 to Moyamoya disease, MONDO:0016820
Mendeliome v1.2553 NOS3 Zornitza Stark Publications for gene: NOS3 were set to 24986538; 28084234; 33652340
Mendeliome v1.2552 NOS3 Zornitza Stark Mode of inheritance for gene: NOS3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2551 NOS3 Zornitza Stark Classified gene: NOS3 as Amber List (moderate evidence)
Mendeliome v1.2551 NOS3 Zornitza Stark Gene: nos3 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v1.4 KEL Zornitza Stark Marked gene: KEL as ready
Cerebral vascular malformations v1.4 KEL Zornitza Stark Gene: kel has been classified as Red List (Low Evidence).
Cerebral vascular malformations v1.4 KEL Zornitza Stark gene: KEL was added
gene: KEL was added to Cerebral vascular malformations. Sources: Literature
Mode of inheritance for gene: KEL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KEL were set to 30578106; 37978175
Phenotypes for gene: KEL were set to vein of Galen aneurysm, MONDO:0015196
Review for gene: KEL was set to RED
Added comment: PMID:37978175 reported a cohort of 114 probands with radiographically confirmed vein of Galen malformations (VOGMs), which is the most common and most severe of congenital brain arteriovenous malformations. This includes 55 cases already reported in PMID:30578106. Of these cases, only two were identified with variants in KEL gene (p.(Gln321Ter) & p.(Gly202Ser)).There is no functional evidence or segregation evidence available.
Sources: Literature
Mendeliome v1.2550 KEL Zornitza Stark Phenotypes for gene: KEL were changed from [Blood group, Kell] 110900 to vein of Galen aneurysm, MONDO:0015196
Mendeliome v1.2549 KEL Zornitza Stark Publications for gene: KEL were set to
Mendeliome v1.2548 KEL Zornitza Stark Mode of inheritance for gene: KEL was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2547 KEL Zornitza Stark reviewed gene: KEL: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark Marked gene: GAP43 as ready
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark Gene: gap43 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v1.132 GAP43 Zornitza Stark gene: GAP43 was added
gene: GAP43 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: GAP43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GAP43 were set to 39738362
Phenotypes for gene: GAP43 were set to neurodevelopmental disorder, MONDO:0700092, GAP43-related
Review for gene: GAP43 was set to RED
Added comment: PMID:39738362 reported the identification of a heterozygous missense variant in the GAP43 gene (p.(Glu146Lys)) in a 15-year-old female patient with moderate intellectual disability, neurodevelopmental disorders, short stature, and skeletal abnormalities such as left-right difference in legs and digital deformities.

The variant GAP43 protein was found to be unstable in neuronal cells and the disruption of Gap43 in mouse embryonic cortical neurons impaired axonal elongation and dendrite formation.
Sources: Literature
Fetal anomalies v1.328 SIRT6 Zornitza Stark Marked gene: SIRT6 as ready
Fetal anomalies v1.328 SIRT6 Zornitza Stark Gene: sirt6 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.328 SIRT6 Zornitza Stark Classified gene: SIRT6 as Amber List (moderate evidence)
Fetal anomalies v1.328 SIRT6 Zornitza Stark Gene: sirt6 has been classified as Amber List (Moderate Evidence).
Fetal anomalies v1.327 SIRT6 Zornitza Stark gene: SIRT6 was added
gene: SIRT6 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: SIRT6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SIRT6 were set to 29555651; 30135584
Phenotypes for gene: SIRT6 were set to syndromic disease, MONDO:0002254, SIRT6-related
Review for gene: SIRT6 was set to AMBER
Added comment: PMID:29555651 reported a family with four consecutive cases of late fetal loss at gestational ages between 17 and 35 weeks. The fetuses showed prenatal abnormalities including intrauterine growth restriction (IUGR), microcephaly, craniofacial anomalies, sex reversal in male fetuses, and congenital heart defects. A homozygous inactivating variant in SIRT6 gene (c.187G > C; p.(Asp63His)) was identified by WES in the four fetuses.

There is also functional data available from in vitro studies, SIRT6 D63H mouse embryonic stem cells and human induced pluripotent stem cells (iPSCs) derived from D63H homozygous foetuses. There is also functional evidence available from several other studies including PMID:30135584, where CRISPR-Cas9-based approach was used to generate a SIRT6-null cynomolgus monkey (Macaca fascicularis) model. SIRT6-deficient monkeys died hours after birth and exhibited severe prenatal developmental retardation.
Sources: Literature
Mendeliome v1.2547 SIRT6 Zornitza Stark Phenotypes for gene: SIRT6 were changed from perinatal disease MONDO:0100086 to syndromic disease, MONDO:0002254, SIRT6-related
Mendeliome v1.2546 SIRT6 Zornitza Stark reviewed gene: SIRT6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: syndromic disease, MONDO:0002254, SIRT6-related; Mode of inheritance: None
Mendeliome v1.2546 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from neurodevelopmental disorder MONDO:0700092, LSM1-related to Neurodevelopmental disorder, MONDO:0700092, LSM1-related
Mendeliome v1.2545 LSM1 Zornitza Stark Publications for gene: LSM1 were set to 31010896
Mendeliome v1.2544 LSM1 Zornitza Stark Classified gene: LSM1 as Green List (high evidence)
Mendeliome v1.2544 LSM1 Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence).
Mendeliome v1.2543 LSM1 Zornitza Stark edited their review of gene: LSM1: Added comment: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals.; Changed rating: GREEN; Changed publications: 31010896, 36100156, 40204357; Changed phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related
Intellectual disability syndromic and non-syndromic v1.131 LSM1 Zornitza Stark Phenotypes for gene: LSM1 were changed from no OMIM number yet to Neurodevelopmental disorder, MONDO:0700092, LSM1-related
Intellectual disability syndromic and non-syndromic v1.130 LSM1 Zornitza Stark Publications for gene: LSM1 were set to PMID: 31010896
Intellectual disability syndromic and non-syndromic v1.129 LSM1 Zornitza Stark Classified gene: LSM1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.129 LSM1 Zornitza Stark Gene: lsm1 has been classified as Green List (High Evidence).
Genetic Epilepsy v1.148 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related
Genetic Epilepsy v1.147 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Genetic Epilepsy v1.146 RNU2-2P Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P.
Mendeliome v1.2543 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related
Mendeliome v1.2542 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Mendeliome v1.2541 RNU2-2P Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P.
Intellectual disability syndromic and non-syndromic v1.128 RNU2-2P Zornitza Stark Phenotypes for gene: RNU2-2P were changed from Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related to Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related
Intellectual disability syndromic and non-syndromic v1.127 RNU2-2P Zornitza Stark Publications for gene: RNU2-2P were set to https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Zornitza Stark Tag new gene name tag was added to gene: RNU2-2P.
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton changed review comment from: Note current HGNC accepted gene name RNU2-2
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Previously referred to as RNU2-2P
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).; to: Note current HGNC accepted gene name RNU2-2
Previously referred to as RNU2-2P
Upstream of WDR74, as such variants may be incorrectly annotated as 5' WDR74
Encodes part of minor spliceosome (RNA) - non protein coding gene.

Total of 25 affected individuals with 16 described in PMID: 40210679 to have a neurodevelopmental disorder including intellectual disability (mod to severe), dysmorphism, global developmental delay, autistic behaviour, early onset drug resistant epilepsy, microcephaly, hyperventilation. Variants were de novo.

Recurrent variants included n.4G>A and n.35A>G
(should note another variant n.35A>T relatively common in population and said to be mosaic somatic by authors).
Intellectual disability syndromic and non-syndromic v1.126 RNU2-2P Sarah Milton reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40210679; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, RNU2-2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Prepair 500+ v1.568 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Prepair 500+ v1.568 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Prepair 500+ v1.568 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from Muscular dystrophy, congenital merosin-deficient, 607855 (3) to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Prepair 500+ v1.567 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Prepair 500+ v1.566 L2HGDH Zornitza Stark Marked gene: L2HGDH as ready
Prepair 500+ v1.566 L2HGDH Zornitza Stark Gene: l2hgdh has been classified as Green List (High Evidence).
Prepair 500+ v1.566 L2HGDH Zornitza Stark Phenotypes for gene: L2HGDH were changed from L-2-hydroxyglutaric aciduria, 236792 (3) to L-2-hydroxyglutaric aciduria, MIM#236792
Prepair 500+ v1.565 L2HGDH Zornitza Stark Publications for gene: L2HGDH were set to
Prepair 500+ v1.564 L1CAM Zornitza Stark Marked gene: L1CAM as ready
Prepair 500+ v1.564 L1CAM Zornitza Stark Gene: l1cam has been classified as Green List (High Evidence).
Prepair 500+ v1.564 L1CAM Zornitza Stark Phenotypes for gene: L1CAM were changed from MASA syndrome, 303350 (3) to MASA syndrome, MIM#303350; Hydrocephalus, congenital, X-linked, MIM#307000
Prepair 500+ v1.563 L1CAM Zornitza Stark Publications for gene: L1CAM were set to
Prepair 500+ v1.562 KRT14 Zornitza Stark Marked gene: KRT14 as ready
Prepair 500+ v1.562 KRT14 Zornitza Stark Gene: krt14 has been classified as Green List (High Evidence).
Prepair 500+ v1.562 KRT14 Zornitza Stark Phenotypes for gene: KRT14 were changed from Epidermolysis bullosa simplex, recessive 1, 601001 (3) to Epidermolysis bullosa simplex 1D, generalized, intermediate or severe, autosomal recessive MIM# 601001; MONDO:0010976
Prepair 500+ v1.561 KRT14 Zornitza Stark Publications for gene: KRT14 were set to
Prepair 500+ v1.560 KIF7 Zornitza Stark Marked gene: KIF7 as ready
Prepair 500+ v1.560 KIF7 Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence).
Prepair 500+ v1.560 KIF7 Zornitza Stark Phenotypes for gene: KIF7 were changed from Hydrolethalus syndrome 2, 614120 (3) to Al-Gazali-Bakalinova syndrome MIM#607131; Hydrolethalus syndrome 2 MIM#614120; Acrocallosal syndrome MIM#200990; Joubert syndrome 12 MIM#200990
Prepair 500+ v1.559 KIF7 Zornitza Stark Publications for gene: KIF7 were set to
Prepair 500+ v1.558 KIF1A Zornitza Stark Marked gene: KIF1A as ready
Prepair 500+ v1.558 KIF1A Zornitza Stark Gene: kif1a has been classified as Green List (High Evidence).
Prepair 500+ v1.558 KIF1A Zornitza Stark Phenotypes for gene: KIF1A were changed from Spastic paraplegia 30, autosomal recessive, 610357 (3) to Spastic paraplegia 30, autosomal recessive, MIM#610357
Prepair 500+ v1.557 KIF1A Zornitza Stark Publications for gene: KIF1A were set to
Renal Ciliopathies and Nephronophthisis v1.29 IFT140 Zornitza Stark Publications for gene: IFT140 were set to 22503633; 23418020; 34890546
Renal Ciliopathies and Nephronophthisis v1.28 IFT140 Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; {Polycystic kidney disease 9, susceptibility to} MIM#621164 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Cranioectodermal dysplasia 5, MIM# 621180; {Polycystic kidney disease 9, susceptibility to} MIM#621164
Renal Ciliopathies and Nephronophthisis v1.27 IFT140 Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum. All individuals had a recurrent tandem duplication spanning exons 27 to 30 in trans with other variants. Renal disease including renal failure was a prominent part of the phenotype.; Changed publications: 22503633, 23418020, 34890546, 37628605; Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, MONDO:0009964, Cranioectodermal dysplasia 5, MIM# 621180, {Polycystic kidney disease 9, susceptibility to} MIM#621164
Ciliopathies v1.69 IFT140 Zornitza Stark changed review comment from: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; to: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum. All individuals had a recurrent tandem duplication spanning exons 27 to 30 in trans with other variants.
Mendeliome v1.2541 BRF2 Zornitza Stark Marked gene: BRF2 as ready
Mendeliome v1.2541 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Mendeliome v1.2541 BRF2 Zornitza Stark Classified gene: BRF2 as Green List (high evidence)
Mendeliome v1.2541 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Mendeliome v1.2540 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model.
Sources: Literature
Fetal anomalies v1.326 BRF2 Zornitza Stark Marked gene: BRF2 as ready
Fetal anomalies v1.326 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Fetal anomalies v1.326 BRF2 Zornitza Stark Classified gene: BRF2 as Green List (high evidence)
Fetal anomalies v1.326 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Fetal anomalies v1.325 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Fetal anomalies. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model.
Sources: Literature
Microcephaly v1.307 BRF2 Zornitza Stark Marked gene: BRF2 as ready
Microcephaly v1.307 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Microcephaly v1.307 BRF2 Zornitza Stark Classified gene: BRF2 as Green List (high evidence)
Microcephaly v1.307 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Microcephaly v1.306 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant. Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID. Supportive functional data, including animal model.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Marked gene: BRF2 as ready
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Classified gene: BRF2 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.126 BRF2 Zornitza Stark Gene: brf2 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.125 BRF2 Zornitza Stark gene: BRF2 was added
gene: BRF2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: BRF2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: BRF2 were set to 40229899
Phenotypes for gene: BRF2 were set to Syndromic disease, MONDO:0002254, BRF2-related
Review for gene: BRF2 was set to GREEN
Added comment: 7 individuals from 3 unrelated families reported. In addition, 3 Icelanding families with same recurrent splicing variant and recurrent perinatal deaths; however, affected individuals unable to be genotyped and this seems to be a founder variant.

Craniofacial malformations, microcephaly and perinatal death in several individuals. Survivors had ID.

Supportive functional data, including animal model.
Sources: Literature
Mendeliome v1.2539 ATP2A2 Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Acrokeratosis verruciformis MIM#101900; Darier disease MIM#124200 to Acrokeratosis verruciformis MIM#101900; Darier disease MIM#124200; Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis
Mendeliome v1.2538 ATP2A2 Zornitza Stark Publications for gene: ATP2A2 were set to PMID: 24336169
Mendeliome v1.2537 ATP2A2 Zornitza Stark reviewed gene: ATP2A2: Rating: AMBER; Mode of pathogenicity: None; Publications: 39970126; Phenotypes: Congenital myopathy, MONDO:0019952, ATP2A2-related, rhabdomyolysis; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v1.2537 MYO1A Bryony Thompson Mode of inheritance for gene: MYO1A was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2536 MYO1A Bryony Thompson Classified gene: MYO1A as Amber List (moderate evidence)
Mendeliome v1.2536 MYO1A Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence).
Rhabdomyolysis and Metabolic Myopathy v1.24 ATP2A2 Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis to Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis
Rhabdomyolysis and Metabolic Myopathy v1.23 ATP2A2 Zornitza Stark Marked gene: ATP2A2 as ready
Rhabdomyolysis and Metabolic Myopathy v1.23 ATP2A2 Zornitza Stark Gene: atp2a2 has been classified as Amber List (Moderate Evidence).
Rhabdomyolysis and Metabolic Myopathy v1.23 ATP2A2 Zornitza Stark Phenotypes for gene: ATP2A2 were changed from Congenital myopathy, MONDO:0019952, ATP2A2-related to Congenital myopathy, MONDO:0019952, ATP2A2-related; rhabdomyolysis
Congenital Diarrhoea v1.19 MYO1A Bryony Thompson Marked gene: MYO1A as ready
Congenital Diarrhoea v1.19 MYO1A Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.19 MYO1A Bryony Thompson Classified gene: MYO1A as Amber List (moderate evidence)
Congenital Diarrhoea v1.19 MYO1A Bryony Thompson Gene: myo1a has been classified as Amber List (Moderate Evidence).
Rhabdomyolysis and Metabolic Myopathy v1.22 ATP2A2 Zornitza Stark Classified gene: ATP2A2 as Amber List (moderate evidence)
Rhabdomyolysis and Metabolic Myopathy v1.22 ATP2A2 Zornitza Stark Gene: atp2a2 has been classified as Amber List (Moderate Evidence).
Rhabdomyolysis and Metabolic Myopathy v1.21 ATP2A2 Zornitza Stark gene: ATP2A2 was added
gene: ATP2A2 was added to Rhabdomyolysis and Metabolic Myopathy. Sources: Literature
Mode of inheritance for gene: ATP2A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: ATP2A2 were set to 39970126
Phenotypes for gene: ATP2A2 were set to Congenital myopathy, MONDO:0019952, ATP2A2-related
Review for gene: ATP2A2 was set to AMBER
Added comment: Recurrent missense variant, c.1583G>A, p.R528Q, identified in 14 individuals from 3 unrelated families. Supportive functional data, including a zebrafish model.

Association established for this variant only.
Sources: Literature
Ciliopathies v1.69 FGF4 Bryony Thompson Marked gene: FGF4 as ready
Ciliopathies v1.69 FGF4 Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Ciliopathies v1.69 FGF4 Bryony Thompson Classified gene: FGF4 as Amber List (moderate evidence)
Ciliopathies v1.69 FGF4 Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2535 FGF4 Bryony Thompson Marked gene: FGF4 as ready
Mendeliome v1.2535 FGF4 Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2535 FGF4 Bryony Thompson Classified gene: FGF4 as Amber List (moderate evidence)
Mendeliome v1.2535 FGF4 Bryony Thompson Gene: fgf4 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2534 EIF3K Bryony Thompson Marked gene: EIF3K as ready
Mendeliome v1.2534 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2534 EIF3K Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence)
Mendeliome v1.2534 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Marked gene: EIF3K as ready
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Classified gene: EIF3K as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.124 EIF3K Bryony Thompson Gene: eif3k has been classified as Amber List (Moderate Evidence).
Ataxia v1.37 PCNA Bryony Thompson Marked gene: PCNA as ready
Ataxia v1.37 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Ataxia v1.37 PCNA Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence)
Ataxia v1.37 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2533 PCNA Bryony Thompson Marked gene: PCNA as ready
Mendeliome v1.2533 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2533 PCNA Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence)
Mendeliome v1.2533 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Marked gene: PCNA as ready
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Classified gene: PCNA as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v1.123 PCNA Bryony Thompson Gene: pcna has been classified as Amber List (Moderate Evidence).
Ataxia v1.36 RAB3A Bryony Thompson Marked gene: RAB3A as ready
Ataxia v1.36 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Ataxia v1.36 RAB3A Bryony Thompson Classified gene: RAB3A as Green List (high evidence)
Ataxia v1.36 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Marked gene: RAB3A as ready
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Classified gene: RAB3A as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.122 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.92 RAB3A Bryony Thompson Marked gene: RAB3A as ready
Hereditary Spastic Paraplegia v1.92 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Hereditary Spastic Paraplegia v1.92 RAB3A Bryony Thompson Classified gene: RAB3A as Green List (high evidence)
Hereditary Spastic Paraplegia v1.92 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Mendeliome v1.2532 RAB3A Bryony Thompson Marked gene: RAB3A as ready
Mendeliome v1.2532 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Mendeliome v1.2532 RAB3A Bryony Thompson Classified gene: RAB3A as Green List (high evidence)
Mendeliome v1.2532 RAB3A Bryony Thompson Gene: rab3a has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.121 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Ataxia v1.35 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Ataxia - paediatric. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to autosomal dominant cerebellar ataxia MONDO:0020380
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Hereditary Spastic Paraplegia v1.91 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Hereditary Spastic Paraplegia - paediatric. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Mendeliome v1.2531 RAB3A Bryony Thompson gene: RAB3A was added
gene: RAB3A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: RAB3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: RAB3A were set to 40166812
Phenotypes for gene: RAB3A were set to autosomal dominant cerebellar ataxia MONDO:0020380; neurodevelopmental disorder MONDO:0700092
Review for gene: RAB3A was set to GREEN
Added comment: 18 individuals from 10 unrelated cerebellar ataxia families were heterozygous for a RAB3A missense variant. 9/10 families had a recurrent variant - p.Arg83Trp. The age of onset of the ataxia was adult, except for 3 paediatric/adolescent onset cases. Additionally, 4 individuals from 3 families (F11, F12, F13) with 2 de novo missense and a stopgain had similar phenotypes consisting of a neurodevelopmental syndrome with progressive cognitive deficits and spasticity. F14 was a singleton with a missense variant and HMSN & optic atrophy. Initially included in the cohort for gait ataxia, was found to be a sensory ataxia. There were supporting in vitro functional assays and Drosophila rescue models that suggest partial loss of function as the disease mechanism, but were unable to differentiate the genotype-phenotype correlation for the cerebellar ataxia phenotype vs the neurodevelopmental syndrome.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton changed review comment from: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable.; to: LSM1 encodes a subunit of a complex composed of proteins LSM1-7 which is involved in mRNA stabilisation as well as degradation. Other proteins within the complex are yet to have a definitive disease association however LSM7 has been reported a candidate gene.

3 papers detail 10 affected individuals from 6 families with either a homozygous recurrent splice variant (LSM1:c.231+4A>C) or a homozygous missense variant (LSM1:p.Asn40Tyr in only 1 family). Both very rare in gnomad v4 with 0 homozygotes.

The phenotype of the individuals encompassed severe intellectual disability/developmental delay, shared dysmorphic features (broad forehead, pointed chin, medially thickened arched eyebrows, hypertelorism, bulbous nasal tip), skeletal anomalies, cardiovascular (ASD/VSD/aortic valve) and genitourinary abnormalities (CAKUT/hypospadias), gastrointestinal manifestations, hypotonia and visual impairments.

RT PCR of the splice variant demonstrated exon 3 skipping with a resultant truncated protein with presumed loss of function mechanism. It was noted by authors there are no biallelic loss of function variant in the gnomad v4, as such it was suggested complete loss of function is non viable. Variants outside of exon 3 have not yet been reported in affected individuals.
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton edited their review of gene: LSM1: Changed publications: (PMID: 31010896, PMID: 36100156, PMID: 40204357)
Intellectual disability syndromic and non-syndromic v1.120 LSM1 Sarah Milton reviewed gene: LSM1: Rating: GREEN; Mode of pathogenicity: None; Publications: (PMID: 31010896, 36100156, 40204357); Phenotypes: Neurodevelopmental disorder, MONDO:0700092, LSM1-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Fetal anomalies v1.324 MYRF Zornitza Stark Phenotypes for gene: MYRF were changed from Cardiac-urogenital syndrome, MIM# 618280 to Cardiac-urogenital syndrome, MIM# 618280; Nanophthalmos 1, MIM# 600165
Fetal anomalies v1.323 MYRF Zornitza Stark Publications for gene: MYRF were set to 30985895; 30070761; 31069960; 29446546; 30532227
Fetal anomalies v1.322 MYRF Zornitza Stark edited their review of gene: MYRF: Changed publications: 29446546, 29446546, 30532227, 31069960, 31266062
Fetal anomalies v1.322 MYRF Zornitza Stark changed review comment from: Cardiac-urogenital syndrome is characterized by partial anomalous pulmonary venous return in association with tracheal anomalies, pulmonary hypoplasia, congenital diaphragmatic hernia, thyroid fibrosis, thymic involution, cleft spleen, penoscrotal hypospadias, and cryptorchidism.

More than 10 unrelated individuals reported.
Sources: Expert list; to: Cardiac-urogenital syndrome is characterized by partial anomalous pulmonary venous return in association with tracheal anomalies, pulmonary hypoplasia, congenital diaphragmatic hernia, thyroid fibrosis, thymic involution, cleft spleen, penoscrotal hypospadias, and cryptorchidism.

More than 10 unrelated individuals reported.

Also note association with nanophthalmos, which may also be detectable on US.
Sources: Expert list
Fetal anomalies v1.322 MYRF Zornitza Stark edited their review of gene: MYRF: Changed phenotypes: Cardiac-urogenital syndrome, MIM# 618280, Nanophthalmos 1, MIM# 600165
Mendeliome v1.2530 MYRF Zornitza Stark Phenotypes for gene: MYRF were changed from Nanophthalmos and high hyperopia; Cardiac-urogenital syndrome, MIM# 618280; Encephalitis/encephalopathy, mild, with reversible myelin vacuolization, MIM# 618113 to Nanophthalmos 1, MIM# 600165; Cardiac-urogenital syndrome, MIM# 618280; Encephalitis/encephalopathy, mild, with reversible myelin vacuolization, MIM# 618113
Anophthalmia_Microphthalmia_Coloboma v1.46 MYRF Zornitza Stark Phenotypes for gene: MYRF were changed from Nanophthalmos; High hyperopia to Nanophthalmos 1, MIM# 600165
Anophthalmia_Microphthalmia_Coloboma v1.45 MYRF Zornitza Stark edited their review of gene: MYRF: Changed phenotypes: Nanophthalmos 1, MIM# 600165
Ataxia v1.34 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Ataxia - paediatric. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Intellectual disability syndromic and non-syndromic v1.120 PCNA Sangavi Sivagnanasundram gene: PCNA was added
gene: PCNA was added to Intellectual disability syndromic and non-syndromic. Sources: ClinGen
Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PCNA were set to 24911150, 33426167, 36990216
Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309
Review for gene: PCNA was set to AMBER
Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778

Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown.
Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability.
Sources: ClinGen
Mendeliome v1.2529 SIRT6 Bryony Thompson Marked gene: SIRT6 as ready
Mendeliome v1.2529 SIRT6 Bryony Thompson Gene: sirt6 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2529 SIRT6 Bryony Thompson Phenotypes for gene: SIRT6 were changed from to perinatal disease MONDO:0100086
Mendeliome v1.2528 SIRT6 Bryony Thompson Classified gene: SIRT6 as Amber List (moderate evidence)
Mendeliome v1.2528 SIRT6 Bryony Thompson Added comment: Comment on list classification: Single family and animal model
Mendeliome v1.2528 SIRT6 Bryony Thompson Gene: sirt6 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2527 MYO1A Sangavi Sivagnanasundram edited their review of gene: MYO1A: Added comment: A male infant presenting with congenital diarrhea from the age of 2.
Compound heterozygous variants in MYO1A detected in trans were identified (I678F (FAF 0.5%); D240N (FAF - 0.004%)
Supportive functional assay in patient fibroblasts was conducted along with a knockout mice model recapitulating human phenotype and findings consistent with the findings from the probands biopsy.; Changed rating: AMBER; Changed publications: 40174224; Changed phenotypes: Congenital diarrhea, MONDO:0000824; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Diarrhoea v1.18 MYO1A Sangavi Sivagnanasundram gene: MYO1A was added
gene: MYO1A was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: MYO1A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO1A were set to 40174224
Phenotypes for gene: MYO1A were set to Congenital diarrhea, MONDO:0000824
Review for gene: MYO1A was set to AMBER
Added comment: A male infant presenting with congenital diarrhea from the age of 2.
Compound heterozygous variants in MYO1A detected in trans were identified (I678F (FAF 0.5%); D240N (FAF - 0.004%)
Supportive functional assay in patient fibroblasts was conducted along with a knockout mice model recapitulating human phenotype and findings consistent with the findings from the probands biopsy.
Sources: Literature
Mendeliome v1.2527 MYO1A Sangavi Sivagnanasundram reviewed gene: MYO1A: Rating: RED; Mode of pathogenicity: None; Publications: 24616153; Phenotypes: nonsyndromic genetic hearing loss MONDO:0019497; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ciliopathies v1.68 FGF4 Sangavi Sivagnanasundram gene: FGF4 was added
gene: FGF4 was added to Ciliopathies. Sources: Literature
Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF4 were set to 40259859
Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770
Review for gene: FGF4 was set to AMBER
Added comment: Two families with three affected individuals reported with homozygous variants in FGF4.

Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased.
Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings.
Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1)

Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy)
Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1)
Sources: Literature
Mendeliome v1.2527 FGF4 Sangavi Sivagnanasundram gene: FGF4 was added
gene: FGF4 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: FGF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FGF4 were set to 40259859
Phenotypes for gene: FGF4 were set to Jeune Syndrome, FGF4-related, MONDO:0018770
Review for gene: FGF4 was set to AMBER
Added comment: Two families with three affected individuals reported with homozygous variants in FGF4.

Family 1 - Consanguineous parents with five children. Three are unaffected and two are affected with Jeune syndrome - like phenotypes. One of the affected siblings is deceased.
Proband was diagnosed with pulmonary hypoplasia at 6 months and later identified to have Jeune Syndrome due to other findings.
Homozygous p.Leu86Phe missense variant was identified (variant absent from gnomAD v4.1)

Family 2 - Non-consanguineous parents with affected son with Jeune syndrome like phenotype (pulmonary hypoplasia and thoracic dystrophy)
Homozygous p.Pro204His missense variant was identified (variant absent from gnomAD v4.1)
Sources: Literature
Mendeliome v1.2527 EIF3K Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram edited their review of gene: EIF3K: Changed rating: AMBER
Fetal anomalies v1.322 ODC1 Bryony Thompson Marked gene: ODC1 as ready
Fetal anomalies v1.322 ODC1 Bryony Thompson Gene: odc1 has been classified as Green List (High Evidence).
Fetal anomalies v1.322 ODC1 Bryony Thompson Classified gene: ODC1 as Green List (high evidence)
Fetal anomalies v1.322 ODC1 Bryony Thompson Gene: odc1 has been classified as Green List (High Evidence).
Congenital Myasthenia v1.12 UNC50 Bryony Thompson Marked gene: UNC50 as ready
Congenital Myasthenia v1.12 UNC50 Bryony Thompson Gene: unc50 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.12 UNC50 Bryony Thompson Classified gene: UNC50 as Amber List (moderate evidence)
Congenital Myasthenia v1.12 UNC50 Bryony Thompson Gene: unc50 has been classified as Amber List (Moderate Evidence).
Congenital Myasthenia v1.11 UNC50 Bryony Thompson gene: UNC50 was added
gene: UNC50 was added to Congenital Myasthenia. Sources: Literature
Mode of inheritance for gene: UNC50 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UNC50 were set to 33820833; 29016857; 40219868
Phenotypes for gene: UNC50 were set to arthrogryposis multiplex congenita MONDO:0015168; congenital myasthenic syndrome MONDO:0018940
Review for gene: UNC50 was set to AMBER
Added comment: 3 probands reported, 2 with AMC and 1 with CMS.
PMID: 33820833 & PMID: 29016857 report the same French AMC proband with a homozygous frameshift variant (c.750_751del:p.Cys251Phefs*4). In the methods section PMID: 33820833 states that morphological analyses of skeletal muscle, neuromuscular junction or peripheral nerve in patient samples, and functional validation of newly identified genes were reported in separate reports, including PMID: 29016857. Supporting C. elegans model with loss of AChR expression.
PMID: 40219868 - the same homozygous splice variant c.644-13_644-9del was reported in 2 unrelated Indian probands, one with AMC and one with a congenital myasthenic syndrome. Both families had affected siblings with consistent phenotypes, which were not tested for the variant.
Sources: Literature
Fetal anomalies v1.321 UNC50 Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2527 UNC50 Bryony Thompson Phenotypes for gene: UNC50 were changed from Arthrogryposis multiplex congenita to arthrogryposis multiplex congenita MONDO:0015168; congenital myasthenic syndrome MONDO:0018940
Mendeliome v1.2526 UNC50 Bryony Thompson Publications for gene: UNC50 were set to 29016857; 33820833
Mendeliome v1.2525 UNC50 Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.419 UNC50 Bryony Thompson edited their review of gene: UNC50: Changed phenotypes: arthrogryposis multiplex congenita MONDO:0015168, congenital myasthenic syndrome MONDO:0018940
Intellectual disability syndromic and non-syndromic v1.120 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Intellectual disability syndromic and non-syndromic. Sources: Other
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence is required determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Other
Mendeliome v1.2525 EIF3K Sangavi Sivagnanasundram changed review comment from: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Literature; to: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder. Only two variants have been reported.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Literature
Mendeliome v1.2525 EIF3K Sangavi Sivagnanasundram gene: EIF3K was added
gene: EIF3K was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: EIF3K was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: EIF3K were set to 40219605
Phenotypes for gene: EIF3K were set to EIF3K-related neurodevelopmental disorder, MONDO:0700092
Review for gene: EIF3K was set to RED
Added comment: More evidence will be needed to determine whether variants in EIF3K result in a neurodevelopmental disorder.

Four individuals with global DD, microcephaly, and short stature. Three out of the four individuals had the recurrent homozygous EIF3K (Asp43Gly - gnomAD v4.1 GrpMax FAF - 0.06044%) variant whilst another individual has homozygous intronic EIF3K variant, c.355-13A>G (gnomADv4.1 GrpMax FAF = 0.002551%).
The 3 individuals of Puerto Rican ancestry with the recurrent missense variant also had homozygous SYNE4 variant (Arg119Trp) identified which the author related to the probands' hearing loss phenotype.
The Asp43Gly missense variant could potentially be a founder variant however only three families with affected probands have been reported with the variant.
Sources: Literature
Arthrogryposis v0.419 UNC50 Bryony Thompson Phenotypes for gene: UNC50 were changed from Arthrogryposis multiplex congenita to Arthrogryposis multiplex congenita MONDO:0015168
Arthrogryposis v0.418 UNC50 Bryony Thompson Publications for gene: UNC50 were set to 29016857; 33820833
Arthrogryposis v0.417 UNC50 Bryony Thompson reviewed gene: UNC50: Rating: AMBER; Mode of pathogenicity: None; Publications: 33820833, 29016857, 40219868; Phenotypes: arthrogryposis multiplex congenita MONDO:0015168; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2525 MON1A Bryony Thompson Marked gene: MON1A as ready
Mendeliome v1.2525 MON1A Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2525 MON1A Bryony Thompson Classified gene: MON1A as Amber List (moderate evidence)
Mendeliome v1.2525 MON1A Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.18 MON1A Bryony Thompson Marked gene: MON1A as ready
Congenital Diarrhoea v1.18 MON1A Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.18 MON1A Bryony Thompson Classified gene: MON1A as Amber List (moderate evidence)
Congenital Diarrhoea v1.18 MON1A Bryony Thompson Gene: mon1a has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2524 MON1A Bryony Thompson gene: MON1A was added
gene: MON1A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: MON1A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MON1A were set to 40174224
Phenotypes for gene: MON1A were set to Congenital diarrhea MONDO:0000824
Review for gene: MON1A was set to AMBER
Added comment: Sources: Literature
Congenital Diarrhoea v1.17 MON1A Bryony Thompson gene: MON1A was added
gene: MON1A was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: MON1A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MON1A were set to 40174224
Phenotypes for gene: MON1A were set to Congenital diarrhea MONDO:0000824
Review for gene: MON1A was set to AMBER
Added comment: A single homozygous (R249C) case with congenital diarrhoea from a consanguineous family. Supporting in vitro assays and expression studies in the patient cells. Also, a knockout zebrafish model that had a phenotype consistent with enteropathy.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 TUBA1C Jasmine Chew gene: TUBA1C was added
gene: TUBA1C was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TUBA1C was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TUBA1C were set to 39209701
Phenotypes for gene: TUBA1C were set to Oocyte/zygote/embryo maturation arrest
Review for gene: TUBA1C was set to GREEN
Added comment: New paper (biallelic variants for OZEMA)-
i) PMID: 39209701- patients 1 and 2 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carrying homozygous nonsense variant (p.Gln358Ter) and frameshift deletion variant (p.Tyr444Metfs*42), respectively. Transfection studies showed that both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 TUBA4A Jasmine Chew edited their review of gene: TUBA4A: Changed publications: 39209701, 37024973, 39872894
Infertility and Recurrent Pregnancy Loss v0.77 TUBA4A Jasmine Chew changed review comment from: New papers reporting biallelic and monoallelic variants associated with OZEMA:
i) PMID: 39209701- patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant c.1319_1320del (p.Tyr440Ter) and missense variant c.1015C>T (p.Arg339Cys) of TUBA4A, respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated.

ii) PMID: 37024973 - reported three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%.

iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I.
Sources: Literature; to: New papers reporting biallelic and monoallelic variants associated with OZEMA:
i) PMID: 39209701- Patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant p.Tyr440Ter and missense variant p.Arg339Cys respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated.

ii) PMID: 37024973 - Three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%.

iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 TUBA4A Jasmine Chew edited their review of gene: TUBA4A: Changed rating: GREEN
Infertility and Recurrent Pregnancy Loss v0.77 TUBA4A Jasmine Chew gene: TUBA4A was added
gene: TUBA4A was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TUBA4A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: TUBA4A were set to 39209701; 37024973; 37024973
Phenotypes for gene: TUBA4A were set to Oocyte/zygote/embryo maturation arrest
Added comment: New papers reporting biallelic and monoallelic variants associated with OZEMA:
i) PMID: 39209701- patients 3 and 4 from unrelated families with primary infertility experiencing recurrent preimplantation embryo development arrest (RPEA) carried homozygous frameshift deletion variant c.1319_1320del (p.Tyr440Ter) and missense variant c.1015C>T (p.Arg339Cys) of TUBA4A, respectively. Transfection studies showed that caused both variants caused a significant decrease in the abundance of encoded proteins and abnormal cytoplasmic localisation manifested as localised protein aggregation. Differentially abundant transcripts in arrested embryos carrying the missense TUBA4A variant exhibited a trend of upregulation and were highly enriched in the mRNA metabolic process, and some key genes involved in degradation, such as MOS and PABPN1L have been shown to be significantly downregulated.

ii) PMID: 37024973 - reported three unrelated infertile females with similar phenotypes of embryonic arrest carrying different de novo heterozygous missense variants (pE77K, pL286P, p.C347K). Functional study showed that all the three mutant proteins caused severe microtubule destabilization. They also identified additional nine sporadic cases (seven were with phenotype of early embryonic arrest and two with phenotype of oocyte maturation arrest) with eight different heterozygous missense TUBA4A variants. Functional study showed that six out of the eight variants (R215H, R229C, A273V, E284K, A314V, and R373H) were incorporated in microtubules with a more severely abnormal appearance. Microinjection of TUBA4A mutant cRNAs (8 out of 11 variants) significantly reduced the rate of first polar body extrusion to 24.5–66.3% and microinjection of TUBA4A mutant cRNAs (6 out of 11 variants) also resulted in embryonic development arrest and reduced the rate of blastocyst formation to 51.0–65.0%.

iii) PMID: 39872894- Three isolated infertile female with zygotic arrest carrying heterozygous missense variants (P1- de novo p.E284K, P2- p.E284G, P3- p.E284K). Injection of mRNA encoding E284G and E284K mutants into mouse GV oocytes showed highly disrupted spindle morphology and apparent chromosome misalignment, only about 30% E284G- and E284K-injected oocytes completed meiosis I.
Sources: Literature
Cerebral vascular malformations v1.3 FOXM1 Bryony Thompson Marked gene: FOXM1 as ready
Cerebral vascular malformations v1.3 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Cerebral vascular malformations v1.3 FOXM1 Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence)
Cerebral vascular malformations v1.3 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Stroke v1.19 FOXM1 Bryony Thompson Marked gene: FOXM1 as ready
Stroke v1.19 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Stroke v1.19 FOXM1 Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence)
Stroke v1.19 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2523 GAP43 Bryony Thompson Marked gene: GAP43 as ready
Mendeliome v1.2523 GAP43 Bryony Thompson Gene: gap43 has been classified as Red List (Low Evidence).
Mendeliome v1.2523 GAP43 Bryony Thompson Classified gene: GAP43 as Red List (low evidence)
Mendeliome v1.2523 GAP43 Bryony Thompson Gene: gap43 has been classified as Red List (Low Evidence).
Cerebral vascular malformations v1.1 FOXM1 Bryony Thompson gene: FOXM1 was added
gene: FOXM1 was added to Cerebral vascular malformations. Sources: Literature
Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXM1 were set to 38969938
Phenotypes for gene: FOXM1 were set to Moyamoya disease MONDO:0016820
Stroke v1.17 FOXM1 Bryony Thompson gene: FOXM1 was added
gene: FOXM1 was added to Stroke. Sources: Literature
Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FOXM1 were set to 38969938
Phenotypes for gene: FOXM1 were set to Moyamoya disease MONDO:0016820
Mendeliome v1.2522 FOXM1 Bryony Thompson Marked gene: FOXM1 as ready
Mendeliome v1.2522 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2522 FOXM1 Bryony Thompson Classified gene: FOXM1 as Amber List (moderate evidence)
Mendeliome v1.2522 FOXM1 Bryony Thompson Gene: foxm1 has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.16 GRWD1 Bryony Thompson Marked gene: GRWD1 as ready
Congenital Diarrhoea v1.16 GRWD1 Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2521 GRWD1 Bryony Thompson Marked gene: GRWD1 as ready
Mendeliome v1.2521 GRWD1 Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.16 GRWD1 Bryony Thompson Classified gene: GRWD1 as Amber List (moderate evidence)
Congenital Diarrhoea v1.16 GRWD1 Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2521 GRWD1 Bryony Thompson Classified gene: GRWD1 as Amber List (moderate evidence)
Mendeliome v1.2521 GRWD1 Bryony Thompson Gene: grwd1 has been classified as Amber List (Moderate Evidence).
Congenital Diarrhoea v1.15 GRWD1 Bryony Thompson gene: GRWD1 was added
gene: GRWD1 was added to Congenital Diarrhoea. Sources: Literature
Mode of inheritance for gene: GRWD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GRWD1 were set to 40174224
Phenotypes for gene: GRWD1 were set to Congenital diarrhoea MONDO:0000824
Review for gene: GRWD1 was set to AMBER
Added comment: Single family (sib pair) with biallelic missense variants. Supporting zebrafish model and in vitro functional assays. Deficiency is the expected mechanism of disease.
Sources: Literature
Mendeliome v1.2520 GRWD1 Bryony Thompson gene: GRWD1 was added
gene: GRWD1 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GRWD1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: GRWD1 were set to 40174224
Phenotypes for gene: GRWD1 were set to Congenital diarrhoea MONDO:0000824
Review for gene: GRWD1 was set to AMBER
Added comment: Single family (sib pair) with biallelic missense variants. Supporting zebrafish model and in vitro functional assays. Deficiency is the expected mechanism of disease.
Sources: Literature
Prepair 500+ v1.556 KDM5C Zornitza Stark Marked gene: KDM5C as ready
Prepair 500+ v1.556 KDM5C Zornitza Stark Gene: kdm5c has been classified as Green List (High Evidence).
Prepair 500+ v1.556 KDM5C Zornitza Stark Phenotypes for gene: KDM5C were changed from Mental retardation, X-linked, syndromic, Claes-Jensen type, 300534 (3) to Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type; MIM#300534
Prepair 500+ v1.555 KDM5C Zornitza Stark Publications for gene: KDM5C were set to
Prepair 500+ v1.554 KCNQ1 Zornitza Stark Marked gene: KCNQ1 as ready
Prepair 500+ v1.554 KCNQ1 Zornitza Stark Gene: kcnq1 has been classified as Green List (High Evidence).
Prepair 500+ v1.554 KCNQ1 Zornitza Stark Phenotypes for gene: KCNQ1 were changed from Jervell and Lange-Nielsen syndrome, 220400 (3) to Jervell and Lange-Nielsen syndrome MIM#220400
Prepair 500+ v1.553 KCNQ1 Zornitza Stark Publications for gene: KCNQ1 were set to 29033053; 28438721
Prepair 500+ v1.552 KCNJ11 Zornitza Stark Marked gene: KCNJ11 as ready
Prepair 500+ v1.552 KCNJ11 Zornitza Stark Gene: kcnj11 has been classified as Green List (High Evidence).
Prepair 500+ v1.552 KCNJ11 Zornitza Stark Phenotypes for gene: KCNJ11 were changed from Hyperinsulinemic hypoglycemia, familial, 2, 601820 (3) to Hyperinsulinemic hypoglycemia, familial, 2, MIM#601820
Prepair 500+ v1.551 KCNJ11 Zornitza Stark Publications for gene: KCNJ11 were set to
Prepair 500+ v1.550 KCNJ1 Zornitza Stark Marked gene: KCNJ1 as ready
Prepair 500+ v1.550 KCNJ1 Zornitza Stark Gene: kcnj1 has been classified as Green List (High Evidence).
Prepair 500+ v1.550 KCNJ1 Zornitza Stark Phenotypes for gene: KCNJ1 were changed from Bartter syndrome, type 2, 241200 (3) to Bartter syndrome, type 2, MIM#241200
Prepair 500+ v1.549 KATNB1 Zornitza Stark Marked gene: KATNB1 as ready
Prepair 500+ v1.549 KATNB1 Zornitza Stark Gene: katnb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.549 KATNB1 Zornitza Stark Phenotypes for gene: KATNB1 were changed from Lissencephaly 6, with microcephaly, 616212 (3) to Lissencephaly 6, with microcephaly, MIM#616212
Prepair 500+ v1.548 KATNB1 Zornitza Stark Publications for gene: KATNB1 were set to
Prepair 500+ v1.547 JAK3 Zornitza Stark Marked gene: JAK3 as ready
Prepair 500+ v1.547 JAK3 Zornitza Stark Gene: jak3 has been classified as Green List (High Evidence).
Prepair 500+ v1.547 JAK3 Zornitza Stark Phenotypes for gene: JAK3 were changed from SCID, autosomal recessive, T-negative/B-positive type, 600802 (3) to Severe combined immunodeficiency, autosomal recessive, T-negative/B-positive type MIM#600802
Prepair 500+ v1.546 JAK3 Zornitza Stark Publications for gene: JAK3 were set to
Prepair 500+ v1.545 IVD Zornitza Stark Marked gene: IVD as ready
Prepair 500+ v1.545 IVD Zornitza Stark Gene: ivd has been classified as Green List (High Evidence).
Prepair 500+ v1.545 IVD Zornitza Stark Phenotypes for gene: IVD were changed from Isovaleric acidemia, 243500 (3) to Isovaleric acidemia, MIM #243500
Prepair 500+ v1.544 IVD Zornitza Stark Publications for gene: IVD were set to
Prepair 500+ v1.543 ITPR1 Zornitza Stark Marked gene: ITPR1 as ready
Prepair 500+ v1.543 ITPR1 Zornitza Stark Gene: itpr1 has been classified as Green List (High Evidence).
Prepair 500+ v1.543 ITPR1 Zornitza Stark Phenotypes for gene: ITPR1 were changed from Gillespie syndrome, 206700 (3), Autosomal recessive to Gillespie syndrome, MIM# 206700
Prepair 500+ v1.542 ITPR1 Zornitza Stark Publications for gene: ITPR1 were set to
Prepair 500+ v1.541 ITGB4 Zornitza Stark Marked gene: ITGB4 as ready
Prepair 500+ v1.541 ITGB4 Zornitza Stark Gene: itgb4 has been classified as Green List (High Evidence).
Prepair 500+ v1.541 ITGB4 Zornitza Stark Phenotypes for gene: ITGB4 were changed from Epidermolysis bullosa, junctional, with pyloric atresia, 226730 (3) to Epidermolysis bullosa, junctional 5B, with pyloric atresia, MIM#226730
Prepair 500+ v1.540 ITGB4 Zornitza Stark Publications for gene: ITGB4 were set to
Prepair 500+ v1.539 ITGA6 Zornitza Stark Marked gene: ITGA6 as ready
Prepair 500+ v1.539 ITGA6 Zornitza Stark Gene: itga6 has been classified as Green List (High Evidence).
Prepair 500+ v1.539 ITGA6 Zornitza Stark Phenotypes for gene: ITGA6 were changed from Epidermolysis bullosa, junctional, with pyloric stenosis, 226730 (3) to Epidermolysis bullosa, junctional 6, with pyloric atresia (MIM#619817)
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Marked gene: IQSEC2 as ready
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Gene: iqsec2 has been classified as Green List (High Evidence).
Prepair 500+ v1.538 IQSEC2 Zornitza Stark Publications for gene: IQSEC2 were set to
Prepair 500+ v1.537 INVS Zornitza Stark Marked gene: INVS as ready
Prepair 500+ v1.537 INVS Zornitza Stark Gene: invs has been classified as Green List (High Evidence).
Prepair 500+ v1.537 INVS Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088)
Prepair 500+ v1.536 INPP5E Zornitza Stark Marked gene: INPP5E as ready
Prepair 500+ v1.536 INPP5E Zornitza Stark Gene: inpp5e has been classified as Green List (High Evidence).
Prepair 500+ v1.536 INPP5E Zornitza Stark Phenotypes for gene: INPP5E were changed from Joubert syndrome 1, 213300 (3) to Joubert syndrome 1, MIM# 213300; MONDO:0008944
Prepair 500+ v1.535 INPP5E Zornitza Stark Publications for gene: INPP5E were set to
Prepair 500+ v1.534 IL7R Zornitza Stark Marked gene: IL7R as ready
Prepair 500+ v1.534 IL7R Zornitza Stark Gene: il7r has been classified as Green List (High Evidence).
Prepair 500+ v1.534 IL2RG Zornitza Stark Marked gene: IL2RG as ready
Prepair 500+ v1.534 IL2RG Zornitza Stark Gene: il2rg has been classified as Green List (High Evidence).
Prepair 500+ v1.534 IL2RG Zornitza Stark Phenotypes for gene: IL2RG were changed from Severe combined immunodeficiency, X-linked, 300400 (3) to Severe combined immunodeficiency, X-linked, MIM#300400
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Marked gene: IL1RAPL1 as ready
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Gene: il1rapl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.533 IL1RAPL1 Zornitza Stark Phenotypes for gene: IL1RAPL1 were changed from Mental retardation, X-linked 21/34, 300143 (3) to Intellectual developmental disorder, X-linked 21, MIM#300143
Prepair 500+ v1.532 IL1RAPL1 Zornitza Stark Publications for gene: IL1RAPL1 were set to
Prepair 500+ v1.531 IKBKB Zornitza Stark Marked gene: IKBKB as ready
Prepair 500+ v1.531 IKBKB Zornitza Stark Gene: ikbkb has been classified as Green List (High Evidence).
Prepair 500+ v1.531 IKBKB Zornitza Stark Phenotypes for gene: IKBKB were changed from Immunodeficiency 15, 615592 (3) to Immunodeficiency 15, MIM#615592
Prepair 500+ v1.530 IKBKB Zornitza Stark Publications for gene: IKBKB were set to
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Marked gene: IGHMBP2 as ready
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Gene: ighmbp2 has been classified as Green List (High Evidence).
Prepair 500+ v1.529 IGHMBP2 Zornitza Stark Phenotypes for gene: IGHMBP2 were changed from Neuronopathy, distal hereditary motor, type VI, 604320 (3) to Neuronopathy, distal hereditary motor, autosomal recessive 1 MIM#604320; Charcot-Marie-Tooth disease, axonal, type 2S MIM#616155
Prepair 500+ v1.528 IGHMBP2 Zornitza Stark Publications for gene: IGHMBP2 were set to
Prepair 500+ v1.527 IDUA Zornitza Stark Marked gene: IDUA as ready
Prepair 500+ v1.527 IDUA Zornitza Stark Gene: idua has been classified as Green List (High Evidence).
Prepair 500+ v1.527 IDUA Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih, MIM#607014
Prepair 500+ v1.526 IDS Zornitza Stark Marked gene: IDS as ready
Prepair 500+ v1.526 IDS Zornitza Stark Gene: ids has been classified as Green List (High Evidence).
Prepair 500+ v1.526 IDS Zornitza Stark Phenotypes for gene: IDS were changed from Mucopolysaccharidosis II, 309900 (3) to Mucopolysaccharidosis II, MIM# 309900; Hunter syndrome, MONDO:0010674
Prepair 500+ v1.525 IDS Zornitza Stark Publications for gene: IDS were set to
Prepair 500+ v1.524 HYLS1 Zornitza Stark Marked gene: HYLS1 as ready
Prepair 500+ v1.524 HYLS1 Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence).
Prepair 500+ v1.524 HYLS1 Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680); Ciliopathy
Prepair 500+ v1.523 HYLS1 Zornitza Stark Publications for gene: HYLS1 were set to
Prepair 500+ v1.522 HUWE1 Zornitza Stark Marked gene: HUWE1 as ready
Prepair 500+ v1.522 HUWE1 Zornitza Stark Gene: huwe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.522 HUWE1 Zornitza Stark Phenotypes for gene: HUWE1 were changed from Mental retardation, X-linked syndromic, Turner type, 300706 (3) to Intellectual developmental disorder, X-linked syndromic, Turner type, MIM#309590
Prepair 500+ v1.521 HUWE1 Zornitza Stark Publications for gene: HUWE1 were set to
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Marked gene: HSD3B2 as ready
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Gene: hsd3b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.520 HSD3B2 Zornitza Stark Phenotypes for gene: HSD3B2 were changed from 3-beta-hydroxysteroid dehydrogenase, type II, deficiency, 201810 (3) to Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency, MIM#201810
Prepair 500+ v1.519 HSD3B2 Zornitza Stark Publications for gene: HSD3B2 were set to
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Marked gene: HSD17B4 as ready
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Gene: hsd17b4 has been classified as Green List (High Evidence).
Prepair 500+ v1.518 HSD17B4 Zornitza Stark Phenotypes for gene: HSD17B4 were changed from D-bifunctional protein deficiency, 261515 (3) to D-bifunctional protein deficiency, MIM#261515
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Marked gene: HSD17B10 as ready
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Gene: hsd17b10 has been classified as Green List (High Evidence).
Prepair 500+ v1.517 HSD17B10 Zornitza Stark Phenotypes for gene: HSD17B10 were changed from HSD10 mitochondrial disease to HSD10 mitochondrial disease, MIM#300438
Prepair 500+ v1.516 HSD17B10 Zornitza Stark Publications for gene: HSD17B10 were set to
Prepair 500+ v1.515 HPS6 Zornitza Stark Marked gene: HPS6 as ready
Prepair 500+ v1.515 HPS6 Zornitza Stark Gene: hps6 has been classified as Green List (High Evidence).
Prepair 500+ v1.515 HPS6 Zornitza Stark Phenotypes for gene: HPS6 were changed from Hermansky-Pudlak syndrome 6, 614075 (3) to Hermansky-Pudlak syndrome 6, MIM# 614075
Prepair 500+ v1.514 HPS6 Zornitza Stark Publications for gene: HPS6 were set to
Prepair 500+ v1.513 HPS5 Zornitza Stark Marked gene: HPS5 as ready
Prepair 500+ v1.513 HPS5 Zornitza Stark Gene: hps5 has been classified as Green List (High Evidence).
Prepair 500+ v1.513 HPS5 Zornitza Stark Phenotypes for gene: HPS5 were changed from Hermansky-Pudlak syndrome 5, 614074 (3) to Hermansky-Pudlak syndrome 5 MIM#614074
Prepair 500+ v1.512 HPS4 Zornitza Stark Marked gene: HPS4 as ready
Prepair 500+ v1.512 HPS4 Zornitza Stark Gene: hps4 has been classified as Green List (High Evidence).
Prepair 500+ v1.512 HPS4 Zornitza Stark Phenotypes for gene: HPS4 were changed from Hermansky-Pudlak syndrome 4, 614073 (3) to Hermansky-Pudlak syndrome 4, MIM #614073
Prepair 500+ v1.511 HPS4 Zornitza Stark Publications for gene: HPS4 were set to
Prepair 500+ v1.510 HPS3 Zornitza Stark Marked gene: HPS3 as ready
Prepair 500+ v1.510 HPS3 Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence).
Prepair 500+ v1.510 HPS3 Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072
Prepair 500+ v1.509 HPS3 Zornitza Stark Publications for gene: HPS3 were set to
Prepair 500+ v1.508 HPS1 Zornitza Stark Marked gene: HPS1 as ready
Prepair 500+ v1.508 HPS1 Zornitza Stark Gene: hps1 has been classified as Green List (High Evidence).
Prepair 500+ v1.508 HPS1 Zornitza Stark Phenotypes for gene: HPS1 were changed from Hermansky-Pudlak syndrome 1, 203300 (3) to Hermansky-Pudlak syndrome 1, MIM#203300
Prepair 500+ v1.507 HPS1 Zornitza Stark Publications for gene: HPS1 were set to
Prepair 500+ v1.506 HPRT1 Zornitza Stark Marked gene: HPRT1 as ready
Prepair 500+ v1.506 HPRT1 Zornitza Stark Gene: hprt1 has been classified as Green List (High Evidence).
Prepair 500+ v1.506 HPRT1 Zornitza Stark Phenotypes for gene: HPRT1 were changed from Lesch-Nyhan syndrome, 300322 (3) to Lesch-Nyhan syndrome (MIM#300322)
Prepair 500+ v1.505 HPRT1 Zornitza Stark Publications for gene: HPRT1 were set to
Prepair 500+ v1.504 HPD Zornitza Stark Marked gene: HPD as ready
Prepair 500+ v1.504 HPD Zornitza Stark Gene: hpd has been classified as Green List (High Evidence).
Prepair 500+ v1.504 HPD Zornitza Stark Phenotypes for gene: HPD were changed from Tyrosinemia, type III, 276710 (3) to Tyrosinaemia, type III, MIM#276710
Prepair 500+ v1.503 HPD Zornitza Stark Publications for gene: HPD were set to
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Marked gene: HMGCS2 as ready
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Gene: hmgcs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.502 HMGCS2 Zornitza Stark Phenotypes for gene: HMGCS2 were changed from HMG-CoA synthase-2 deficiency, 605911 (3) to HMG-CoA synthase-2 deficiency, MIM#605911
Prepair 500+ v1.501 HMGCS2 Zornitza Stark Publications for gene: HMGCS2 were set to
Prepair 500+ v1.500 HMGCL Zornitza Stark Marked gene: HMGCL as ready
Prepair 500+ v1.500 HMGCL Zornitza Stark Gene: hmgcl has been classified as Green List (High Evidence).
Prepair 500+ v1.500 HMGCL Zornitza Stark Phenotypes for gene: HMGCL were changed from HMG-CoA lyase deficiency, 246450 (3) to HMG-CoA lyase deficiency, MIM# 246450
Prepair 500+ v1.499 HLCS Zornitza Stark Marked gene: HLCS as ready
Prepair 500+ v1.499 HLCS Zornitza Stark Gene: hlcs has been classified as Green List (High Evidence).
Prepair 500+ v1.499 HLCS Zornitza Stark Phenotypes for gene: HLCS were changed from Holocarboxylase synthetase deficiency, 253270 (3) to Holocarboxylase synthetase deficiency MIM#253270
Prepair 500+ v1.498 HIBCH Zornitza Stark Marked gene: HIBCH as ready
Prepair 500+ v1.498 HIBCH Zornitza Stark Gene: hibch has been classified as Green List (High Evidence).
Prepair 500+ v1.498 HIBCH Zornitza Stark Phenotypes for gene: HIBCH were changed from 3-hydroxyisobutryl-CoA hydrolase deficiency, 250620 (3) to 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#250620
Prepair 500+ v1.497 HIBCH Zornitza Stark Publications for gene: HIBCH were set to
Prepair 500+ v1.496 HGSNAT Zornitza Stark Marked gene: HGSNAT as ready
Prepair 500+ v1.496 HGSNAT Zornitza Stark Gene: hgsnat has been classified as Green List (High Evidence).
Prepair 500+ v1.496 HGSNAT Zornitza Stark Phenotypes for gene: HGSNAT were changed from Mucopolysaccharidosis type IIIC (Sanfilippo C), 252930 (3) to Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM#252930; Retinitis pigmentosa 73, MIM#616544
Prepair 500+ v1.495 HGSNAT Zornitza Stark Publications for gene: HGSNAT were set to
Prepair 500+ v1.494 HFE2 Zornitza Stark Marked gene: HFE2 as ready
Prepair 500+ v1.494 HFE2 Zornitza Stark Gene: hfe2 has been classified as Green List (High Evidence).
Prepair 500+ v1.494 HFE2 Zornitza Stark Phenotypes for gene: HFE2 were changed from Hemochromatosis, type 2A, 602390 (3) to Haemochromatosis, type 2A, MIM#602390
Prepair 500+ v1.493 HEXB Zornitza Stark Marked gene: HEXB as ready
Prepair 500+ v1.493 HEXB Zornitza Stark Gene: hexb has been classified as Green List (High Evidence).
Prepair 500+ v1.493 HEXB Zornitza Stark Phenotypes for gene: HEXB were changed from Sandhoff disease, infantile, juvenile, and adult forms, 268800 (3) to Sandhoff disease, infantile, juvenile, and adult forms, MIM#268800
Prepair 500+ v1.492 HEXB Zornitza Stark Publications for gene: HEXB were set to
Prepair 500+ v1.491 HEXA Zornitza Stark Marked gene: HEXA as ready
Prepair 500+ v1.491 HEXA Zornitza Stark Gene: hexa has been classified as Green List (High Evidence).
Prepair 500+ v1.491 HEXA Zornitza Stark Phenotypes for gene: HEXA were changed from Tay-Sachs disease, 272800 (3) to Tay-Sachs disease, MIM#272800
Prepair 500+ v1.490 HEXA Zornitza Stark Publications for gene: HEXA were set to
Prepair 500+ v1.489 HCFC1 Zornitza Stark Marked gene: HCFC1 as ready
Prepair 500+ v1.489 HCFC1 Zornitza Stark Gene: hcfc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.489 HCFC1 Zornitza Stark Phenotypes for gene: HCFC1 were changed from Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ), 309541 (3) to Methylmalonic aciduria and homocysteinemia, cblX type, MIM#309541
Prepair 500+ v1.488 HCFC1 Zornitza Stark Publications for gene: HCFC1 were set to
Prepair 500+ v1.487 HBB Zornitza Stark Marked gene: HBB as ready
Prepair 500+ v1.487 HBB Zornitza Stark Gene: hbb has been classified as Green List (High Evidence).
Prepair 500+ v1.487 HBB Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Sickle cell anaemia, MIM# 603903
Prepair 500+ v1.486 HAX1 Zornitza Stark Marked gene: HAX1 as ready
Prepair 500+ v1.486 HAX1 Zornitza Stark Gene: hax1 has been classified as Green List (High Evidence).
Prepair 500+ v1.486 HAX1 Zornitza Stark Phenotypes for gene: HAX1 were changed from Neutropenia, severe congenital 3, autosomal recessive, 610738 (3) to Neutropenia, severe congenital 3, autosomal recessive, MIM#610738
Prepair 500+ v1.485 HAX1 Zornitza Stark Publications for gene: HAX1 were set to
Prepair 500+ v1.484 HAMP Zornitza Stark Marked gene: HAMP as ready
Prepair 500+ v1.484 HAMP Zornitza Stark Gene: hamp has been classified as Green List (High Evidence).
Prepair 500+ v1.484 HAMP Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313
Prepair 500+ v1.483 HAMP Zornitza Stark Publications for gene: HAMP were set to
Prepair 500+ v1.482 HADHB Zornitza Stark Marked gene: HADHB as ready
Prepair 500+ v1.482 HADHB Zornitza Stark Gene: hadhb has been classified as Green List (High Evidence).
Prepair 500+ v1.482 HADHB Zornitza Stark Phenotypes for gene: HADHB were changed from Trifunctional protein deficiency, 609015 (3) to Mitochondrial trifunctional protein deficiency 2 MIM#620300
Prepair 500+ v1.481 HADHA Zornitza Stark Marked gene: HADHA as ready
Prepair 500+ v1.481 HADHA Zornitza Stark Gene: hadha has been classified as Green List (High Evidence).
Prepair 500+ v1.481 HADHA Zornitza Stark Phenotypes for gene: HADHA were changed from Fatty liver, acute, of pregnancy, 609016 (3) to LCHAD deficiency MIM#609016; Mitochondrial trifunctional protein deficiency 1 MIM#609015
Prepair 500+ v1.480 HADH Zornitza Stark Marked gene: HADH as ready
Prepair 500+ v1.480 HADH Zornitza Stark Gene: hadh has been classified as Green List (High Evidence).
Prepair 500+ v1.480 HADH Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530
Prepair 500+ v1.479 HADH Zornitza Stark Publications for gene: HADH were set to
Prepair 500+ v1.478 GUSB Zornitza Stark Marked gene: GUSB as ready
Prepair 500+ v1.478 GUSB Zornitza Stark Gene: gusb has been classified as Green List (High Evidence).
Prepair 500+ v1.478 GUSB Zornitza Stark Phenotypes for gene: GUSB were changed from Mucopolysaccharidosis VII, 253220 (3) to Mucopolysaccharidosis VII, MIM# 253220
Prepair 500+ v1.477 GUSB Zornitza Stark Publications for gene: GUSB were set to
Prepair 500+ v1.476 GUCY2D Zornitza Stark Marked gene: GUCY2D as ready
Prepair 500+ v1.476 GUCY2D Zornitza Stark Gene: gucy2d has been classified as Green List (High Evidence).
Prepair 500+ v1.476 GUCY2D Zornitza Stark Phenotypes for gene: GUCY2D were changed from Leber congenital amaurosis 1, 204000 (3) to Leber congenital amaurosis 1, MIM #204000
Prepair 500+ v1.475 GUCY2D Zornitza Stark Publications for gene: GUCY2D were set to
Prepair 500+ v1.474 GSS Zornitza Stark Marked gene: GSS as ready
Prepair 500+ v1.474 GSS Zornitza Stark Gene: gss has been classified as Green List (High Evidence).
Prepair 500+ v1.474 GSS Zornitza Stark Phenotypes for gene: GSS were changed from Glutathione synthetase deficiency, 266130 (3) to Glutathione synthetase deficiency MIM#266130
Prepair 500+ v1.473 GPSM2 Zornitza Stark Marked gene: GPSM2 as ready
Prepair 500+ v1.473 GPSM2 Zornitza Stark Gene: gpsm2 has been classified as Green List (High Evidence).
Prepair 500+ v1.473 GPSM2 Zornitza Stark Phenotypes for gene: GPSM2 were changed from Chudley-McCullough syndrome, 604213 (3) to Chudley-McCullough syndrome MIM#604213
Prepair 500+ v1.472 GPSM2 Zornitza Stark Publications for gene: GPSM2 were set to
Prepair 500+ v1.471 GPR143 Zornitza Stark Marked gene: GPR143 as ready
Prepair 500+ v1.471 GPR143 Zornitza Stark Gene: gpr143 has been classified as Green List (High Evidence).
Prepair 500+ v1.471 GPR143 Zornitza Stark Phenotypes for gene: GPR143 were changed from Ocular albinism, type I, Nettleship-Falls type, 300500 (3) to Nystagmus 6, congenital, X-linked, MIM#300814; Ocular albinism, type I, Nettleship-Falls type, MIM#300500
Prepair 500+ v1.470 GPR143 Zornitza Stark Publications for gene: GPR143 were set to
Prepair 500+ v1.469 GPC3 Zornitza Stark Marked gene: GPC3 as ready
Prepair 500+ v1.469 GPC3 Zornitza Stark Gene: gpc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.469 GPC3 Zornitza Stark Phenotypes for gene: GPC3 were changed from Simpson-Golabi-Behmel syndrome, type 1, 312870 (3) to Simpson-Golabi-Behmel syndrome, type 1, MIM #312870
Prepair 500+ v1.468 GPC3 Zornitza Stark Publications for gene: GPC3 were set to
Prepair 500+ v1.467 GORAB Zornitza Stark Marked gene: GORAB as ready
Prepair 500+ v1.467 GORAB Zornitza Stark Gene: gorab has been classified as Green List (High Evidence).
Prepair 500+ v1.467 GORAB Zornitza Stark Phenotypes for gene: GORAB were changed from Geroderma osteodysplasticum, 231070 (3) to Geroderma osteodysplasticum, MIM#231070; MONDO:0009271
Prepair 500+ v1.466 GORAB Zornitza Stark Publications for gene: GORAB were set to
Prepair 500+ v1.465 GNS Zornitza Stark Marked gene: GNS as ready
Prepair 500+ v1.465 GNS Zornitza Stark Gene: gns has been classified as Green List (High Evidence).
Prepair 500+ v1.465 GNS Zornitza Stark Phenotypes for gene: GNS were changed from Mucopolysaccharidosis type IIID, 252940 (3) to Mucopolysaccharidosis type IIID, MIM# 252940; Sanfilippo syndrome type D, MONDO:0009658
Prepair 500+ v1.464 GNS Zornitza Stark Publications for gene: GNS were set to
Prepair 500+ v1.463 GNPTG Zornitza Stark Marked gene: GNPTG as ready
Prepair 500+ v1.463 GNPTG Zornitza Stark Gene: gnptg has been classified as Green List (High Evidence).
Prepair 500+ v1.463 GNPTG Zornitza Stark Phenotypes for gene: GNPTG were changed from Mucolipidosis III gamma, 252605 (3) to Mucolipidosis III gamma, MIM# 252605
Prepair 500+ v1.462 GNPTG Zornitza Stark Publications for gene: GNPTG were set to
Prepair 500+ v1.461 GNPTAB Zornitza Stark Marked gene: GNPTAB as ready
Prepair 500+ v1.461 GNPTAB Zornitza Stark Gene: gnptab has been classified as Green List (High Evidence).
Prepair 500+ v1.461 GNPTAB Zornitza Stark Phenotypes for gene: GNPTAB were changed from Mucolipidosis III alpha/beta, 252600 (3) to Mucolipidosis III alpha/beta MIM#252600; Mucolipidosis II alpha/beta MIM#252500
Prepair 500+ v1.460 GNPAT Zornitza Stark Marked gene: GNPAT as ready
Prepair 500+ v1.460 GNPAT Zornitza Stark Gene: gnpat has been classified as Green List (High Evidence).
Prepair 500+ v1.460 GNPAT Zornitza Stark Phenotypes for gene: GNPAT were changed from Chondrodysplasia punctata, rhizomelic, type 2, 222765 (3) to Rhizomelic chondrodysplasia punctata, type 2 (MIM# 222765)
Prepair 500+ v1.459 GNPAT Zornitza Stark Publications for gene: GNPAT were set to
Prepair 500+ v1.458 GNB5 Zornitza Stark Marked gene: GNB5 as ready
Prepair 500+ v1.458 GNB5 Zornitza Stark Gene: gnb5 has been classified as Green List (High Evidence).
Prepair 500+ v1.458 GNB5 Zornitza Stark Phenotypes for gene: GNB5 were changed from Intellectual developmental disorder with cardiac arrhythmia, 617173 (3), Autosomal recessive to Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173); Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)
Prepair 500+ v1.457 GNB5 Zornitza Stark Publications for gene: GNB5 were set to
Prepair 500+ v1.456 GLE1 Zornitza Stark Marked gene: GLE1 as ready
Prepair 500+ v1.456 GLE1 Zornitza Stark Gene: gle1 has been classified as Green List (High Evidence).
Prepair 500+ v1.456 GLE1 Zornitza Stark Phenotypes for gene: GLE1 were changed from Arthrogryposis, lethal, with anterior horn cell disease, 611890 (3) to Congenital arthrogryposis with anterior horn cell disease, MIM #611890; Lethal congenital contracture syndrome 1, MIM #253310
Prepair 500+ v1.455 GLE1 Zornitza Stark Publications for gene: GLE1 were set to
Prepair 500+ v1.454 GLDC Zornitza Stark Marked gene: GLDC as ready
Prepair 500+ v1.454 GLDC Zornitza Stark Gene: gldc has been classified as Green List (High Evidence).
Prepair 500+ v1.454 GLDC Zornitza Stark Phenotypes for gene: GLDC were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy1 (MIM#605899)
Prepair 500+ v1.453 GLDC Zornitza Stark Publications for gene: GLDC were set to
Prepair 500+ v1.452 GLB1 Zornitza Stark Marked gene: GLB1 as ready
Prepair 500+ v1.452 GLB1 Zornitza Stark Gene: glb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.452 GLB1 Zornitza Stark Phenotypes for gene: GLB1 were changed from Mucopolysaccharidosis type IVB (Morquio), 253010 (3) to GM1-gangliosidosis, type I MIM#230500; GM1-gangliosidosis, type II MIM#230600; GM1-gangliosidosis, type III MIM#230650; Mucopolysaccharidosis type IVB (Morquio) MIM#253010
Prepair 500+ v1.451 GLB1 Zornitza Stark Publications for gene: GLB1 were set to
Prepair 500+ v1.450 GLA Zornitza Stark Marked gene: GLA as ready
Prepair 500+ v1.450 GLA Zornitza Stark Gene: gla has been classified as Green List (High Evidence).
Prepair 500+ v1.450 GLA Zornitza Stark Publications for gene: GLA were set to 29649853; 20301469
Prepair 500+ v1.449 GJB1 Zornitza Stark Marked gene: GJB1 as ready
Prepair 500+ v1.449 GJB1 Zornitza Stark Gene: gjb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.449 GJB1 Zornitza Stark Phenotypes for gene: GJB1 were changed from Charcot-Marie-Tooth neuropathy, X-linked dominant, 1 (MIM#302800) to Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM#302800
Prepair 500+ v1.448 GJB1 Zornitza Stark Publications for gene: GJB1 were set to
Prepair 500+ v1.447 GHR Zornitza Stark Marked gene: GHR as ready
Prepair 500+ v1.447 GHR Zornitza Stark Gene: ghr has been classified as Green List (High Evidence).
Prepair 500+ v1.447 GHR Zornitza Stark Phenotypes for gene: GHR were changed from Laron dwarfism, 262500 (3) to Laron dwarfism, MIM#262500
Prepair 500+ v1.446 GHR Zornitza Stark Publications for gene: GHR were set to
Prepair 500+ v1.445 GFM1 Zornitza Stark Marked gene: GFM1 as ready
Prepair 500+ v1.445 GFM1 Zornitza Stark Gene: gfm1 has been classified as Green List (High Evidence).
Prepair 500+ v1.445 GFM1 Zornitza Stark Phenotypes for gene: GFM1 were changed from Combined oxidative phosphorylation deficiency 1, 609060 (3) to Combined oxidative phosphorylation deficiency 1, MIM#609060
Prepair 500+ v1.444 GDF5 Zornitza Stark Marked gene: GDF5 as ready
Prepair 500+ v1.444 GDF5 Zornitza Stark Gene: gdf5 has been classified as Green List (High Evidence).
Prepair 500+ v1.444 GDF5 Zornitza Stark Phenotypes for gene: GDF5 were changed from Chondrodysplasia, Grebe type, 200700 (3) to Acromesomelic dysplasia 2A MIM#200700; Acromesomelic dysplasia 2B MIM#228900
Prepair 500+ v1.443 GDF5 Zornitza Stark Publications for gene: GDF5 were set to
Prepair 500+ v1.442 GDF1 Zornitza Stark Marked gene: GDF1 as ready
Prepair 500+ v1.442 GDF1 Zornitza Stark Gene: gdf1 has been classified as Green List (High Evidence).
Prepair 500+ v1.442 GDF1 Zornitza Stark Phenotypes for gene: GDF1 were changed from Right atrial isomerism, 208530 (3) to Right atrial isomerism (Ivemark), MIM #208530
Prepair 500+ v1.441 GDF1 Zornitza Stark Publications for gene: GDF1 were set to
Prepair 500+ v1.440 GDAP1 Zornitza Stark Marked gene: GDAP1 as ready
Prepair 500+ v1.440 GDAP1 Zornitza Stark Gene: gdap1 has been classified as Green List (High Evidence).
Prepair 500+ v1.440 GDAP1 Zornitza Stark Phenotypes for gene: GDAP1 were changed from Charcot-Marie-Tooth disease, recessive intermediate, A, 608340 (3) to Charcot-Marie-Tooth disease, axonal, type 2K, MIM #607831; Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM #607706; Charcot-Marie-Tooth disease, recessive intermediate, A, MIM #608340; Charcot-Marie-Tooth disease, type 4A, MIM#214400
Prepair 500+ v1.439 GDAP1 Zornitza Stark Publications for gene: GDAP1 were set to
Prepair 500+ v1.438 GCH1 Zornitza Stark Marked gene: GCH1 as ready
Prepair 500+ v1.438 GCH1 Zornitza Stark Gene: gch1 has been classified as Green List (High Evidence).
Prepair 500+ v1.438 GCH1 Zornitza Stark Phenotypes for gene: GCH1 were changed from Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, 128230 (3) to Dystonia, DOPA-responsive, with or without hyperphenylalaninaemia, MIM#128230
Prepair 500+ v1.437 GCH1 Zornitza Stark Publications for gene: GCH1 were set to
Prepair 500+ v1.436 GCDH Zornitza Stark Marked gene: GCDH as ready
Prepair 500+ v1.436 GCDH Zornitza Stark Gene: gcdh has been classified as Green List (High Evidence).
Prepair 500+ v1.436 GCDH Zornitza Stark Phenotypes for gene: GCDH were changed from Glutaricaciduria, type I, 231670 (3) to Glutaric aciduria, type I, MIM#231670
Prepair 500+ v1.435 GCDH Zornitza Stark Publications for gene: GCDH were set to
Prepair 500+ v1.434 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Prepair 500+ v1.434 GBE1 Zornitza Stark Gene: gbe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.434 GBE1 Zornitza Stark Phenotypes for gene: GBE1 were changed from Glycogen storage disease IV, 232500 (3) to Glycogen storage disease IV, MIM#232500
Prepair 500+ v1.433 GATM Zornitza Stark Marked gene: GATM as ready
Prepair 500+ v1.433 GATM Zornitza Stark Gene: gatm has been classified as Green List (High Evidence).
Prepair 500+ v1.433 GATM Zornitza Stark Phenotypes for gene: GATM were changed from Cerebral creatine deficiency syndrome 3, 612718 (3) to Cerebral creatine deficiency syndrome 3 MIM#612718; AGAT deficiency MONDO:0012996
Prepair 500+ v1.432 GATM Zornitza Stark Publications for gene: GATM were set to
Prepair 500+ v1.431 GAMT Zornitza Stark Marked gene: GAMT as ready
Prepair 500+ v1.431 GAMT Zornitza Stark Gene: gamt has been classified as Green List (High Evidence).
Prepair 500+ v1.431 GAMT Zornitza Stark Phenotypes for gene: GAMT were changed from Cerebral creatine deficiency syndrome 2, 612736 (3) to Cerebral creatine deficiency syndrome 2 (MIM#612736)
Prepair 500+ v1.430 GAMT Zornitza Stark Publications for gene: GAMT were set to
Prepair 500+ v1.429 GALT Zornitza Stark Marked gene: GALT as ready
Prepair 500+ v1.429 GALT Zornitza Stark Gene: galt has been classified as Green List (High Evidence).
Prepair 500+ v1.429 GALT Zornitza Stark Phenotypes for gene: GALT were changed from Galactosemia, 230400 (3) to Galactosaemia MIM# 230400
Prepair 500+ v1.428 GALNS Zornitza Stark Marked gene: GALNS as ready
Prepair 500+ v1.428 GALNS Zornitza Stark Gene: galns has been classified as Green List (High Evidence).
Prepair 500+ v1.428 GALNS Zornitza Stark Phenotypes for gene: GALNS were changed from Mucopolysaccharidosis IVA, 253000 (3) to Mucopolysaccharidosis IVA, MIM#253000
Prepair 500+ v1.427 GALNS Zornitza Stark Publications for gene: GALNS were set to
Prepair 500+ v1.426 GALC Zornitza Stark Marked gene: GALC as ready
Prepair 500+ v1.426 GALC Zornitza Stark Gene: galc has been classified as Green List (High Evidence).
Prepair 500+ v1.426 GALC Zornitza Stark Phenotypes for gene: GALC were changed from Krabbe disease, 245200 (3) to Krabbe disease, MIM# 245200; MONDO:0009499
Prepair 500+ v1.425 GALC Zornitza Stark Publications for gene: GALC were set to
Prepair 500+ v1.424 GAA Zornitza Stark Marked gene: GAA as ready
Prepair 500+ v1.424 GAA Zornitza Stark Gene: gaa has been classified as Green List (High Evidence).
Prepair 500+ v1.424 GAA Zornitza Stark Phenotypes for gene: GAA were changed from Glycogen storage disease II, 232300 (3) to Glycogen storage disease II, MIM#232300
Prepair 500+ v1.423 GAA Zornitza Stark Publications for gene: GAA were set to
Prepair 500+ v1.422 G6PC3 Zornitza Stark Marked gene: G6PC3 as ready
Prepair 500+ v1.422 G6PC3 Zornitza Stark Gene: g6pc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.422 G6PC3 Zornitza Stark Phenotypes for gene: G6PC3 were changed from Dursun syndrome, 612541 (3) to Dursun syndrome, MIM# 612541; Neutropenia, severe congenital 4, autosomal recessive, MIM# 612541
Prepair 500+ v1.421 G6PC Zornitza Stark Marked gene: G6PC as ready
Prepair 500+ v1.421 G6PC Zornitza Stark Gene: g6pc has been classified as Green List (High Evidence).
Prepair 500+ v1.421 G6PC Zornitza Stark Phenotypes for gene: G6PC were changed from Glycogen storage disease Ia, 232200 (3) to Glycogen storage disease Ia (MIM# 232200)
Prepair 500+ v1.420 FUCA1 Zornitza Stark Marked gene: FUCA1 as ready
Prepair 500+ v1.420 FUCA1 Zornitza Stark Gene: fuca1 has been classified as Green List (High Evidence).
Prepair 500+ v1.420 FUCA1 Zornitza Stark Phenotypes for gene: FUCA1 were changed from Fucosidosis, 230000 (3) to Fucosidosis, MIM# 230000
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Marked gene: FTSJ1 as ready
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence).
Prepair 500+ v1.419 FTSJ1 Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549
Prepair 500+ v1.418 FTSJ1 Zornitza Stark Publications for gene: FTSJ1 were set to
Prepair 500+ v1.417 FREM2 Zornitza Stark Marked gene: FREM2 as ready
Prepair 500+ v1.417 FREM2 Zornitza Stark Gene: frem2 has been classified as Green List (High Evidence).
Prepair 500+ v1.417 FREM2 Zornitza Stark Phenotypes for gene: FREM2 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome, MIM#219000
Prepair 500+ v1.416 FREM2 Zornitza Stark Publications for gene: FREM2 were set to
Prepair 500+ v1.415 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Prepair 500+ v1.415 FRAS1 Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence).
Prepair 500+ v1.415 FRAS1 Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000
Prepair 500+ v1.414 FRAS1 Zornitza Stark Publications for gene: FRAS1 were set to
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Marked gene: FOXRED1 as ready
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Gene: foxred1 has been classified as Green List (High Evidence).
Prepair 500+ v1.413 FOXRED1 Zornitza Stark Phenotypes for gene: FOXRED1 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 19, MIM# 618241
Prepair 500+ v1.412 FOXRED1 Zornitza Stark Publications for gene: FOXRED1 were set to
Prepair 500+ v1.411 FOXN1 Zornitza Stark Marked gene: FOXN1 as ready
Prepair 500+ v1.411 FOXN1 Zornitza Stark Gene: foxn1 has been classified as Green List (High Evidence).
Prepair 500+ v1.411 FOXN1 Zornitza Stark Phenotypes for gene: FOXN1 were changed from T-cell immunodeficiency, congenital alopecia, and nail dystrophy, 601705 (3) to T-cell immunodeficiency, congenital alopecia, and nail dystrophy MIM#601705
Prepair 500+ v1.410 FOXN1 Zornitza Stark Publications for gene: FOXN1 were set to
Prepair 500+ v1.409 FMR1 Zornitza Stark Marked gene: FMR1 as ready
Prepair 500+ v1.409 FMR1 Zornitza Stark Gene: fmr1 has been classified as Green List (High Evidence).
Prepair 500+ v1.409 FMR1 Zornitza Stark Phenotypes for gene: FMR1 were changed from Fragile X syndrome to Fragile X syndrome, MIM #300624
Prepair 500+ v1.408 FMR1 Zornitza Stark Publications for gene: FMR1 were set to
Prepair 500+ v1.407 FLNA Zornitza Stark Marked gene: FLNA as ready
Prepair 500+ v1.407 FLNA Zornitza Stark Gene: flna has been classified as Green List (High Evidence).
Prepair 500+ v1.407 FLNA Zornitza Stark Phenotypes for gene: FLNA were changed from FG syndrome 2, 300321 (3) to Frontometaphyseal dysplasia 1, MIM#305620; Heterotopia, periventricular, 1, MIM#300049; Intestinal pseudoobstruction, neuronal, MIM#300048; Melnick-Needles syndrome, MIM#309350; Otopalatodigital syndrome, type I, MIM#311300; Otopalatodigital syndrome, type II, MIM#304120; Terminal osseous dysplasia, MIM#300244
Prepair 500+ v1.406 FLNA Zornitza Stark Publications for gene: FLNA were set to
Prepair 500+ v1.405 FKTN Zornitza Stark Marked gene: FKTN as ready
Prepair 500+ v1.405 FKTN Zornitza Stark Gene: fktn has been classified as Green List (High Evidence).
Prepair 500+ v1.405 FKTN Zornitza Stark Phenotypes for gene: FKTN were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4, 253800 (3) to Muscular dystrophy-dystroglycanopathy MONDO:0018276
Prepair 500+ v1.404 FKTN Zornitza Stark Publications for gene: FKTN were set to
Prepair 500+ v1.403 FKRP Zornitza Stark Marked gene: FKRP as ready
Prepair 500+ v1.403 FKRP Zornitza Stark Gene: fkrp has been classified as Green List (High Evidence).
Prepair 500+ v1.403 FKRP Zornitza Stark Phenotypes for gene: FKRP were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5, 613153 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 (MIM#613153); Muscular dystrophy-dystroglycanopathy (congenital with or without intellectual development), type B, 5 (MIM#606612); Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 (MIM#607155)
Prepair 500+ v1.402 FKRP Zornitza Stark Publications for gene: FKRP were set to
Prepair 500+ v1.401 FKBP10 Zornitza Stark Marked gene: FKBP10 as ready
Prepair 500+ v1.401 FKBP10 Zornitza Stark Gene: fkbp10 has been classified as Green List (High Evidence).
Prepair 500+ v1.401 FKBP10 Zornitza Stark Phenotypes for gene: FKBP10 were changed from Bruck syndrome 1, 259450 (3) to Bruck syndrome 1, MIM#259450; osteogenesis imperfecta, type XI, MIM#610968
Prepair 500+ v1.400 FKBP10 Zornitza Stark Publications for gene: FKBP10 were set to
Prepair 500+ v1.399 FHL1 Zornitza Stark Marked gene: FHL1 as ready
Prepair 500+ v1.399 FHL1 Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence).
Prepair 500+ v1.399 FHL1 Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680
Prepair 500+ v1.398 FHL1 Zornitza Stark Publications for gene: FHL1 were set to
Prepair 500+ v1.397 FH Zornitza Stark Marked gene: FH as ready
Prepair 500+ v1.397 FH Zornitza Stark Gene: fh has been classified as Green List (High Evidence).
Prepair 500+ v1.397 FH Zornitza Stark Phenotypes for gene: FH were changed from Fumarase deficiency, 606812 (3) to Fumarase deficiency, MIM# 606812
Prepair 500+ v1.396 FH Zornitza Stark Publications for gene: FH were set to
Prepair 500+ v1.395 FBXO7 Zornitza Stark Marked gene: FBXO7 as ready
Prepair 500+ v1.395 FBXO7 Zornitza Stark Gene: fbxo7 has been classified as Green List (High Evidence).
Prepair 500+ v1.395 FBXO7 Zornitza Stark Phenotypes for gene: FBXO7 were changed from Parkinson disease 15, autosomal recessive, 260300 (3) to Parkinson disease 15, autosomal recessive, MIM#260300
Prepair 500+ v1.394 FBXO7 Zornitza Stark Publications for gene: FBXO7 were set to
Prepair 500+ v1.393 FBP1 Zornitza Stark Marked gene: FBP1 as ready
Prepair 500+ v1.393 FBP1 Zornitza Stark Gene: fbp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.393 FBP1 Zornitza Stark Phenotypes for gene: FBP1 were changed from Fructose-1,6-bisphosphatase deficiency, 229700 (3) to Fructose-1,6-bisphosphatase deficiency, MIM#229700
Prepair 500+ v1.392 FAT4 Zornitza Stark Marked gene: FAT4 as ready
Prepair 500+ v1.392 FAT4 Zornitza Stark Gene: fat4 has been classified as Green List (High Evidence).
Prepair 500+ v1.392 FAT4 Zornitza Stark Phenotypes for gene: FAT4 were changed from Hennekam lymphangiectasia-lymphedema syndrome 2, 616006 (3) to Hennekam lymphangiectasia-lymphedema syndrome 2 MIM#616006; Van Maldergem syndrome 2 MIM#615546
Prepair 500+ v1.391 FAT4 Zornitza Stark Publications for gene: FAT4 were set to
Prepair 500+ v1.390 FANCL Zornitza Stark Marked gene: FANCL as ready
Prepair 500+ v1.390 FANCL Zornitza Stark Gene: fancl has been classified as Green List (High Evidence).
Prepair 500+ v1.390 FANCL Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083
Prepair 500+ v1.389 FANCL Zornitza Stark Publications for gene: FANCL were set to
Prepair 500+ v1.388 FANCI Zornitza Stark Marked gene: FANCI as ready
Prepair 500+ v1.388 FANCI Zornitza Stark Gene: fanci has been classified as Green List (High Evidence).
Prepair 500+ v1.388 FANCI Zornitza Stark Phenotypes for gene: FANCI were changed from Fanconi anemia, complementation group I, 609053 (3) to Fanconi anaemia, complementation group I, MIM#609053
Prepair 500+ v1.387 FANCI Zornitza Stark Publications for gene: FANCI were set to
Prepair 500+ v1.386 FANCG Zornitza Stark Marked gene: FANCG as ready
Prepair 500+ v1.386 FANCG Zornitza Stark Gene: fancg has been classified as Green List (High Evidence).
Prepair 500+ v1.386 FANCG Zornitza Stark Phenotypes for gene: FANCG were changed from Fanconi anemia, complementation group G, 614082 (3) to Fanconi anaemia, complementation group G, MIM#614082
Prepair 500+ v1.385 FANCG Zornitza Stark Publications for gene: FANCG were set to
Prepair 500+ v1.384 FANCF Zornitza Stark Marked gene: FANCF as ready
Prepair 500+ v1.384 FANCF Zornitza Stark Gene: fancf has been classified as Green List (High Evidence).
Prepair 500+ v1.384 FANCF Zornitza Stark Phenotypes for gene: FANCF were changed from Fanconi anemia, complementation group F, 603467 (3) to Fanconi anaemia, complementation group F, MIM#603467
Prepair 500+ v1.383 FANCF Zornitza Stark Publications for gene: FANCF were set to
Prepair 500+ v1.382 FANCE Zornitza Stark Marked gene: FANCE as ready
Prepair 500+ v1.382 FANCE Zornitza Stark Gene: fance has been classified as Green List (High Evidence).
Prepair 500+ v1.382 FANCE Zornitza Stark Phenotypes for gene: FANCE were changed from Fanconi anemia, complementation group E, 600901 (3) to Fanconi anaemia, complementation group E, MIM#600901
Prepair 500+ v1.381 FANCE Zornitza Stark Publications for gene: FANCE were set to
Prepair 500+ v1.380 FANCD2 Zornitza Stark Marked gene: FANCD2 as ready
Prepair 500+ v1.380 FANCD2 Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence).
Prepair 500+ v1.380 FANCD2 Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2, MIM#227646
Prepair 500+ v1.379 FANCD2 Zornitza Stark Publications for gene: FANCD2 were set to
Prepair 500+ v1.378 FANCC Zornitza Stark Marked gene: FANCC as ready
Prepair 500+ v1.378 FANCC Zornitza Stark Gene: fancc has been classified as Green List (High Evidence).
Prepair 500+ v1.378 FANCC Zornitza Stark Phenotypes for gene: FANCC were changed from Fanconi anemia, complementation group C, 227645 (3) to Fanconi anaemia, complementation group C, MIM#227645
Prepair 500+ v1.377 FANCC Zornitza Stark Publications for gene: FANCC were set to
Prepair 500+ v1.376 FANCB Zornitza Stark Marked gene: FANCB as ready
Prepair 500+ v1.376 FANCB Zornitza Stark Gene: fancb has been classified as Green List (High Evidence).
Prepair 500+ v1.376 FANCB Zornitza Stark Phenotypes for gene: FANCB were changed from Fanconi anemia, complementation group B, 300514 (3) to Fanconi anaemia, complementation group B, MIM#300514
Prepair 500+ v1.375 FANCA Zornitza Stark Marked gene: FANCA as ready
Prepair 500+ v1.375 FANCA Zornitza Stark Gene: fanca has been classified as Green List (High Evidence).
Prepair 500+ v1.375 FANCA Zornitza Stark Phenotypes for gene: FANCA were changed from Fanconi anemia, complementation group A, 227650 (3) to Fanconi anaemia, complementation group A, MIM# 227650; MONDO:0009215
Prepair 500+ v1.374 FAM126A Zornitza Stark Marked gene: FAM126A as ready
Prepair 500+ v1.374 FAM126A Zornitza Stark Gene: fam126a has been classified as Green List (High Evidence).
Prepair 500+ v1.374 FAM126A Zornitza Stark Phenotypes for gene: FAM126A were changed from Leukodystrophy, hypomyelinating, 5, 610532 (3) to Leukodystrophy, hypomyelinating, 5 MIM#610532
Prepair 500+ v1.373 FAM126A Zornitza Stark Publications for gene: FAM126A were set to
Prepair 500+ v1.372 FAH Zornitza Stark Marked gene: FAH as ready
Prepair 500+ v1.372 FAH Zornitza Stark Gene: fah has been classified as Green List (High Evidence).
Prepair 500+ v1.372 FAH Zornitza Stark Phenotypes for gene: FAH were changed from Tyrosinemia, type I, 276700 (3) to Tyrosinaemia, type I, MIM# 276700
Prepair 500+ v1.371 FAH Zornitza Stark Publications for gene: FAH were set to
Prepair 500+ v1.370 F2 Zornitza Stark Marked gene: F2 as ready
Prepair 500+ v1.370 F2 Zornitza Stark Gene: f2 has been classified as Green List (High Evidence).
Prepair 500+ v1.370 F2 Zornitza Stark Phenotypes for gene: F2 were changed from Hypoprothrombinaemia (MIM#613679); Dysprothrombinaemia, 613679 to Hypoprothrombinaemia (MIM#613679)
Prepair 500+ v1.369 F2 Zornitza Stark Publications for gene: F2 were set to
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Marked gene: EXOSC8 as ready
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Gene: exosc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.368 EXOSC8 Zornitza Stark Phenotypes for gene: EXOSC8 were changed from Pontocerebellar hypoplasia, type 1C, 616081 (3) to Pontocerebellar hypoplasia, type 1C, MIM#616081
Prepair 500+ v1.367 EXOSC8 Zornitza Stark Publications for gene: EXOSC8 were set to
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Marked gene: EXOSC3 as ready
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Gene: exosc3 has been classified as Green List (High Evidence).
Prepair 500+ v1.366 EXOSC3 Zornitza Stark Phenotypes for gene: EXOSC3 were changed from Pontocerebellar hypoplasia, type 1B, 614678 (3) to Pontocerebellar hypoplasia, type 1B, MIM# 614678
Prepair 500+ v1.365 EXOSC3 Zornitza Stark Publications for gene: EXOSC3 were set to
Prepair 500+ v1.364 EVC2 Zornitza Stark Marked gene: EVC2 as ready
Prepair 500+ v1.364 EVC2 Zornitza Stark Gene: evc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.364 EVC2 Zornitza Stark Phenotypes for gene: EVC2 were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome MIM#225500
Prepair 500+ v1.363 EVC2 Zornitza Stark Publications for gene: EVC2 were set to
Prepair 500+ v1.362 EVC Zornitza Stark Marked gene: EVC as ready
Prepair 500+ v1.362 EVC Zornitza Stark Gene: evc has been classified as Green List (High Evidence).
Prepair 500+ v1.362 EVC Zornitza Stark Phenotypes for gene: EVC were changed from Ellis-van Creveld syndrome, 225500 (3) to Ellis-van Creveld syndrome, MIM# 225500
Prepair 500+ v1.361 EVC Zornitza Stark Publications for gene: EVC were set to
Prepair 500+ v1.360 ETHE1 Zornitza Stark Marked gene: ETHE1 as ready
Prepair 500+ v1.360 ETHE1 Zornitza Stark Gene: ethe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.360 ETHE1 Zornitza Stark Phenotypes for gene: ETHE1 were changed from Ethylmalonic encephalopathy, 602473 (3) to Ethylmalonic encephalopathy, MIM#602473
Prepair 500+ v1.359 ETHE1 Zornitza Stark Publications for gene: ETHE1 were set to
Prepair 500+ v1.358 ETFDH Zornitza Stark Marked gene: ETFDH as ready
Prepair 500+ v1.358 ETFDH Zornitza Stark Gene: etfdh has been classified as Green List (High Evidence).
Prepair 500+ v1.358 ETFDH Zornitza Stark Phenotypes for gene: ETFDH were changed from Glutaric acidemia IIC, 231680 (3) to Glutaric acidemia IIC, MIM# 231680
Prepair 500+ v1.357 ETFDH Zornitza Stark Publications for gene: ETFDH were set to
Prepair 500+ v1.356 ETFB Zornitza Stark Marked gene: ETFB as ready
Prepair 500+ v1.356 ETFB Zornitza Stark Gene: etfb has been classified as Green List (High Evidence).
Prepair 500+ v1.356 ETFB Zornitza Stark Phenotypes for gene: ETFB were changed from Glutaric acidemia IIB, 231680 (3) to Glutaric acidemia IIB, MIM# 231680
Prepair 500+ v1.355 ETFB Zornitza Stark Publications for gene: ETFB were set to
Prepair 500+ v1.354 ETFA Zornitza Stark Marked gene: ETFA as ready
Prepair 500+ v1.354 ETFA Zornitza Stark Gene: etfa has been classified as Green List (High Evidence).
Prepair 500+ v1.354 ETFA Zornitza Stark Phenotypes for gene: ETFA were changed from Glutaric acidemia IIA, 231680 (3) to Glutaric acidemia IIA, MIM# 231680
Prepair 500+ v1.353 ETFA Zornitza Stark Publications for gene: ETFA were set to
Prepair 500+ v1.352 ESCO2 Zornitza Stark Marked gene: ESCO2 as ready
Prepair 500+ v1.352 ESCO2 Zornitza Stark Gene: esco2 has been classified as Green List (High Evidence).
Prepair 500+ v1.352 ESCO2 Zornitza Stark Phenotypes for gene: ESCO2 were changed from SC phocomelia syndrome, 269000 (3) to Roberts-SC phocomelia syndrome (MIM#268300)
Prepair 500+ v1.351 ESCO2 Zornitza Stark Publications for gene: ESCO2 were set to
Prepair 500+ v1.350 ERCC8 Zornitza Stark Marked gene: ERCC8 as ready
Prepair 500+ v1.350 ERCC8 Zornitza Stark Gene: ercc8 has been classified as Green List (High Evidence).
Prepair 500+ v1.350 ERCC8 Zornitza Stark Phenotypes for gene: ERCC8 were changed from Cockayne syndrome, type A, 216400 (3) to Cockayne syndrome, type A, MIM#216400
Prepair 500+ v1.349 ERCC6 Zornitza Stark Marked gene: ERCC6 as ready
Prepair 500+ v1.349 ERCC6 Zornitza Stark Gene: ercc6 has been classified as Green List (High Evidence).
Prepair 500+ v1.349 ERCC6 Zornitza Stark Phenotypes for gene: ERCC6 were changed from Cockayne syndrome, type B, 133540 (3) to Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506
Prepair 500+ v1.348 ERCC6 Zornitza Stark Publications for gene: ERCC6 were set to
Prepair 500+ v1.347 ERCC5 Zornitza Stark Marked gene: ERCC5 as ready
Prepair 500+ v1.347 ERCC5 Zornitza Stark Gene: ercc5 has been classified as Green List (High Evidence).
Prepair 500+ v1.347 ERCC5 Zornitza Stark Phenotypes for gene: ERCC5 were changed from Xeroderma pigmentosum, group G, 278780 (3) to Cerebrooculofacioskeletal syndrome 3, MIM# 616570; MONDO:0014696; Xeroderma pigmentosum, group G, MIM# 278780; MONDO:0010216
Prepair 500+ v1.346 ERCC5 Zornitza Stark Publications for gene: ERCC5 were set to
Prepair 500+ v1.345 ERCC4 Zornitza Stark Marked gene: ERCC4 as ready
Prepair 500+ v1.345 ERCC4 Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence).
Prepair 500+ v1.345 ERCC4 Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590
Prepair 500+ v1.344 ERCC2 Zornitza Stark Marked gene: ERCC2 as ready
Prepair 500+ v1.344 ERCC2 Zornitza Stark Gene: ercc2 has been classified as Green List (High Evidence).
Prepair 500+ v1.344 ERCC2 Zornitza Stark Phenotypes for gene: ERCC2 were changed from Cerebrooculofacioskeletal syndrome 2, 610756 (3) to Cerebrooculofacioskeletal syndrome 2, MIM# 610756; Trichothiodystrophy 1, photosensitive, MIM# 601675; Xeroderma pigmentosum, group D, MIM# 278730
Prepair 500+ v1.343 ERCC2 Zornitza Stark Publications for gene: ERCC2 were set to
Prepair 500+ v1.342 EPG5 Zornitza Stark Marked gene: EPG5 as ready
Prepair 500+ v1.342 EPG5 Zornitza Stark Gene: epg5 has been classified as Green List (High Evidence).
Prepair 500+ v1.342 EPG5 Zornitza Stark Phenotypes for gene: EPG5 were changed from Vici syndrome, 242840 (3) to Vici syndrome MIM# 242840
Prepair 500+ v1.341 EPG5 Zornitza Stark Publications for gene: EPG5 were set to
Prepair 500+ v1.340 ENPP1 Zornitza Stark Marked gene: ENPP1 as ready
Prepair 500+ v1.340 ENPP1 Zornitza Stark Gene: enpp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.340 ENPP1 Zornitza Stark Phenotypes for gene: ENPP1 were changed from Hypophosphatemic rickets, autosomal recessive, 2, 613312 (3) to Arterial calcification, generalized, of infancy, 1 MIM#208000; Hypophosphatemic rickets, autosomal recessive, 2 MIM#613312
Prepair 500+ v1.339 ENPP1 Zornitza Stark Publications for gene: ENPP1 were set to
Prepair 500+ v1.338 EMD Zornitza Stark Marked gene: EMD as ready
Prepair 500+ v1.338 EMD Zornitza Stark Gene: emd has been classified as Green List (High Evidence).
Prepair 500+ v1.338 EMD Zornitza Stark Phenotypes for gene: EMD were changed from Emery-Dreifuss muscular dystrophy 1, X-linked, 310300 (3) to Emery-Dreifuss muscular dystrophy 1, X-linked, MIM# 310300
Prepair 500+ v1.337 EMD Zornitza Stark Publications for gene: EMD were set to
Prepair 500+ v1.336 ELP1 Zornitza Stark Marked gene: ELP1 as ready
Prepair 500+ v1.336 ELP1 Zornitza Stark Gene: elp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.336 ELP1 Zornitza Stark Phenotypes for gene: ELP1 were changed from Dysautonomia, familial, 223900 (3) to Dysautonomia, familial MIM#223900
Prepair 500+ v1.335 ELP1 Zornitza Stark Publications for gene: ELP1 were set to
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Marked gene: EIF2B5 as ready
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Gene: eif2b5 has been classified as Green List (High Evidence).
Prepair 500+ v1.334 EIF2B5 Zornitza Stark Phenotypes for gene: EIF2B5 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 5, with or without ovarian failure (MIM#620315)
Prepair 500+ v1.333 EIF2B5 Zornitza Stark Publications for gene: EIF2B5 were set to
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Marked gene: EIF2B4 as ready
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Gene: eif2b4 has been classified as Green List (High Evidence).
Prepair 500+ v1.332 EIF2B4 Zornitza Stark Phenotypes for gene: EIF2B4 were changed from Leukoencephaly with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 4, with or without ovarian failure MIM#620314
Prepair 500+ v1.331 EIF2B4 Zornitza Stark Publications for gene: EIF2B4 were set to
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Marked gene: EIF2B3 as ready
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence).
Prepair 500+ v1.330 EIF2B3 Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313
Prepair 500+ v1.329 EIF2B3 Zornitza Stark Publications for gene: EIF2B3 were set to
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Marked gene: EIF2B2 as ready
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Gene: eif2b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.328 EIF2B2 Zornitza Stark Phenotypes for gene: EIF2B2 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 2, with or without ovarian failure, MIM #620312
Prepair 500+ v1.327 EIF2B2 Zornitza Stark Publications for gene: EIF2B2 were set to
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Marked gene: EIF2B1 as ready
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Gene: eif2b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.326 EIF2B1 Zornitza Stark Phenotypes for gene: EIF2B1 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 1, with or without ovarian failure MIM#603896
Prepair 500+ v1.325 EIF2B1 Zornitza Stark Publications for gene: EIF2B1 were set to
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Marked gene: EIF2AK3 as ready
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Gene: eif2ak3 has been classified as Green List (High Evidence).
Prepair 500+ v1.324 EIF2AK3 Zornitza Stark Phenotypes for gene: EIF2AK3 were changed from Wolcott-Rallison syndrome, 226980 (3) to Wolcott-Rallison syndrome MIM#226980
Prepair 500+ v1.323 EIF2AK3 Zornitza Stark Publications for gene: EIF2AK3 were set to
Prepair 500+ v1.322 EDA Zornitza Stark Marked gene: EDA as ready
Prepair 500+ v1.322 EDA Zornitza Stark Gene: eda has been classified as Green List (High Evidence).
Prepair 500+ v1.322 EDA Zornitza Stark Phenotypes for gene: EDA were changed from Ectodermal dysplasia 1, hypohidrotic, X-linked, 305100 (3) to Ectodermal dysplasia 1, hypohidrotic, X-linked MIM#305100; Tooth agenesis, selective, X-linked 1 MIM#313500
Prepair 500+ v1.321 EDA Zornitza Stark Publications for gene: EDA were set to
Prepair 500+ v1.320 ECHS1 Zornitza Stark Marked gene: ECHS1 as ready
Prepair 500+ v1.320 ECHS1 Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.320 ECHS1 Zornitza Stark Phenotypes for gene: ECHS1 were changed from Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, 616277 (3) to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277
Prepair 500+ v1.319 ECHS1 Zornitza Stark Publications for gene: ECHS1 were set to
Prepair 500+ v1.318 DYSF Zornitza Stark Marked gene: DYSF as ready
Prepair 500+ v1.318 DYSF Zornitza Stark Gene: dysf has been classified as Green List (High Evidence).
Prepair 500+ v1.318 DYSF Zornitza Stark Phenotypes for gene: DYSF were changed from Muscular dystrophy, limb-girdle, type 2B, 253601 (3) to Miyoshi muscular dystrophy 1 MIM#254130; MONDO:0024545; Muscular dystrophy, limb-girdle, autosomal recessive 2 MIM#253601; MONDO:0009676; Myopathy, distal, with anterior tibial onset MIM#606768; MONDO:0011721
Prepair 500+ v1.317 DYSF Zornitza Stark Publications for gene: DYSF were set to
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Marked gene: DYNC2H1 as ready
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Gene: dync2h1 has been classified as Green List (High Evidence).
Prepair 500+ v1.316 DYNC2H1 Zornitza Stark Phenotypes for gene: DYNC2H1 were changed from Short-rib thoracic dysplasia 3 with or without polydactyly, 613091 (3) to Short-rib thoracic dysplasia 3 with or without polydactyly, MIM#613091
Prepair 500+ v1.315 DYNC2H1 Zornitza Stark Publications for gene: DYNC2H1 were set to
Prepair 500+ v1.314 DYM Zornitza Stark Marked gene: DYM as ready
Prepair 500+ v1.314 DYM Zornitza Stark Gene: dym has been classified as Green List (High Evidence).
Prepair 500+ v1.314 DYM Zornitza Stark Phenotypes for gene: DYM were changed from Dyggve-Melchior-Clausen disease, 223800 (3) to Dyggve-Melchior-Clausen disease MIM#223800; Smith-McCort dysplasia MIM#607326
Prepair 500+ v1.313 DYM Zornitza Stark Publications for gene: DYM were set to
Prepair 500+ v1.312 DOK7 Zornitza Stark Marked gene: DOK7 as ready
Prepair 500+ v1.312 DOK7 Zornitza Stark Gene: dok7 has been classified as Green List (High Evidence).
Prepair 500+ v1.312 DOK7 Zornitza Stark Phenotypes for gene: DOK7 were changed from Myasthenic syndrome, congenital, 10, 254300 (3) to Myasthenic syndrome, congenital, 10, MIM# 254300; Fetal akinesia deformation sequence 3, MIM# 618389
Prepair 500+ v1.311 DOK7 Zornitza Stark Publications for gene: DOK7 were set to
Prepair 500+ v1.310 DOCK6 Zornitza Stark Marked gene: DOCK6 as ready
Prepair 500+ v1.310 DOCK6 Zornitza Stark Gene: dock6 has been classified as Green List (High Evidence).
Prepair 500+ v1.310 DOCK6 Zornitza Stark Phenotypes for gene: DOCK6 were changed from Adams-Oliver syndrome 2, 614219 (3) to Adams-Oliver syndrome 2, MIM# 614219
Prepair 500+ v1.309 DOCK6 Zornitza Stark Publications for gene: DOCK6 were set to
Prepair 500+ v1.308 DNMT3B Zornitza Stark Marked gene: DNMT3B as ready
Prepair 500+ v1.308 DNMT3B Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence).
Prepair 500+ v1.308 DNMT3B Zornitza Stark Phenotypes for gene: DNMT3B were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 242860 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 1 (MIM#242860)
Prepair 500+ v1.307 DNAI2 Zornitza Stark Marked gene: DNAI2 as ready
Prepair 500+ v1.307 DNAI2 Zornitza Stark Gene: dnai2 has been classified as Green List (High Evidence).
Prepair 500+ v1.307 DNAI2 Zornitza Stark Phenotypes for gene: DNAI2 were changed from Ciliary dyskinesia, primary, 9, with or without situs inversus, 612444 (3) to Ciliary dyskinesia, primary, 9, with or without situs inversus, MIM# 612444
Prepair 500+ v1.306 DNAI2 Zornitza Stark Publications for gene: DNAI2 were set to
Prepair 500+ v1.305 DNAI1 Zornitza Stark Marked gene: DNAI1 as ready
Prepair 500+ v1.305 DNAI1 Zornitza Stark Gene: dnai1 has been classified as Green List (High Evidence).
Prepair 500+ v1.305 DNAI1 Zornitza Stark Phenotypes for gene: DNAI1 were changed from Ciliary dyskinesia, primary, 1, with or without situs inversus, 244400 (3) to Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400
Prepair 500+ v1.304 DNAI1 Zornitza Stark Publications for gene: DNAI1 were set to
Prepair 500+ v1.303 DNAH5 Zornitza Stark Marked gene: DNAH5 as ready
Prepair 500+ v1.303 DNAH5 Zornitza Stark Gene: dnah5 has been classified as Green List (High Evidence).
Prepair 500+ v1.303 DNAH5 Zornitza Stark Phenotypes for gene: DNAH5 were changed from Ciliary dyskinesia, primary, 3, with or without situs inversus, 608644 (3) to Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644
Prepair 500+ v1.302 DNAH5 Zornitza Stark Publications for gene: DNAH5 were set to
Prepair 500+ v1.301 DNAH11 Zornitza Stark Marked gene: DNAH11 as ready
Prepair 500+ v1.301 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Prepair 500+ v1.301 DNAH11 Zornitza Stark Phenotypes for gene: DNAH11 were changed from Ciliary dyskinesia, primary, 7, with or without situs inversus, 611884 (3) to Ciliary dyskinesia, primary, 7, with or without situs inversus, MIM#611884
Prepair 500+ v1.300 DNAH11 Zornitza Stark Publications for gene: DNAH11 were set to
Prepair 500+ v1.299 DMD Zornitza Stark Marked gene: DMD as ready
Prepair 500+ v1.299 DMD Zornitza Stark Gene: dmd has been classified as Green List (High Evidence).
Prepair 500+ v1.299 DMD Zornitza Stark Phenotypes for gene: DMD were changed from Duchenne muscular dystrophy, 310200 (3) to Duchenne muscular dystrophy MIM#310200
Prepair 500+ v1.298 DMD Zornitza Stark Publications for gene: DMD were set to
Prepair 500+ v1.297 DLL3 Zornitza Stark Marked gene: DLL3 as ready
Prepair 500+ v1.297 DLL3 Zornitza Stark Gene: dll3 has been classified as Green List (High Evidence).
Prepair 500+ v1.297 DLL3 Zornitza Stark Phenotypes for gene: DLL3 were changed from Spondylocostal dysostosis 1, autosomal recessive, 277300 (3) to Spondylocostal dysostosis 1, autosomal recessive, MIM# 277300; MONDO:0020692
Prepair 500+ v1.296 DLL3 Zornitza Stark Publications for gene: DLL3 were set to
Prepair 500+ v1.295 DLG3 Zornitza Stark Marked gene: DLG3 as ready
Prepair 500+ v1.295 DLG3 Zornitza Stark Gene: dlg3 has been classified as Green List (High Evidence).
Prepair 500+ v1.295 DLG3 Zornitza Stark Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, 300850 (3) to Intellectual developmental disorder, X-linked 90 MIM#300850
Prepair 500+ v1.294 DLG3 Zornitza Stark Publications for gene: DLG3 were set to
Prepair 500+ v1.293 DLD Zornitza Stark Marked gene: DLD as ready
Prepair 500+ v1.293 DLD Zornitza Stark Gene: dld has been classified as Green List (High Evidence).
Prepair 500+ v1.293 DLD Zornitza Stark Phenotypes for gene: DLD were changed from Dihydrolipoamide dehydrogenase deficiency, 246900 (3) to Dihydrolipoamide dehydrogenase deficiency (MIM#246900)
Prepair 500+ v1.292 DLD Zornitza Stark Publications for gene: DLD were set to
Prepair 500+ v1.291 DKC1 Zornitza Stark Marked gene: DKC1 as ready
Prepair 500+ v1.291 DKC1 Zornitza Stark Gene: dkc1 has been classified as Green List (High Evidence).
Prepair 500+ v1.291 DKC1 Zornitza Stark Phenotypes for gene: DKC1 were changed from Dyskeratosis congenita, X-linked, 305000 (3) to Dyskeratosis congenita, X-linked MIM#305000
Prepair 500+ v1.290 DKC1 Zornitza Stark Publications for gene: DKC1 were set to
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Marked gene: DIS3L2 as ready
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence).
Prepair 500+ v1.289 DIS3L2 Zornitza Stark Phenotypes for gene: DIS3L2 were changed from Perlman syndrome, 267000 (3) to Perlman syndrome MIM# 267000
Prepair 500+ v1.288 DIS3L2 Zornitza Stark Publications for gene: DIS3L2 were set to
Prepair 500+ v1.287 DHDDS Zornitza Stark Marked gene: DHDDS as ready
Prepair 500+ v1.287 DHDDS Zornitza Stark Gene: dhdds has been classified as Green List (High Evidence).
Prepair 500+ v1.287 DHDDS Zornitza Stark Phenotypes for gene: DHDDS were changed from Retinitis pigmentosa 59, 613861 (3) to Retinitis pigmentosa 59, MIM#613861; Congenital disorder of glycosylation, type 1bb, MIM# 613861
Prepair 500+ v1.286 DHDDS Zornitza Stark Publications for gene: DHDDS were set to
Prepair 500+ v1.285 DHCR7 Zornitza Stark Marked gene: DHCR7 as ready
Prepair 500+ v1.285 DHCR7 Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence).
Prepair 500+ v1.285 DHCR7 Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith-Lemli-Opitz syndrome, 270400 (3) to Smith-Lemli-Opitz syndrome (MIM#270400)
Prepair 500+ v1.284 DHCR7 Zornitza Stark Publications for gene: DHCR7 were set to
Prepair 500+ v1.283 DHCR24 Zornitza Stark Marked gene: DHCR24 as ready
Prepair 500+ v1.283 DHCR24 Zornitza Stark Gene: dhcr24 has been classified as Green List (High Evidence).
Prepair 500+ v1.283 DHCR24 Zornitza Stark Phenotypes for gene: DHCR24 were changed from Desmosterolosis, 602398 (3) to Desmosterolosis, MIM#602398
Prepair 500+ v1.282 DHCR24 Zornitza Stark Publications for gene: DHCR24 were set to
Prepair 500+ v1.281 DGUOK Zornitza Stark Marked gene: DGUOK as ready
Prepair 500+ v1.281 DGUOK Zornitza Stark Gene: dguok has been classified as Green List (High Evidence).
Prepair 500+ v1.281 DGUOK Zornitza Stark Phenotypes for gene: DGUOK were changed from Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), 251880 (3) to Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880; Portal hypertension, noncirrhotic, 1, MIM# 617068; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070
Prepair 500+ v1.280 DGUOK Zornitza Stark Publications for gene: DGUOK were set to
Prepair 500+ v1.279 DGAT1 Zornitza Stark Marked gene: DGAT1 as ready
Prepair 500+ v1.279 DGAT1 Zornitza Stark Gene: dgat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.279 DGAT1 Zornitza Stark Phenotypes for gene: DGAT1 were changed from ?Diarrhea 7, protein-losing enteropathy type to Diarrhoea 7, protein-losing enteropathy type, MIM# 615863; congenital diarrhea 7 with exudative enteropathy MONDO:0014375
Prepair 500+ v1.278 DGAT1 Zornitza Stark Publications for gene: DGAT1 were set to
Prepair 500+ v1.277 DDX11 Zornitza Stark Marked gene: DDX11 as ready
Prepair 500+ v1.277 DDX11 Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence).
Prepair 500+ v1.277 DDX11 Zornitza Stark Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, 613398 (3) to Warsaw breakage syndrome MIM#613398
Prepair 500+ v1.276 DDX11 Zornitza Stark Publications for gene: DDX11 were set to
Prepair 500+ v1.275 DDC Zornitza Stark Marked gene: DDC as ready
Prepair 500+ v1.275 DDC Zornitza Stark Gene: ddc has been classified as Green List (High Evidence).
Prepair 500+ v1.275 DDC Zornitza Stark Phenotypes for gene: DDC were changed from Aromatic L-amino acid decarboxylase deficiency, 608643 (3) to Aromatic L-amino acid decarboxylase deficiency MIM#608643; Aromatic L-amino acid decarboxylase deficiency (MIM#608643)
Prepair 500+ v1.274 DCX Zornitza Stark Marked gene: DCX as ready
Prepair 500+ v1.274 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Prepair 500+ v1.274 DCX Zornitza Stark Phenotypes for gene: DCX were changed from Lissencephaly, X-linked, 300067 (3) to Lissencephaly, X-linked MIM#300067; Subcortical laminal heterotopia, X-linked MIM#300067
Prepair 500+ v1.273 DCX Zornitza Stark Publications for gene: DCX were set to
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Marked gene: DCLRE1C as ready
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence).
Prepair 500+ v1.272 DCLRE1C Zornitza Stark Phenotypes for gene: DCLRE1C were changed from Severe combined immunodeficiency, Athabascan type, 602450 (3) to Severe combined immunodeficiency, Athabascan type, MIM# 602450; Omenn syndrome, MIM# 603554
Prepair 500+ v1.271 DCLRE1C Zornitza Stark Publications for gene: DCLRE1C were set to
Prepair 500+ v1.270 DCAF17 Zornitza Stark Marked gene: DCAF17 as ready
Prepair 500+ v1.270 DCAF17 Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence).
Prepair 500+ v1.270 DCAF17 Zornitza Stark Phenotypes for gene: DCAF17 were changed from Woodhouse-Sakati syndrome, 241080 (3) to Woodhouse-Sakati syndrome MIM#241080
Prepair 500+ v1.269 DCAF17 Zornitza Stark Publications for gene: DCAF17 were set to
Prepair 500+ v1.268 DBT Zornitza Stark Marked gene: DBT as ready
Prepair 500+ v1.268 DBT Zornitza Stark Gene: dbt has been classified as Green List (High Evidence).
Prepair 500+ v1.268 DBT Zornitza Stark Phenotypes for gene: DBT were changed from Maple syrup urine disease, type II, 248600 (3) to Maple syrup urine disease, type II, MIM#248600
Prepair 500+ v1.267 D2HGDH Zornitza Stark Marked gene: D2HGDH as ready
Prepair 500+ v1.267 D2HGDH Zornitza Stark Gene: d2hgdh has been classified as Green List (High Evidence).
Prepair 500+ v1.267 D2HGDH Zornitza Stark Phenotypes for gene: D2HGDH were changed from D-2-hydroxyglutaric aciduria, 600721 (3) to D-2-hydroxyglutaric aciduria, MIM#600721
Prepair 500+ v1.266 D2HGDH Zornitza Stark Publications for gene: D2HGDH were set to
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Marked gene: CYP7B1 as ready
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.265 CYP7B1 Zornitza Stark Phenotypes for gene: CYP7B1 were changed from Bile acid synthesis defect, congenital, 3, 613812 (3) to Bile acid synthesis defect, congenital, 3, MIM#613812; Spastic paraplegia 5A, MIM#270800
Prepair 500+ v1.264 CYP7B1 Zornitza Stark Publications for gene: CYP7B1 were set to
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Marked gene: CYP27A1 as ready
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.263 CYP27A1 Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cerebrotendinous xanthomatosis, 213700 (3) to Cerebrotendinous xanthomatosis, MIM#213700
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Marked gene: CYP1B1 as ready
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Gene: cyp1b1 has been classified as Green List (High Evidence).
Prepair 500+ v1.262 CYP1B1 Zornitza Stark Phenotypes for gene: CYP1B1 were changed from Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, 231300 (3) to Anterior segment dysgenesis 6, multiple subtypes, MIM#617315
Prepair 500+ v1.261 CYP1B1 Zornitza Stark Publications for gene: CYP1B1 were set to
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Marked gene: CYP17A1 as ready
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Gene: cyp17a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.260 CYP17A1 Zornitza Stark Phenotypes for gene: CYP17A1 were changed from 17,20-lyase deficiency, isolated, 202110 (3) to 17-alpha-hydroxylase/17,20-lyase deficiency MIM#202110
Prepair 500+ v1.259 CYP17A1 Zornitza Stark Publications for gene: CYP17A1 were set to
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Marked gene: CYP11B2 as ready
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Gene: cyp11b2 has been classified as Green List (High Evidence).
Prepair 500+ v1.258 CYP11B2 Zornitza Stark Phenotypes for gene: CYP11B2 were changed from Hypoaldosteronism, congenital, due to CMO I deficiency, 203400 (3) to Hypoaldosteronism, congenital, due to CMO I deficiency MIM#203400; Hypoaldosteronism, congenital, due to CMO II deficiency MIM#610600
Prepair 500+ v1.257 CYP11B2 Zornitza Stark Publications for gene: CYP11B2 were set to
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Marked gene: CYP11A1 as ready
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Gene: cyp11a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.256 CYP11A1 Zornitza Stark Phenotypes for gene: CYP11A1 were changed from Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete, 613743 (3) to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete MIM#613743
Prepair 500+ v1.255 CYP11A1 Zornitza Stark Publications for gene: CYP11A1 were set to
Prepair 500+ v1.254 CYBB Zornitza Stark reviewed gene: CYBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chronic granulomatous disease, X-linked, MIM#306400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Prepair 500+ v1.254 CYBB Zornitza Stark Marked gene: CYBB as ready
Prepair 500+ v1.254 CYBB Zornitza Stark Gene: cybb has been classified as Green List (High Evidence).
Prepair 500+ v1.254 CYBB Zornitza Stark Phenotypes for gene: CYBB were changed from Chronic granulomatous disease, X-linked, 306400 (3) to Chronic granulomatous disease, X-linked, MIM#306400
Prepair 500+ v1.253 CYBB Zornitza Stark Publications for gene: CYBB were set to
Prepair 500+ v1.252 CYBA Zornitza Stark Marked gene: CYBA as ready
Prepair 500+ v1.252 CYBA Zornitza Stark Gene: cyba has been classified as Green List (High Evidence).
Prepair 500+ v1.252 CYBA Zornitza Stark Phenotypes for gene: CYBA were changed from Chronic granulomatous disease, autosomal, due to deficiency of CYBA, 233690 (3) to Chronic granulomatous disease 4 MIM#233690
Prepair 500+ v1.251 CYBA Zornitza Stark Publications for gene: CYBA were set to
Prepair 500+ v1.250 CUL4B Zornitza Stark Marked gene: CUL4B as ready
Prepair 500+ v1.250 CUL4B Zornitza Stark Gene: cul4b has been classified as Green List (High Evidence).
Prepair 500+ v1.250 CUL4B Zornitza Stark Phenotypes for gene: CUL4B were changed from Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354 (3) to Intellectual developmental disorder, X-linked syndromic, Cabezas type, MIM#300354
Prepair 500+ v1.249 CUL4B Zornitza Stark Publications for gene: CUL4B were set to
Prepair 500+ v1.248 CTSK Zornitza Stark Marked gene: CTSK as ready
Prepair 500+ v1.248 CTSK Zornitza Stark Gene: ctsk has been classified as Green List (High Evidence).
Prepair 500+ v1.248 CTSK Zornitza Stark Phenotypes for gene: CTSK were changed from Pycnodysostosis, 265800 (3) to Pycnodysostosis MIM#265800
Prepair 500+ v1.247 CTSK Zornitza Stark Publications for gene: CTSK were set to
Prepair 500+ v1.246 CTSD Zornitza Stark Marked gene: CTSD as ready
Prepair 500+ v1.246 CTSD Zornitza Stark Gene: ctsd has been classified as Green List (High Evidence).
Prepair 500+ v1.246 CTSD Zornitza Stark Phenotypes for gene: CTSD were changed from Ceroid lipofuscinosis, neuronal, 10, 610127 (3) to Ceroid lipofuscinosis, neuronal, 10, MIM# 610127
Prepair 500+ v1.245 CTSC Zornitza Stark Marked gene: CTSC as ready
Prepair 500+ v1.245 CTSC Zornitza Stark Gene: ctsc has been classified as Green List (High Evidence).
Prepair 500+ v1.245 CTSC Zornitza Stark Phenotypes for gene: CTSC were changed from Papillon-Lefevre syndrome, 245000 (3) to Haim-Munk syndrome MIM#245010; Papillon-Lefevre syndrome MIM#245000
Prepair 500+ v1.244 CTSA Zornitza Stark Marked gene: CTSA as ready
Prepair 500+ v1.244 CTSA Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence).
Prepair 500+ v1.244 CTSA Zornitza Stark Phenotypes for gene: CTSA were changed from Galactosialidosis, 256540 (3) to Galactosialidosis MIM#256540
Prepair 500+ v1.243 CTSA Zornitza Stark Publications for gene: CTSA were set to
Prepair 500+ v1.242 CTNS Zornitza Stark Marked gene: CTNS as ready
Prepair 500+ v1.242 CTNS Zornitza Stark Gene: ctns has been classified as Green List (High Evidence).
Prepair 500+ v1.242 CTNS Zornitza Stark Phenotypes for gene: CTNS were changed from Cystinosis, nephropathic, 219800 (3) to Cystinosis, nephropathic MIM#219800
Prepair 500+ v1.241 CTNS Zornitza Stark Publications for gene: CTNS were set to
Prepair 500+ v1.240 CSPP1 Zornitza Stark Marked gene: CSPP1 as ready
Prepair 500+ v1.240 CSPP1 Zornitza Stark Gene: cspp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.240 CSPP1 Zornitza Stark Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288
Prepair 500+ v1.239 CSPP1 Zornitza Stark Publications for gene: CSPP1 were set to
Prepair 500+ v1.238 CRTAP Zornitza Stark Marked gene: CRTAP as ready
Prepair 500+ v1.238 CRTAP Zornitza Stark Gene: crtap has been classified as Green List (High Evidence).
Prepair 500+ v1.238 CRTAP Zornitza Stark Phenotypes for gene: CRTAP were changed from Osteogenesis imperfecta, type VII, 610682 (3) to Osteogenesis imperfecta, type VII MIM#610682
Prepair 500+ v1.237 CRTAP Zornitza Stark Publications for gene: CRTAP were set to
Prepair 500+ v1.236 CRB1 Zornitza Stark Marked gene: CRB1 as ready
Prepair 500+ v1.236 CRB1 Zornitza Stark Gene: crb1 has been classified as Green List (High Evidence).
Prepair 500+ v1.236 CRB1 Zornitza Stark Phenotypes for gene: CRB1 were changed from Leber congenital amaurosis 8, 613835 (3) to Leber congenital amaurosis 8, MIM#613835
Prepair 500+ v1.235 CRB1 Zornitza Stark Publications for gene: CRB1 were set to
Prepair 500+ v1.234 CPT2 Zornitza Stark Marked gene: CPT2 as ready
Prepair 500+ v1.234 CPT2 Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence).
Prepair 500+ v1.234 CPT2 Zornitza Stark Phenotypes for gene: CPT2 were changed from CPT II deficiency, lethal neonatal, 608836 (3) to CPT II deficiency, infantile MIM#600649; CPT II deficiency, lethal neonatal MIM#608836
Prepair 500+ v1.233 CPT2 Zornitza Stark Publications for gene: CPT2 were set to
Prepair 500+ v1.232 CPT1A Zornitza Stark Marked gene: CPT1A as ready
Prepair 500+ v1.232 CPT1A Zornitza Stark Gene: cpt1a has been classified as Green List (High Evidence).
Prepair 500+ v1.232 CPT1A Zornitza Stark Phenotypes for gene: CPT1A were changed from CPT deficiency, hepatic, type IA, 255120 (3) to CPT deficiency, hepatic, type IA, MIM#255120
Prepair 500+ v1.231 CPT1A Zornitza Stark Publications for gene: CPT1A were set to
Prepair 500+ v1.230 CPS1 Zornitza Stark Marked gene: CPS1 as ready
Prepair 500+ v1.230 CPS1 Zornitza Stark Gene: cps1 has been classified as Green List (High Evidence).
Prepair 500+ v1.230 CPS1 Zornitza Stark Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency, 237300 (3) to Carbamoylphosphate synthetase I deficiency MIM#237300
Prepair 500+ v1.229 CPS1 Zornitza Stark Publications for gene: CPS1 were set to
Prepair 500+ v1.228 COX15 Zornitza Stark Marked gene: COX15 as ready
Prepair 500+ v1.228 COX15 Zornitza Stark Gene: cox15 has been classified as Green List (High Evidence).
Prepair 500+ v1.228 COX15 Zornitza Stark Phenotypes for gene: COX15 were changed from Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 2, 615119 (3) to Mitochondrial complex IV deficiency, nuclear type 6, MIM #615119
Prepair 500+ v1.227 COX15 Zornitza Stark Publications for gene: COX15 were set to
Prepair 500+ v1.226 COLQ Zornitza Stark Marked gene: COLQ as ready
Prepair 500+ v1.226 COLQ Zornitza Stark Gene: colq has been classified as Green List (High Evidence).
Prepair 500+ v1.226 COLQ Zornitza Stark Phenotypes for gene: COLQ were changed from Myasthenic syndrome, congenital, 5, 603034 (3) to Myasthenic syndrome, congenital, 5 MIM#603034; MONDO:0011281
Prepair 500+ v1.225 COLQ Zornitza Stark Publications for gene: COLQ were set to
Prepair 500+ v1.224 COLEC11 Zornitza Stark Marked gene: COLEC11 as ready
Prepair 500+ v1.224 COLEC11 Zornitza Stark Gene: colec11 has been classified as Green List (High Evidence).
Prepair 500+ v1.224 COLEC11 Zornitza Stark Phenotypes for gene: COLEC11 were changed from 3MC syndrome 2, 265050 (3) to 3MC syndrome 2, MIM# 265050; MONDO:0009927
Prepair 500+ v1.223 COLEC11 Zornitza Stark Publications for gene: COLEC11 were set to
Prepair 500+ v1.222 COL7A1 Zornitza Stark Marked gene: COL7A1 as ready
Prepair 500+ v1.222 COL7A1 Zornitza Stark Gene: col7a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.222 COL7A1 Zornitza Stark Phenotypes for gene: COL7A1 were changed from Epidermolysis bullosa dystrophica, AR, 226600 (3) to Epidermolysis bullosa dystrophica inversa MIM#226600; Epidermolysis bullosa dystrophica, autosomal recessive MIM#226600; Epidermolysis bullosa dystrophica, localisata variant MIM#226600; Epidermolysis bullosa pruriginosa MIM#604129
Prepair 500+ v1.221 COL7A1 Zornitza Stark Publications for gene: COL7A1 were set to
Prepair 500+ v1.220 COL6A1 Zornitza Stark Marked gene: COL6A1 as ready
Prepair 500+ v1.220 COL6A1 Zornitza Stark Gene: col6a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.220 COL6A1 Zornitza Stark Phenotypes for gene: COL6A1 were changed from Ullrich congenital muscular dystrophy 1, 254090 (3) to Ullrich congenital muscular dystrophy 1A MIM#254090
Prepair 500+ v1.219 COL6A1 Zornitza Stark Publications for gene: COL6A1 were set to
Prepair 500+ v1.218 COL4A5 Zornitza Stark Marked gene: COL4A5 as ready
Prepair 500+ v1.218 COL4A5 Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence).
Prepair 500+ v1.218 COL4A5 Zornitza Stark Phenotypes for gene: COL4A5 were changed from Alport syndrome 1, X-linked to Alport syndrome 1, X-linked, MIM#301050
Prepair 500+ v1.217 COL4A5 Zornitza Stark Publications for gene: COL4A5 were set to
Prepair 500+ v1.216 COL4A4 Zornitza Stark Marked gene: COL4A4 as ready
Prepair 500+ v1.216 COL4A4 Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence).
Prepair 500+ v1.216 COL4A4 Zornitza Stark Phenotypes for gene: COL4A4 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 2, autosomal recessive MIM# 203780
Prepair 500+ v1.215 COL4A4 Zornitza Stark Publications for gene: COL4A4 were set to
Prepair 500+ v1.214 COL4A3 Zornitza Stark Marked gene: COL4A3 as ready
Prepair 500+ v1.214 COL4A3 Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence).
Prepair 500+ v1.214 COL4A3 Zornitza Stark Phenotypes for gene: COL4A3 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 3b, autosomal recessive MIM#620536; MONDO:0957811
Prepair 500+ v1.213 COL4A3 Zornitza Stark Publications for gene: COL4A3 were set to
Prepair 500+ v1.212 COL27A1 Zornitza Stark Marked gene: COL27A1 as ready
Prepair 500+ v1.212 COL27A1 Zornitza Stark Gene: col27a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.212 COL27A1 Zornitza Stark Phenotypes for gene: COL27A1 were changed from Steel Syndrome to Steel syndrome (MIM#615155)
Prepair 500+ v1.211 COL27A1 Zornitza Stark Publications for gene: COL27A1 were set to
Prepair 500+ v1.210 COL18A1 Zornitza Stark Marked gene: COL18A1 as ready
Prepair 500+ v1.210 COL18A1 Zornitza Stark Gene: col18a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.210 COL18A1 Zornitza Stark Phenotypes for gene: COL18A1 were changed from Knobloch syndrome, type 1, 267750 (3) to Knobloch syndrome, type 1 MIM#267750
Prepair 500+ v1.209 COL18A1 Zornitza Stark Publications for gene: COL18A1 were set to
Prepair 500+ v1.208 COL17A1 Zornitza Stark Marked gene: COL17A1 as ready
Prepair 500+ v1.208 COL17A1 Zornitza Stark Gene: col17a1 has been classified as Green List (High Evidence).
Prepair 500+ v1.208 COL17A1 Zornitza Stark Phenotypes for gene: COL17A1 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (3) to Epidermolysis bullosa, junctional 4, intermediate, MIM# 619787
Prepair 500+ v1.207 COL17A1 Zornitza Stark Publications for gene: COL17A1 were set to
Prepair 500+ v1.206 COL11A2 Zornitza Stark Marked gene: COL11A2 as ready
Prepair 500+ v1.206 COL11A2 Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence).
Prepair 500+ v1.206 COL11A2 Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Deafness, autosomal recessive 53 MIM#609706; Fibrochondrogenesis 2 MIM#614524; Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150
Prepair 500+ v1.205 COL11A2 Zornitza Stark Publications for gene: COL11A2 were set to
Prepair 500+ v1.204 CNGB3 Zornitza Stark Marked gene: CNGB3 as ready
Prepair 500+ v1.204 CNGB3 Zornitza Stark Gene: cngb3 has been classified as Green List (High Evidence).
Prepair 500+ v1.204 CNGB3 Zornitza Stark Phenotypes for gene: CNGB3 were changed from Macular degeneration, juvenile, 248200 (3) to Achromatopsia 3 MIM#262300
Prepair 500+ v1.203 CNGB3 Zornitza Stark Publications for gene: CNGB3 were set to
Prepair 500+ v1.202 CLRN1 Zornitza Stark Marked gene: CLRN1 as ready
Prepair 500+ v1.202 CLRN1 Zornitza Stark Gene: clrn1 has been classified as Green List (High Evidence).
Prepair 500+ v1.202 CLRN1 Zornitza Stark Phenotypes for gene: CLRN1 were changed from Usher syndrome, type 3A, 276902 (3) to Usher syndrome, type 3A, MIM#276902
Prepair 500+ v1.201 CLRN1 Zornitza Stark Publications for gene: CLRN1 were set to
Prepair 500+ v1.200 CLPB Zornitza Stark Marked gene: CLPB as ready
Prepair 500+ v1.200 CLPB Zornitza Stark Gene: clpb has been classified as Green List (High Evidence).
Prepair 500+ v1.200 CLPB Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropenia, 616271 (3) to 3-methylglutaconic aciduria, type VIIB, autosomal recessive (MIM#616271)
Prepair 500+ v1.199 CLPB Zornitza Stark Publications for gene: CLPB were set to
Prepair 500+ v1.198 CLP1 Zornitza Stark Marked gene: CLP1 as ready
Prepair 500+ v1.198 CLP1 Zornitza Stark Gene: clp1 has been classified as Green List (High Evidence).
Prepair 500+ v1.198 CLP1 Zornitza Stark Phenotypes for gene: CLP1 were changed from Pontocerebellar hypoplasia, type 10, 615803 (3) to Pontocerebellar hypoplasia, type 10 MIM#615803
Prepair 500+ v1.197 CLP1 Zornitza Stark Publications for gene: CLP1 were set to
Prepair 500+ v1.196 CLN8 Zornitza Stark Marked gene: CLN8 as ready
Prepair 500+ v1.196 CLN8 Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence).
Prepair 500+ v1.196 CLN8 Zornitza Stark Phenotypes for gene: CLN8 were changed from Ceroid lipofuscinosis, neuronal, 8, 600143 (3) to Ceroid lipofuscinosis, neuronal, 8, MIM# 600143
Prepair 500+ v1.195 CLN6 Zornitza Stark Marked gene: CLN6 as ready
Prepair 500+ v1.195 CLN6 Zornitza Stark Gene: cln6 has been classified as Green List (High Evidence).
Prepair 500+ v1.195 CLN6 Zornitza Stark Phenotypes for gene: CLN6 were changed from Ceroid lipofuscinosis, neuronal 6, 601780 (3) to Ceroid lipofuscinosis, neuronal 6, MIM#601780
Prepair 500+ v1.194 CLN6 Zornitza Stark Publications for gene: CLN6 were set to
Prepair 500+ v1.193 CLN5 Zornitza Stark Marked gene: CLN5 as ready
Prepair 500+ v1.193 CLN5 Zornitza Stark Gene: cln5 has been classified as Green List (High Evidence).
Prepair 500+ v1.193 CLN5 Zornitza Stark Phenotypes for gene: CLN5 were changed from Ceroid lipofuscinosis, neuronal, 5, 256731 (3) to Ceroid lipofuscinosis, neuronal, 5, MIM# 256731; MONDO:0009745
Prepair 500+ v1.192 CLCN7 Zornitza Stark Marked gene: CLCN7 as ready
Prepair 500+ v1.192 CLCN7 Zornitza Stark Gene: clcn7 has been classified as Green List (High Evidence).
Prepair 500+ v1.192 CLCN7 Zornitza Stark Phenotypes for gene: CLCN7 were changed from Osteopetrosis, autosomal recessive 4, 611490 (3) to Osteopetrosis, autosomal recessive 4, MIM#611490
Prepair 500+ v1.191 CLCN7 Zornitza Stark Publications for gene: CLCN7 were set to
Prepair 500+ v1.190 CLCN5 Zornitza Stark Marked gene: CLCN5 as ready
Prepair 500+ v1.190 CLCN5 Zornitza Stark Gene: clcn5 has been classified as Green List (High Evidence).
Prepair 500+ v1.190 CLCN5 Zornitza Stark Phenotypes for gene: CLCN5 were changed from Dent disease, 300009 (3) to Dent disease, MIM#300009
Prepair 500+ v1.189 CKAP2L Zornitza Stark Marked gene: CKAP2L as ready
Prepair 500+ v1.189 CKAP2L Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence).
Prepair 500+ v1.189 CKAP2L Zornitza Stark Phenotypes for gene: CKAP2L were changed from Filippi syndrome, 272440 (3) to Filippi syndrome MIM#272440
Prepair 500+ v1.188 CKAP2L Zornitza Stark Publications for gene: CKAP2L were set to
Prepair 500+ v1.187 CIITA Zornitza Stark Marked gene: CIITA as ready
Prepair 500+ v1.187 CIITA Zornitza Stark Gene: ciita has been classified as Green List (High Evidence).
Prepair 500+ v1.187 CIITA Zornitza Stark Phenotypes for gene: CIITA were changed from Bare lymphocyte syndrome, type II, complementation group A, 209920 (3) to MHC class II deficiency 1 MIM#209920
Prepair 500+ v1.186 CIITA Zornitza Stark Publications for gene: CIITA were set to
Prepair 500+ v1.185 CHRNG Zornitza Stark Marked gene: CHRNG as ready
Prepair 500+ v1.185 CHRNG Zornitza Stark Gene: chrng has been classified as Green List (High Evidence).
Prepair 500+ v1.185 CHRNG Zornitza Stark Phenotypes for gene: CHRNG were changed from Escobar syndrome, 265000 (3) to Escobar syndrome (MIM# 265000); Multiple pterygium syndrome, lethal type, (MIM# 253290)
Prepair 500+ v1.184 CHRNG Zornitza Stark Publications for gene: CHRNG were set to
Prepair 500+ v1.183 CHRNE Zornitza Stark Marked gene: CHRNE as ready
Prepair 500+ v1.183 CHRNE Zornitza Stark Gene: chrne has been classified as Green List (High Evidence).
Prepair 500+ v1.183 CHRNE Zornitza Stark Phenotypes for gene: CHRNE were changed from Myasthenic syndrome, congenital, 4A, slow-channel, 605809 (3) to Myasthenic syndrome, congenital, 4A, slow-channel MIM#605809; Myasthenic syndrome, congenital, 4B, fast-channel MIM#616324; Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency MIM#608931
Prepair 500+ v1.182 CHRNE Zornitza Stark Publications for gene: CHRNE were set to
Prepair 500+ v1.181 CHAT Zornitza Stark Marked gene: CHAT as ready
Prepair 500+ v1.181 CHAT Zornitza Stark Gene: chat has been classified as Green List (High Evidence).
Prepair 500+ v1.181 CHAT Zornitza Stark Phenotypes for gene: CHAT were changed from Myasthenic syndrome, congenital, 6, presynaptic, 254210 (3) to Myasthenic syndrome, congenital, 6, presynaptic MIM#254210
Prepair 500+ v1.180 CHAT Zornitza Stark Publications for gene: CHAT were set to
Prepair 500+ v1.179 CFTR Zornitza Stark Marked gene: CFTR as ready
Prepair 500+ v1.179 CFTR Zornitza Stark Gene: cftr has been classified as Green List (High Evidence).
Prepair 500+ v1.179 CFTR Zornitza Stark Phenotypes for gene: CFTR were changed from Cystic fibrosis, 219700 (3) to Cystic fibrosis, MIM#219700; MONDO:0009061
Prepair 500+ v1.178 CFTR Zornitza Stark Publications for gene: CFTR were set to
Prepair 500+ v1.177 CEP41 Zornitza Stark Marked gene: CEP41 as ready
Prepair 500+ v1.177 CEP41 Zornitza Stark Gene: cep41 has been classified as Green List (High Evidence).
Prepair 500+ v1.177 CEP41 Zornitza Stark Phenotypes for gene: CEP41 were changed from Joubert syndrome 15, 614464 (3) to Joubert syndrome 15, MIM# 614464
Prepair 500+ v1.176 CEP41 Zornitza Stark Publications for gene: CEP41 were set to
Prepair 500+ v1.175 CEP290 Zornitza Stark Marked gene: CEP290 as ready
Prepair 500+ v1.175 CEP290 Zornitza Stark Gene: cep290 has been classified as Green List (High Evidence).
Prepair 500+ v1.175 CEP290 Zornitza Stark Phenotypes for gene: CEP290 were changed from Joubert syndrome 5, 610188 (3) to CEP290-related ciliopathy MONDO:0100451; Bardet-Biedl syndrome 14, MIM# 615991; Joubert syndrome 5 610188; Leber congenital amaurosis 10, MIM# 611755; Meckel syndrome 4, MIM# 611134; Senior-Loken syndrome 6, MIM# 610189
Prepair 500+ v1.174 CEP290 Zornitza Stark Publications for gene: CEP290 were set to
Prepair 500+ v1.173 CEP152 Zornitza Stark Marked gene: CEP152 as ready
Prepair 500+ v1.173 CEP152 Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence).
Prepair 500+ v1.173 CEP152 Zornitza Stark Phenotypes for gene: CEP152 were changed from Seckel syndrome 5, 613823 (3) to Microcephaly 9, primary, autosomal recessive, MIM# 614852; MONDO:0013923; Seckel syndrome 5, MIM# 613823; MONDO:0013443
Prepair 500+ v1.172 CEP152 Zornitza Stark Publications for gene: CEP152 were set to
Prepair 500+ v1.171 CENPJ Zornitza Stark Marked gene: CENPJ as ready
Prepair 500+ v1.171 CENPJ Zornitza Stark Gene: cenpj has been classified as Green List (High Evidence).
Prepair 500+ v1.171 CENPJ Zornitza Stark Phenotypes for gene: CENPJ were changed from Microcephaly 6, primary, autosomal recessive, 608393 (3) to Microcephaly 6, primary MIM#608393; Seckel syndrome 4 MIM#613676
Prepair 500+ v1.170 CENPJ Zornitza Stark Publications for gene: CENPJ were set to
Prepair 500+ v1.169 CDH23 Zornitza Stark Marked gene: CDH23 as ready
Prepair 500+ v1.169 CDH23 Zornitza Stark Gene: cdh23 has been classified as Green List (High Evidence).
Prepair 500+ v1.169 CDH23 Zornitza Stark Phenotypes for gene: CDH23 were changed from Usher syndrome, type 1D, 601067 (3) to Usher syndrome, type 1D (MIM#601067)
Prepair 500+ v1.168 CDH23 Zornitza Stark Publications for gene: CDH23 were set to
Prepair 500+ v1.167 CD40LG Zornitza Stark Marked gene: CD40LG as ready
Prepair 500+ v1.167 CD40LG Zornitza Stark Gene: cd40lg has been classified as Green List (High Evidence).
Prepair 500+ v1.167 CD40LG Zornitza Stark Phenotypes for gene: CD40LG were changed from Immunodeficiency, X-linked, with hyper-IgM, 308230 (3) to Immunodeficiency, X-linked, with hyper-IgM MIM# 308230
Prepair 500+ v1.166 CD40LG Zornitza Stark Publications for gene: CD40LG were set to
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Marked gene: IFT57 as ready
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Cone-rod Dystrophy v0.56 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Polydactyly v0.283 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Polydactyly v0.283 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Ciliopathies v1.68 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Ciliopathies v1.68 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Ciliopathies v1.67 IFT57 Krithika Murali Marked gene: IFT57 as ready
Ciliopathies v1.67 IFT57 Krithika Murali Gene: ift57 has been classified as Red List (Low Evidence).
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Marked gene: IFT57 as ready
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Bardet Biedl syndrome v1.12 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Mendeliome v1.2519 IFT57 Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Mendeliome v1.2518 IFT57 Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Mendeliome v1.2517 IFT57 Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence)
Mendeliome v1.2517 IFT57 Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.120 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Genetic Epilepsy v1.146 UGGT1 Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v1.146 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Genetic Epilepsy v1.146 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence)
Renal Macrocystic Disease v0.85 UGGT1 Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence).
Microcephaly v1.305 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Microcephaly v1.305 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Microcephaly v1.304 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Microcephaly v1.304 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Mendeliome v1.2516 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Mendeliome v1.2516 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Mendeliome v1.2516 UGGT1 Krithika Murali Phenotypes for gene: UGGT1 were changed from to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Mendeliome v1.2515 UGGT1 Krithika Murali Publications for gene: UGGT1 were set to
Mendeliome v1.2514 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2513 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Mendeliome v1.2513 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Disorders of Glycosylation v1.66 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Autism v0.207 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Autism v0.207 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.442 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Heart Defect v0.442 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.441 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Congenital Heart Defect v0.441 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.440 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Congenital Heart Defect v0.440 UGGT1 Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence).
Differences of Sex Development v1.11 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Differences of Sex Development v1.11 UGGT1 Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Differences of Sex Development v1.10 UGGT1 Krithika Murali Marked gene: UGGT1 as ready
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.10 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.10 UGGT1 Krithika Murali Classified gene: UGGT1 as Green List (high evidence)
Differences of Sex Development v1.10 UGGT1 Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence).
Differences of Sex Development v1.9 UGGT1 Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Differences of Sex Development v1.9 UGGT1 Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Differences of Sex Development v1.9 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Differences of Sex Development. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: Genitourinary anomalies such as cryptorchidism reported

--

PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Congenital Heart Defect v0.440 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Congenital Heart Defect. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Renal Macrocystic Disease v0.84 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Renal Macrocystic Disease. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to AMBER
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants and CDG/multisystem disorder with clinical features including GDD/ID,
microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).Supportive functional evidence also provided.

Of note, two individuals reported with cystic renal dysplasia and hepatobiliary anomalies that were similar in apperaance to ARPKD.
Sources: Literature
Autism v0.206 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Autism. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Microcephaly v1.304 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Microcephaly. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID:40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Congenital Disorders of Glycosylation v1.65 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity.

Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.119 UGGT1 Krithika Murali gene: UGGT1 was added
gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: UGGT1 were set to PMID: 40267907
Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG
Review for gene: UGGT1 was set to GREEN
Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants.

Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).

Supportive functional evidence also provided.
Sources: Literature
Mendeliome v1.2512 UGGT1 Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v1.2512 IFT57 Krithika Murali reviewed gene: IFT57: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:40273360; Phenotypes: Bardet-Bield syndrome, ciliopathy - MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ciliopathies v1.67 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Ciliopathies. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Learning difficulties
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Polydactyly v0.282 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Polydactyly. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Learning difficulties
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Cone-rod Dystrophy v0.55 IFT57 Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Learning difficulties
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Bardet Biedl syndrome v1.11 IFT57 Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Learning difficulties
- Obesity and type 2 diabetes

- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Cone-rod Dystrophy v0.55 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Cone-rod Dystrophy. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Bardet Biedl syndrome v1.11 IFT57 Krithika Murali gene: IFT57 was added
gene: IFT57 was added to Bardet Biedl syndrome. Sources: Literature
Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: IFT57 were set to PMID:40273360
Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308
Review for gene: IFT57 was set to AMBER
Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include:
- Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness
- Post-axial polydactyly
- Obesity and type 2 diabetes
- Moderate sensorineural hearing loss

Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17).

Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells.
Sources: Literature
Familial hypercholesterolaemia v1.0 APOB Zornitza Stark Marked gene: APOB as ready
Familial hypercholesterolaemia v1.0 APOB Zornitza Stark Gene: apob has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.118 DLG3 Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850
Mendeliome v1.2512 DLG3 Lilian Downie Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850
Prepair 500+ v1.165 CD40 Zornitza Stark Marked gene: CD40 as ready
Prepair 500+ v1.165 CD40 Zornitza Stark Gene: cd40 has been classified as Green List (High Evidence).
Prepair 500+ v1.165 CD40 Zornitza Stark Phenotypes for gene: CD40 were changed from Immunodeficiency with hyper-IgM, type 3, 606843 (3) to Immunodeficiency with hyper-IgM, type 3, MIM# 606843
Prepair 500+ v1.164 CD3D Zornitza Stark Marked gene: CD3D as ready
Prepair 500+ v1.164 CD3D Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence).
Prepair 500+ v1.164 CD3D Zornitza Stark Phenotypes for gene: CD3D were changed from Immunodeficiency 19, 615617 (3) to Immunodeficiency 19, severe combined MIM# 615617
Prepair 500+ v1.163 CCDC88C Zornitza Stark Marked gene: CCDC88C as ready
Prepair 500+ v1.163 CCDC88C Zornitza Stark Gene: ccdc88c has been classified as Green List (High Evidence).
Prepair 500+ v1.163 CCDC88C Zornitza Stark Phenotypes for gene: CCDC88C were changed from Hydrocephalus, nonsyndromic, autosomal recessive, 236600 (3) to Hydrocephalus, congenital, 1 MIM#236600
Prepair 500+ v1.162 CCDC88C Zornitza Stark Publications for gene: CCDC88C were set to
Prepair 500+ v1.161 CCDC39 Zornitza Stark Marked gene: CCDC39 as ready
Prepair 500+ v1.161 CCDC39 Zornitza Stark Gene: ccdc39 has been classified as Green List (High Evidence).
Prepair 500+ v1.161 CCDC39 Zornitza Stark Phenotypes for gene: CCDC39 were changed from Ciliary dyskinesia, primary, 14, 613807 (3) to Ciliary dyskinesia, primary, 14 MIM#613807
Prepair 500+ v1.160 CCDC39 Zornitza Stark Publications for gene: CCDC39 were set to
Prepair 500+ v1.159 CCDC103 Zornitza Stark Marked gene: CCDC103 as ready
Prepair 500+ v1.159 CCDC103 Zornitza Stark Gene: ccdc103 has been classified as Green List (High Evidence).
Prepair 500+ v1.159 CCDC103 Zornitza Stark Phenotypes for gene: CCDC103 were changed from Ciliary dyskinesia, primary, 17, 614679 (3) to Primary ciliary dyskinesia-17, MIM # 614679
Prepair 500+ v1.158 CCDC103 Zornitza Stark Publications for gene: CCDC103 were set to
Prepair 500+ v1.157 CCBE1 Zornitza Stark Marked gene: CCBE1 as ready
Prepair 500+ v1.157 CCBE1 Zornitza Stark Gene: ccbe1 has been classified as Green List (High Evidence).
Prepair 500+ v1.157 CCBE1 Zornitza Stark Phenotypes for gene: CCBE1 were changed from Hennekam lymphangiectasia-lymphedema syndrome 1, 235510 (3) to Hennekam lymphangiectasia-lymphoedema syndrome 1 MIM#235510
Prepair 500+ v1.156 CCBE1 Zornitza Stark Publications for gene: CCBE1 were set to
Prepair 500+ v1.155 CC2D2A Zornitza Stark Marked gene: CC2D2A as ready
Prepair 500+ v1.155 CC2D2A Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence).
Prepair 500+ v1.155 CC2D2A Zornitza Stark Phenotypes for gene: CC2D2A were changed from Joubert syndrome 9, 612285 (3) to COACH syndrome, MIM#216360; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284; Retinitis pigmentosa 93, MIM# 619845
Prepair 500+ v1.154 CC2D2A Zornitza Stark Publications for gene: CC2D2A were set to
Prepair 500+ v1.153 CC2D1A Zornitza Stark Marked gene: CC2D1A as ready
Prepair 500+ v1.153 CC2D1A Zornitza Stark Gene: cc2d1a has been classified as Green List (High Evidence).
Prepair 500+ v1.153 CC2D1A Zornitza Stark Phenotypes for gene: CC2D1A were changed from Mental retardation, autosomal recessive 3, 608443 (3) to Intellectual developmental disorder, autosomal recessive 3, MIM# 608443
Prepair 500+ v1.152 CC2D1A Zornitza Stark Publications for gene: CC2D1A were set to
Prepair 500+ v1.151 CASQ2 Zornitza Stark Marked gene: CASQ2 as ready
Prepair 500+ v1.151 CASQ2 Zornitza Stark Gene: casq2 has been classified as Green List (High Evidence).
Prepair 500+ v1.151 CASQ2 Zornitza Stark Phenotypes for gene: CASQ2 were changed from Ventricular tachycardia, catecholaminergic polymorphic, 2, 611938 (3) to Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938)
Prepair 500+ v1.150 CASK Zornitza Stark Marked gene: CASK as ready
Prepair 500+ v1.150 CASK Zornitza Stark Gene: cask has been classified as Green List (High Evidence).
Prepair 500+ v1.150 CASK Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119
Prepair 500+ v1.149 CASK Zornitza Stark Publications for gene: CASK were set to
Prepair 500+ v1.148 GNE Zornitza Stark Marked gene: GNE as ready
Prepair 500+ v1.148 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.148 GNE Zornitza Stark Phenotypes for gene: GNE were changed from Inclusion body myopathy, autosomal recessive, 600737 (3) to Nonaka myopathy MIM#605820; Thrombocytopenia 12 with or without myopathy MIM#620757
Prepair 500+ v1.147 GNE Zornitza Stark Publications for gene: GNE were set to
Prepair 500+ v1.146 GNE Zornitza Stark Classified gene: GNE as Red List (low evidence)
Prepair 500+ v1.146 GNE Zornitza Stark Gene: gne has been classified as Red List (Low Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Prepair 500+ v1.145 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.145 CLN3 Zornitza Stark Phenotypes for gene: CLN3 were changed from Ceroid lipofuscinosis, neuronal, 3, 204200 (3) to Ceroid lipofuscinosis, neuronal, 3, MIM# 204200; MONDO:0008767
Prepair 500+ v1.144 CLN3 Zornitza Stark Publications for gene: CLN3 were set to
Prepair 500+ v1.143 CLN3 Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence)
Prepair 500+ v1.143 CLN3 Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence).
Prepair 1000+ v2.7 GPR143 Zornitza Stark Tag for review tag was added to gene: GPR143.
Mendeliome v1.2511 NUDT2 Sangavi Sivagnanasundram reviewed gene: NUDT2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder with or without peripheral neuropathy, MONDO:0859240; Mode of inheritance: None
Mendeliome v1.2511 NLRP2 Sangavi Sivagnanasundram reviewed gene: NLRP2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte/zygote/embryo maturation arrest 18, MONDO:0957230; Mode of inheritance: None
Mendeliome v1.2511 NKAP Sangavi Sivagnanasundram reviewed gene: NKAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v1.2511 NDUFAF8 Sangavi Sivagnanasundram reviewed gene: NDUFAF8: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Leigh Syndrome MONDO:0009723; Mode of inheritance: None
Mendeliome v1.2511 NDUFAF7 Sangavi Sivagnanasundram reviewed gene: NDUFAF7: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Pathological Myopia MONDO:0001383; Mode of inheritance: None
Repeat Disorders v0.256 THAP11_SCA51_CAG Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Marked STR: RAPGEF2_FAME7_TTTCA as ready
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Classified STR: RAPGEF2_FAME7_TTTCA as Amber List (moderate evidence)
Genetic Epilepsy v1.145 RAPGEF2_FAME7_TTTCA Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence).
Genetic Epilepsy v1.144 RAPGEF2_FAME7_TTTCA Bryony Thompson STR: RAPGEF2_FAME7_TTTCA was added
STR: RAPGEF2_FAME7_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: RAPGEF2_FAME7_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: RAPGEF2_FAME7_TTTCA were set to 29507423; 30351492; 33791773
Phenotypes for STR: RAPGEF2_FAME7_TTTCA were set to Epilepsy, familial adult myoclonic, 7 MIM#618075
Review for STR: RAPGEF2_FAME7_TTTCA was set to AMBER
Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported.
The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat.
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.117 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Mendeliome v1.2511 DIP2B_FRA12A_CGG Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG
Hereditary Neuropathy v1.27 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Mendeliome v1.2510 ZFHX3_SCA4_GGC Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Congenital Disorders of Glycosylation v1.64 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.116 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence)
Skeletal dysplasia v0.309 XYLT1_DBQD2_GGC Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v1.63 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Congenital Disorders of Glycosylation. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.115 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Skeletal dysplasia v0.308 XYLT1_DBQD2_GGC Bryony Thompson STR: XYLT1_DBQD2_GGC was added
STR: XYLT1_DBQD2_GGC was added to Skeletal dysplasia. Sources: Literature
Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: XYLT1_DBQD2_GGC were set to 30554721
Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777
Review for STR: XYLT1_DBQD2_GGC was set to GREEN
STR: XYLT1_DBQD2_GGC was marked as clinically relevant
STR: XYLT1_DBQD2_GGC was marked as current diagnostic
Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease.
Normal: 9-20 GGC repeats
Pathogenic: 120-800 repeats
Sources: Literature
Corneal Dystrophy v1.12 TCF4_FECD3_CTG Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Marked STR: TBP_SCA17_CAG as ready
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.35 TBP_SCA17_CAG Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.34 TBP_SCA17_CAG Bryony Thompson STR: TBP_SCA17_CAG was added
STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list
Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409
Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: TBP_SCA17_CAG was set to GREEN
STR: TBP_SCA17_CAG was marked as clinically relevant
STR: TBP_SCA17_CAG was marked as current diagnostic
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Regression v0.577 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Mendeliome v1.2509 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Early-onset Dementia v1.39 TBP_SCA17_CAG Bryony Thompson SCA17 was changed to TBP_SCA17_CAG
Early-onset Parkinson disease v2.33 TAF1_XDP_CCCTCT Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT
Genetic Epilepsy v1.143 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Mendeliome v1.2508 STARD7_FAME2_ATTTC Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Classified STR: SAMD12_FAME1_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.142 SAMD12_FAME1_TTTCA Bryony Thompson Str: samd12_fame1_tttca has been classified as Green List (High Evidence).
Mendeliome v1.2507 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Genetic Epilepsy v1.141 SAMD12_FAME1_TTTCA Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA
Mendeliome v1.2506 RILPL1_OPDM4_CGG Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.58 RILPL1_OPDM4_CGG Bryony Thompson OPDM4_RILPL1_CGG was changed to RILPL1_OPDM4_CGG
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.32 ATXN8OS_SCA8_CTG Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.31 ATXN8OS_SCA8_CTG Bryony Thompson STR: ATXN8OS_SCA8_CTG was added
STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387
Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: ATXN8OS_SCA8_CTG was set to GREEN
STR: ATXN8OS_SCA8_CTG was marked as clinically relevant
STR: ATXN8OS_SCA8_CTG was marked as current diagnostic
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Literature
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.30 PPP2R2B_SCA12_CAG Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.29 PPP2R2B_SCA12_CAG Bryony Thompson STR: PPP2R2B_SCA12_CAG was added
STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021
Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: PPP2R2B_SCA12_CAG was set to GREEN
STR: PPP2R2B_SCA12_CAG was marked as clinically relevant
STR: PPP2R2B_SCA12_CAG was marked as current diagnostic
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12
Established pathogenic (used as diagnostic cut-off): ≥51 repeats
Sources: Literature
Mendeliome v1.2505 PPP2R2B_SCA12_CAG Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG
Mendeliome v1.2504 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV_PLIN4 was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.57 PLIN4_MRUPAV_33-mer Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Classified STR: PABPN1_OPMD_GCN as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.55 PABPN1_OPMD_GCN Bryony Thompson STR: PABPN1_OPMD_GCN was added
STR: PABPN1_OPMD_GCN was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: PABPN1_OPMD_GCN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for STR: PABPN1_OPMD_GCN were set to 9462747; 20301305
Phenotypes for STR: PABPN1_OPMD_GCN were set to Oculopharyngeal muscular dystrophy MIM#164300
Review for STR: PABPN1_OPMD_GCN was set to GREEN
STR: PABPN1_OPMD_GCN was marked as clinically relevant
STR: PABPN1_OPMD_GCN was marked as current diagnostic
Added comment: NM_004643.3:c.4_6[X]
Expected gain of function mechanism of disease
Normal allele: (GCN)10 / Ala10
Autosomal recessive: (GCN)11/Ala11
Autosomal dominant: (GCN)12-17
Sources: Expert list
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready
Repeat Disorders v0.255 PABPN1_OPMD_GCN Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Marked STR: NUTM2B-AS1_OPDM_CCG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Classified STR: NUTM2B-AS1_OPDM_CCG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 NUTM2B-AS1_OPDM_CCG Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.53 NUTM2B-AS1_OPDM_CCG Bryony Thompson STR: NUTM2B-AS1_OPDM_CCG was added
STR: NUTM2B-AS1_OPDM_CCG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Literature
Mode of inheritance for STR: NUTM2B-AS1_OPDM_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: NUTM2B-AS1_OPDM_CCG were set to 31332380; 37923380; 39308795; 38159879
Phenotypes for STR: NUTM2B-AS1_OPDM_CCG were set to Oculopharyngodistal myopathy MONDO:0025193
Review for STR: NUTM2B-AS1_OPDM_CCG was set to GREEN
STR: NUTM2B-AS1_OPDM_CCG was marked as clinically relevant
Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.
NR_120611.1:n.192CCG[X]
4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60.
Sources: Literature
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence).
Early-onset Dementia v1.38 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Early-onset Parkinson disease v2.28 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Mendeliome v1.2503 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Regression v0.576 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Hereditary Neuropathy v1.26 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.52 NOTCH2NLC_NIID_GGC Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC
Regression v0.575 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Mendeliome v1.2502 NOP56_SCA36_GGCCTG Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Marked STR: MARCH6_FAME3_TTTCA as ready
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Classified STR: MARCH6_FAME3_TTTCA as Green List (high evidence)
Genetic Epilepsy v1.140 MARCH6_FAME3_TTTCA Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.139 MARCH6_FAME3_TTTCA Bryony Thompson STR: MARCH6_FAME3_TTTCA was added
STR: MARCH6_FAME3_TTTCA was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for STR: MARCH6_FAME3_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: MARCH6_FAME3_TTTCA were set to 31664039
Phenotypes for STR: MARCH6_FAME3_TTTCA were set to Epilepsy, familial adult myoclonic, 3 MIM#613608
Review for STR: MARCH6_FAME3_TTTCA was set to GREEN
STR: MARCH6_FAME3_TTTCA was marked as clinically relevant
STR: MARCH6_FAME3_TTTCA was marked as current diagnostic
Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells.
Sources: Literature
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.51 LRP12_OPDM1_CGG Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG
Motor Neurone Disease v1.33 LRP12_ALS_CGG Bryony Thompson LRP12-ALS_CGG was changed to LRP12_ALS_CGG
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence)
Early-onset Parkinson disease v2.27 JPH3_HDL2_CTG Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Early-onset Parkinson disease v2.26 JPH3_HDL2_CTG Bryony Thompson STR: JPH3_HDL2_CTG was added
STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701
Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438
Review for STR: JPH3_HDL2_CTG was set to GREEN
STR: JPH3_HDL2_CTG was marked as clinically relevant
STR: JPH3_HDL2_CTG was marked as current diagnostic
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29
Sources: Literature
Early-onset Dementia v1.37 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Mendeliome v1.2501 JPH3_HDL2_CTG Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG
Early-onset Parkinson disease v2.25 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Incidentalome v0.316 HTT_HD_CAG Bryony Thompson HD was changed to HTT_HD_CAG
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Genetic Epilepsy v1.138 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.114 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Genetic Epilepsy v1.137 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence)
Aminoacidopathy v1.135 GLS_GDPAG_GCA Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.113 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Aminoacidopathy v1.134 GLS_GDPAG_GCA Bryony Thompson STR: GLS_GDPAG_GCA was added
STR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list
Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: GLS_GDPAG_GCA were set to 30970188
Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412
Review for STR: GLS_GDPAG_GCA was set to GREEN
STR: GLS_GDPAG_GCA was marked as clinically relevant
STR: GLS_GDPAG_GCA was marked as current diagnostic
Added comment: NM_014905.5(GLS):c.-212_-210GCA[X]
3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease.
Sources: Expert list
Miscellaneous Metabolic Disorders v1.49 GLS_GDPAG_GCA Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA
Mendeliome v1.2500 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.50 GIPC1_OPDM2_CGG Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG
Hereditary Neuropathy v1.25 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Hereditary Neuropathy v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Marked STR: FXN_FRDA_GAA as ready
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy v1.25 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Hereditary Neuropathy v1.25 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence)
Mitochondrial disease v0.973 FXN_FRDA_GAA Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence).
Hereditary Neuropathy v1.24 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Mitochondrial disease v0.972 FXN_FRDA_GAA Bryony Thompson STR: FXN_FRDA_GAA was added
STR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list
Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916
Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300
Review for STR: FXN_FRDA_GAA was set to GREEN
STR: FXN_FRDA_GAA was marked as clinically relevant
STR: FXN_FRDA_GAA was marked as current diagnostic
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Ataxia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Ataxia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Ataxia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Ataxia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy v1.23 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Hereditary Neuropathy v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Hereditary Neuropathy v1.23 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Hereditary Neuropathy v1.23 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Blepharophimosis v1.3 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence)
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 FOXL2_BPES_GCN Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).
Blepharophimosis v1.2 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.346 FOXL2_BPES_GCN Bryony Thompson STR: FOXL2_BPES_GCN was added
STR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature
Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808
Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996
Review for STR: FOXL2_BPES_GCN was set to GREEN
STR: FOXL2_BPES_GCN was marked as clinically relevant
STR: FOXL2_BPES_GCN was marked as current diagnostic
Added comment: NM_023067.2:c.661_702[X]
Mechanism of disease is polyAlanine tract leading to a loss of function of the protein
Normal repeat number: 14
Pathogenic repeat number: 19-24
Sources: Literature
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Marked STR: FMR1_FXS_CGG as ready
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.112 FMR1_FXS_CGG Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.24 FMR1_FXTAS_CGG Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG
Intellectual disability syndromic and non-syndromic v1.111 FMR1_FXS_CGG Bryony Thompson STR: FMR1_FXS_CGG was added
STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184
Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624
Review for STR: FMR1_FXS_CGG was set to GREEN
STR: FMR1_FXS_CGG was marked as clinically relevant
STR: FMR1_FXS_CGG was marked as current diagnostic
Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200
Sources: Expert list
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Marked STR: FMR1_FXPOI_CGG as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 FMR1_FXPOI_CGG Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Pierre Robin Sequence v0.49 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Clefting disorders v0.264 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Mandibulofacial Acrofacial dysostosis v1.14 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)
Intellectual disability syndromic and non-syndromic v1.110 EIF4A3_RCPS_complex Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
Pierre Robin Sequence v0.48 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Literature
Clefting disorders v0.263 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Mandibulofacial Acrofacial dysostosis v1.13 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Intellectual disability syndromic and non-syndromic v1.109 EIF4A3_RCPS_complex Bryony Thompson STR: EIF4A3_RCPS_complex was added
STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243
Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Review for STR: EIF4A3_RCPS_complex was set to GREEN
STR: EIF4A3_RCPS_complex was marked as clinically relevant
STR: EIF4A3_RCPS_complex was marked as current diagnostic
Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: Expert list
Prepair 500+ v1.142 CAPN3 Zornitza Stark Marked gene: CAPN3 as ready
Prepair 500+ v1.142 CAPN3 Zornitza Stark Gene: capn3 has been classified as Green List (High Evidence).
Prepair 500+ v1.142 CAPN3 Zornitza Stark Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600
Prepair 500+ v1.141 CAPN3 Zornitza Stark Publications for gene: CAPN3 were set to
Prepair 500+ v1.140 CANT1 Zornitza Stark Marked gene: CANT1 as ready
Prepair 500+ v1.140 CANT1 Zornitza Stark Gene: cant1 has been classified as Green List (High Evidence).
Prepair 500+ v1.140 CANT1 Zornitza Stark Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719
Prepair 500+ v1.139 CANT1 Zornitza Stark Publications for gene: CANT1 were set to
Prepair 500+ v1.138 C5orf42 Zornitza Stark Marked gene: C5orf42 as ready
Prepair 500+ v1.138 C5orf42 Zornitza Stark Gene: c5orf42 has been classified as Green List (High Evidence).
Prepair 500+ v1.138 C5orf42 Zornitza Stark Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170
Prepair 500+ v1.137 C5orf42 Zornitza Stark Publications for gene: C5orf42 were set to
Infertility and Recurrent Pregnancy Loss v0.77 MEIOB Jasmine Chew gene: MEIOB was added
gene: MEIOB was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MEIOB was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MEIOB were set to 28206990; 34392356; 35991565; 37715646; 31000419; 39545410; 30838384
Phenotypes for gene: MEIOB were set to Premature ovarian failure 23, MIM# 620686; Spermatogenic failure 22, MIM# 617706
Review for gene: MEIOB was set to GREEN
Added comment: Literature in OMIM- PMID: 28206990; 34392356; 35991565; 37715646; 31000419- multiple unrelated infertile males due to spermatogenic failure and females due to premature ovarian failure carrying biallelic variants, supported by functional evidence.

New papers:
i) PMID: 39545410- previously reported homozygous nonsense p.(Arg272*) in proband 2136 (Egyptian), with a history of 6 early miscarriages, 3 failed intracytoplasmic sperm injection cycles, 1 HM, and low anti-Müllerian hormone (AMH) (2 times ≤0.2 ng/mL).

ii) PMID: 30838384- A novel homozygous frameshift variant in two brothers of Arab ethnicity. This frame-shift is predicted to result in a truncated MEIOB protein, which lacks the conserved C-terminal DNA binding domain.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 SYCP2 Jasmine Chew changed review comment from: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for Hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature; to: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 SYCP2 Jasmine Chew gene: SYCP2 was added
gene: SYCP2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: SYCP2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SYCP2 were set to 31866047; 39202451; 38511217; 37337432; 39545410
Phenotypes for gene: SYCP2 were set to Spermatogenic failure 1, MIM# 258150; Hydatidiform mole
Review for gene: SYCP2 was set to GREEN
Added comment: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.

New papers (monoallelic and biallelic variants for male infertility):
i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia.

ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).

iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA.

New paper (biallelic variant for Hydatidiform mole):
i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410- Compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 CCDC155 Jasmine Chew gene: CCDC155 was added
gene: CCDC155 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: CCDC155 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CCDC155 were set to 29790874; 35674372; 36864840; 35708642; 39545410
Phenotypes for gene: CCDC155 were set to Premature ovarian failure 22, MIM# 620548; Spermatogenic failure 88, MIM# 620547
Review for gene: CCDC155 was set to GREEN
Added comment: Note- HGNC Approved Gene Symbol: KASH5

Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants

New paper:
i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 C11orf80 Jasmine Chew edited their review of gene: C11orf80: Changed publications: 30388401, 36732965
Infertility and Recurrent Pregnancy Loss v0.77 MAJIN Jasmine Chew gene: MAJIN was added
gene: MAJIN was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MAJIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MAJIN were set to 39545410; 33211200
Phenotypes for gene: MAJIN were set to Recurrent hydatidiform mole, non-obstructive azoospermia
Review for gene: MAJIN was set to AMBER
Added comment: New papers (biallelic variant for HM/male infertility):
i) PMID: 39545410- Novel homozygous splice donor site variant c.349+1G>T in patient 1824 (Italian) with 2 HMs followed by secondary infertility and substantially reduced bilateral ovarian volumes. MAJIN codes for a junction protein that forms a complex with TERB1 and TERB2, which together bind to telomeres and anchor them to the inner nuclear membrane components KASH5 and SUN1. This attachment of chromosomes to the nuclear envelope is essential for homologous chromosome movement and synapsis. In mice, both male and female null mutants Majin are infertile (PMID: 26548954). In humans, biallelic mutations in MAJIN have been reported in infertile males.

ii) PMID: 33211200- A homozygous p.Arg53His in NOA-affected male (Individual 4- M1646) with high CADD scores and low gnomad freq. Mice disrupted for either Majin or Terb2 display impaired synapsis, zygotene arrest, a lack of postmeiotic cells and infertility (Shibuya et al. 2015; Zhang et al. 2017).
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 C11orf80 Jasmine Chew gene: C11orf80 was added
gene: C11orf80 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: C11orf80 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C11orf80 were set to Recurrent hydatidiform mole 4, MIM # 618432
Review for gene: C11orf80 was set to AMBER
Added comment: Note: HGNC Approved Gene Symbol- TOP6BL

Literature in OMIM- PubMed: 30388401- Two unrelated females with RHMs carrying a homozygous p.Glu262∗ and p.Ser501Pro, respectively.

New paper (biallelic variants for OZEMA/NOA)
i) PMID: 36732965- A homozygous LOF p.E162* in four infertile siblings born to a consanguineous marriage, with three brothers suffering from non-obstructive azoospermia and one sister suffering from unexplained infertility. Mouse models carrying similar mutations to that in patients recapitulated the spermatogenic abnormalities of the patient.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 DNAAF4 Jasmine Chew gene: DNAAF4 was added
gene: DNAAF4 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: DNAAF4 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DNAAF4 were set to 23872636; 37674365; 37147940; 36583018; 35903363
Phenotypes for gene: DNAAF4 were set to Primary ciliary dyskinesia 25, MIM# 615482
Review for gene: DNAAF4 was set to GREEN
Added comment: Literature in OMIM- PMID: 23872636- biallelic variants reported for PCD, and reduced fertility was observed.

New papers (biallelic variants reported for PCD/ infertility):
i) PMID: 37674365- A novel homozygous splice acceptor site variant in DNAAF4 in two brother with asthenozoospermia. Functional assay revealed the absence of any exon 7-containing DNAAF4 transcripts in the sperm from P1, unlike in a normal control sample, consistent with the dysfunction or loss of DNAAF4 protein expression that may explain the abnormal sperm phenotypes in this patient.

ii) PMID: 37147940- Novel compound heterozygous splice site c.784-1G>A and 20.1 Kb deletion in a male with PCD and asthenoteratozoospermia, resulting in a truncated and functionless DNAAF4 protein. mmunofluorescence analysis indicated that the inner dynein arm was not present in the sperm flagellum, and sperm morphological analysis revealed small sperm with twisted and curved flagella or lacking flagella.

iii) PMID: 36583018- A novel homozygous p. G373E variant in a female patient with PCD who was born in a consanguineous family. Functional assays showed that the variant lead to PCD by reducing the stability of DNAAF4 protein.

iv) PMID: 35903363- Two homozygous variants, Arg330Trp and p.Arg245*, identified in two unrelated male and female with PCD. The affected male had asthenoteratozoospermia while female with primary infertility.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 TBPL2 Jasmine Chew gene: TBPL2 was added
gene: TBPL2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: TBPL2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TBPL2 were set to 37804378; 33966269; 33893736; 33541821
Phenotypes for gene: TBPL2 were set to Oocyte maturation arrest
Review for gene: TBPL2 was set to GREEN
Added comment: New papers reporting biallelic variants in infertile women:
i) PMID: 37804378- Compound heterozygous novel p.Arg268Ter and recurrent p.Arg233Ter in a female with impaired ovarian folliculogenesis. Structure prediction by molecular modeling demonstrated that three-dimensional structure of TBPL2 was destabilized in mutant proteins.

ii) PMID: 33966269- Homozygous missense mutation p.C299R in two infertile sisters with oocyte maturation arrest and degeneration from a consanguineous family. Functional assays showed that the transcriptional level of ZP3 was not completely blocked but severely reduced by the regulation of the mutant TBPL2, while the transcriptional level of H2Bc was significantly reduced but to a less severe extent compared with that of ZP3, suggesting that the missense had a damage to the transcription initiation function of TBPL2 and its downstream targeted genes got involved in different degrees. The mutant protein also has less stability, which contributes to the lower activity of transcription initiation in the mutant form.

iii) PMID: 33893736- Homozygous splicing variant (c.788 + 3A>G) in two unrelated families characterized by oocyte maturation defects. Functional assays showed that the variant disrupted the integrity of TBPL2 mRNA and affected oocytes showed that vital genes for oocyte maturation and fertilization were widely and markedly downregulated, suggesting that a mutation in TBPL2, led to global gene alterations in oocytes; the same variant reported before in PMID: 33541821 in three affected females with diminished ovarian reserve from 3 independent families.
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew changed review comment from: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others- PMID: 32741963, PMID: 36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature; to: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others: PMID: 32741963;36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew edited their review of gene: MEI1: Changed publications: 30388401, 38416203, 34037756, 36759719, 32741963, 36017582
Infertility and Recurrent Pregnancy Loss v0.77 MEI1 Jasmine Chew gene: MEI1 was added
gene: MEI1 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: MEI1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MEI1 were set to 30388401
Phenotypes for gene: MEI1 were set to Recurrent hydatidiform mole 3, MIM# 618431; Non-obstructive azoospermia
Review for gene: MEI1 was set to GREEN
Added comment: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)

New papers (biallelic variants for OZEMA):
i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles.

ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.

New papers (biallelic variants for NOA):
i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.
- others- PMID: 32741963, PMID: 36017582

Note: Moderate evidence for OZEMA and HM in FeRGI database
Sources: Literature
Infertility and Recurrent Pregnancy Loss v0.77 FOXL2 Jasmine Chew gene: FOXL2 was added
gene: FOXL2 was added to Infertility and Pregnancy Loss. Sources: Literature
Mode of inheritance for gene: FOXL2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: FOXL2 were set to 12149404; 19429596; 38558253; 36793102; 39545410
Phenotypes for gene: FOXL2 were set to Premature ovarian failure 3, #MIM 608996
Added comment: Literature in OMIM- PubMed: 12149404; 19429596- multiple patients with isolated POF carrying monoallelic variants

New papers (monoallelic variants for POI):
i) PMID: 38558253- One in-frame deletion and 13 missense variants, including two recurrent ones (p.(Pro212Ala) and p.(Arg349Gly) in 14 patients with POI/DOR. Two variants, (p.(Gly187Asp) and p.(Arg349Gly) have been previously identified in patients with non-syndromic POI (PMID: 19429596 and PMID: 36793102).

ii) PMID: 36793102- Sixteen POI patients carrying four different heterozygous variants, including the recurrent p.(Arg349Gly). Functional assay on the recurrent variant showed that the mutant FOXL2 did not present with the transcriptional repressive effect on CYP17A1 expression as shown by wild-type protein.

New paper (biallelic variants for HM):
i) PMID: 39545410- A novel homozygous missense p.(Phe167Ser) in patient 1690 (South Asian) with 5 CHMs, 3 miscarriages, 1 stillbirth, and 1 live birth. FOXL2 is essential for granulosa cell differentiation and proliferation, as well as ovarian maintenance and function.Therefore, its impairment may affect indirectly the meiotic maturation of oocytes, and may consequently lead to molar pregnancies.
Sources: Literature
Mendeliome v1.2499 KEL Achchuthan Shanmugasundram reviewed gene: KEL: Rating: AMBER; Mode of pathogenicity: None; Publications: 30578106, 37978175; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Mendeliome v1.2499 NOS3 Achchuthan Shanmugasundram reviewed gene: NOS3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36941667, 37383439; Phenotypes: Moyamoya disease, MONDO:0016820; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Marked gene: NLRP7 as ready
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Classified gene: NLRP7 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.77 NLRP7 Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Marked gene: MOS as ready
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Gene: mos has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Classified gene: MOS as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.76 MOS Zornitza Stark Gene: mos has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Marked gene: MUSK as ready
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Added comment: Comment when marking as ready: Severe fetal anomalies can lead to pregnancy loss; however, this is more in scope for the Fetal Anomalies panel.
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Classified gene: MUSK as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.75 MUSK Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Marked gene: DNAH11 as ready
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Classified gene: DNAH11 as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.74 DNAH11 Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Marked gene: LHCGR as ready
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Classified gene: LHCGR as Green List (high evidence)
Infertility and Recurrent Pregnancy Loss v0.73 LHCGR Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence).
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Marked gene: FRAS1 as ready
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Added comment: Comment when marking as ready: Severe fetal abnormalities can cause pregnancy loss. However, this is more in scope for Fetal anomalies panel.
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Classified gene: FRAS1 as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.72 FRAS1 Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Added comment: Comment when marking as ready: Mechanism of pregnancy loss unclear, could be chance observation.
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Marked gene: GBE1 as ready
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Classified gene: GBE1 as Amber List (moderate evidence)
Infertility and Recurrent Pregnancy Loss v0.71 GBE1 Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence).
Prepair 500+ v1.136 BTK Zornitza Stark Marked gene: BTK as ready
Prepair 500+ v1.136 BTK Zornitza Stark Gene: btk has been classified as Green List (High Evidence).
Prepair 500+ v1.136 BTK Zornitza Stark Phenotypes for gene: BTK were changed from Agammaglobulinemia and isolated hormone deficiency, 307200 (3) to Agammaglobulinemia, X-linked 1 MIM#300755; Bruton-type agammaglobulinemia MONDO:0010421; Isolated growth hormone deficiency, type III, with agammaglobulinemia MIM#307200 MONDO:0010615
Prepair 500+ v1.135 BTK Zornitza Stark Publications for gene: BTK were set to
Prepair 500+ v1.134 BSND Zornitza Stark Marked gene: BSND as ready
Prepair 500+ v1.134 BSND Zornitza Stark Gene: bsnd has been classified as Green List (High Evidence).
Prepair 500+ v1.134 BSND Zornitza Stark Phenotypes for gene: BSND were changed from Bartter syndrome, type 4a, 602522 (3) to Bartter syndrome, type 4a MIM#602522
Prepair 500+ v1.133 BSND Zornitza Stark Publications for gene: BSND were set to
Prepair 500+ v1.132 BRWD3 Zornitza Stark Marked gene: BRWD3 as ready
Prepair 500+ v1.132 BRWD3 Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence).
Prepair 500+ v1.132 BRWD3 Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659
Prepair 500+ v1.131 BRWD3 Zornitza Stark Publications for gene: BRWD3 were set to
Prepair 500+ v1.130 BRAT1 Zornitza Stark Marked gene: BRAT1 as ready
Prepair 500+ v1.130 BRAT1 Zornitza Stark Gene: brat1 has been classified as Green List (High Evidence).
Prepair 500+ v1.130 BRAT1 Zornitza Stark Phenotypes for gene: BRAT1 were changed from Rigidity and multifocal seizure syndrome, lethal neonatal, 614498 (3) to Rigidity and multifocal seizure syndrome, lethal neonatal, MIM#614498; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056
Prepair 500+ v1.129 BRAT1 Zornitza Stark Publications for gene: BRAT1 were set to
Prepair 500+ v1.128 BLM Zornitza Stark Marked gene: BLM as ready
Prepair 500+ v1.128 BLM Zornitza Stark Gene: blm has been classified as Green List (High Evidence).
Prepair 500+ v1.128 BLM Zornitza Stark Phenotypes for gene: BLM were changed from Bloom syndrome, 210900 (3) to Bloom Syndrome MIM# 210900
Prepair 500+ v1.127 BLM Zornitza Stark Publications for gene: BLM were set to
Prepair 500+ v1.126 BCS1L Zornitza Stark Marked gene: BCS1L as ready
Prepair 500+ v1.126 BCS1L Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence).
Prepair 500+ v1.126 BCS1L Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, 603358 (3) to GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type 1, MIM#124000
Prepair 500+ v1.125 BCS1L Zornitza Stark Publications for gene: BCS1L were set to
Prepair 500+ v1.124 BCKDHB Zornitza Stark Marked gene: BCKDHB as ready
Prepair 500+ v1.124 BCKDHB Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence).
Prepair 500+ v1.124 BCKDHB Zornitza Stark Phenotypes for gene: BCKDHB were changed from Maple syrup urine disease, type Ib, 248600 (3) to Maple syrup urine disease, type Ib 620698
Prepair 500+ v1.123 BCKDHB Zornitza Stark Publications for gene: BCKDHB were set to
Prepair 500+ v1.122 BCKDHA Zornitza Stark Marked gene: BCKDHA as ready
Prepair 500+ v1.122 BCKDHA Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence).
Prepair 500+ v1.122 BCKDHA Zornitza Stark Phenotypes for gene: BCKDHA were changed from Maple syrup urine disease, type Ia, 248600 (3) to Maple syrup urine disease, type Ia, MIM# 248600
Prepair 500+ v1.121 BCKDHA Zornitza Stark Publications for gene: BCKDHA were set to
Prepair 500+ v1.120 BBS9 Zornitza Stark Marked gene: BBS9 as ready
Prepair 500+ v1.120 BBS9 Zornitza Stark Gene: bbs9 has been classified as Green List (High Evidence).
Prepair 500+ v1.120 BBS9 Zornitza Stark Phenotypes for gene: BBS9 were changed from Bardet-Biedl syndrome 9, 615986 (3) to Bardet-Biedl syndrome 9 MIM#615986
Prepair 500+ v1.119 BBS9 Zornitza Stark Publications for gene: BBS9 were set to
Prepair 500+ v1.118 BBS7 Zornitza Stark Marked gene: BBS7 as ready
Prepair 500+ v1.118 BBS7 Zornitza Stark Gene: bbs7 has been classified as Green List (High Evidence).
Prepair 500+ v1.118 BBS7 Zornitza Stark Phenotypes for gene: BBS7 were changed from Bardet-Biedl syndrome 7, 615984 (3) to Bardet-Biedl syndrome 7, MIM# 615984; MONDO:0014435
Prepair 500+ v1.117 BBS7 Zornitza Stark Publications for gene: BBS7 were set to
Prepair 500+ v1.116 BBS5 Zornitza Stark Marked gene: BBS5 as ready
Prepair 500+ v1.116 BBS5 Zornitza Stark Gene: bbs5 has been classified as Green List (High Evidence).
Prepair 500+ v1.116 BBS5 Zornitza Stark Phenotypes for gene: BBS5 were changed from Bardet-Biedl syndrome 5, 615983 (3) to Bardet-Biedl syndrome 5, MIM#615983; MONDO:0014434
Prepair 500+ v1.115 BBS5 Zornitza Stark Publications for gene: BBS5 were set to
Prepair 500+ v1.114 BBS4 Zornitza Stark Marked gene: BBS4 as ready
Prepair 500+ v1.114 BBS4 Zornitza Stark Gene: bbs4 has been classified as Green List (High Evidence).
Prepair 500+ v1.114 BBS4 Zornitza Stark Phenotypes for gene: BBS4 were changed from Bardet-Biedl syndrome 4, 615982 (3) to Bardet-Biedl syndrome 4, MIM#615982
Prepair 500+ v1.113 BBS2 Zornitza Stark Marked gene: BBS2 as ready
Prepair 500+ v1.113 BBS2 Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence).
Prepair 500+ v1.113 BBS2 Zornitza Stark Phenotypes for gene: BBS2 were changed from Bardet-Biedl syndrome 2, 615981 (3) to Bardet-Biedl syndrome 2, MIM#615981
Prepair 500+ v1.112 BBS12 Zornitza Stark Marked gene: BBS12 as ready
Prepair 500+ v1.112 BBS12 Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence).
Prepair 500+ v1.112 BBS12 Zornitza Stark Phenotypes for gene: BBS12 were changed from Bardet-Biedl syndrome 12, 615989 (3) to Bardet-Biedl syndrome 12, MIM#615989
Prepair 500+ v1.111 BBS10 Zornitza Stark Marked gene: BBS10 as ready
Prepair 500+ v1.111 BBS10 Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence).
Prepair 500+ v1.111 BBS10 Zornitza Stark Phenotypes for gene: BBS10 were changed from Bardet-Biedl syndrome 10, 615987 (3) to Bardet-Biedl syndrome 10 (MIM#615987)
Prepair 500+ v1.110 BBS10 Zornitza Stark Publications for gene: BBS10 were set to
Prepair 500+ v1.109 BBS1 Zornitza Stark Marked gene: BBS1 as ready
Prepair 500+ v1.109 BBS1 Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence).
Prepair 500+ v1.109 BBS1 Zornitza Stark Phenotypes for gene: BBS1 were changed from Bardet-Biedl syndrome 1, 209900 (3) to Bardet-Biedl syndrome 1, MIM# 209900
Prepair 500+ v1.108 BBS1 Zornitza Stark Publications for gene: BBS1 were set to
Prepair 500+ v1.107 B3GLCT Zornitza Stark Marked gene: B3GLCT as ready
Prepair 500+ v1.107 B3GLCT Zornitza Stark Gene: b3glct has been classified as Green List (High Evidence).
Prepair 500+ v1.107 B3GLCT Zornitza Stark Phenotypes for gene: B3GLCT were changed from Peters-plus syndrome, 261540 (3) to Peters-plus syndrome (MIM#261540)
Prepair 500+ v1.106 B3GLCT Zornitza Stark Publications for gene: B3GLCT were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.49 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Intellectual disability syndromic and non-syndromic v1.108 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2499 DMPK_DM1_CTG Bryony Thompson DM1 was changed to DMPK_DM1_CTG
Mendeliome v1.2498 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence).
Callosome v0.542 DAB1_SCA37_ATTTC Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Genetic Epilepsy v1.136 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence)
Progressive Myoclonic Epilepsy v0.21 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence).
Progressive Myoclonic Epilepsy v0.20 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Progressive Myoclonic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Genetic Epilepsy v1.135 CSTB_EPM1_CCCCGCCCCGCG Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added
STR: CSTB_EPM1_CCCCGCCCCGCG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745
Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant
STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Expert list
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Marked STR: CNBP_DM2_CCTG as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Classified STR: CNBP_DM2_CCTG as Green List (high evidence)
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 CNBP_DM2_CCTG Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.47 CNBP_DM2_CCTG Bryony Thompson STR: CNBP_DM2_CCTG was added
STR: CNBP_DM2_CCTG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list
Mode of inheritance for STR: CNBP_DM2_CCTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: CNBP_DM2_CCTG were set to 20301639; 11486088
Phenotypes for STR: CNBP_DM2_CCTG were set to Myotonic dystrophy 2 MIM#602668
Review for STR: CNBP_DM2_CCTG was set to GREEN
STR: CNBP_DM2_CCTG was marked as clinically relevant
STR: CNBP_DM2_CCTG was marked as current diagnostic
Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X]
Toxic gain of function RNA expected mechanism of disease
Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions
Unknown significance (normal vs. mutable): 27-29 CCTG repeats
Mutable normal (premutation) alleles. ~30-~54 CCTG repeats
Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats
Pathogenic: ~75-11,000 CCTG repeats
Sources: Expert list
Mendeliome v1.2497 CNBP_DM2_CCTG Bryony Thompson DM2 was changed to CNBP_DM2_CCTG
Dystonia and Chorea v0.280 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Incidentalome v0.315 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Parkinson disease v2.23 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Motor Neurone Disease v1.32 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Early-onset Dementia v1.36 C9orf72_FTDALS_GGGGCC Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC
Mendeliome v1.2496 BEAN1_SCA31_TGGAA Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA
Mendeliome v1.2495 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Syndromic Retinopathy v0.223 ATXN7_SCA7_CAG Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.22 ATXN3_SCA3_CAG Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.21 ATXN3_SCA3_CAG Bryony Thompson STR: ATXN3_SCA3_CAG was added
STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606
Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: ATXN3_SCA3_CAG was set to GREEN
STR: ATXN3_SCA3_CAG was marked as clinically relevant
STR: ATXN3_SCA3_CAG was marked as current diagnostic
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Literature
Mendeliome v1.2494 ATXN3_SCA3_CAG Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence)
Early-onset Parkinson disease v2.20 ATXN2_SCA2_CAG Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence).
Early-onset Parkinson disease v2.19 ATXN2_SCA2_CAG Bryony Thompson STR: ATXN2_SCA2_CAG was added
STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature
Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452
Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: ATXN2_SCA2_CAG was set to GREEN
STR: ATXN2_SCA2_CAG was marked as clinically relevant
STR: ATXN2_SCA2_CAG was marked as current diagnostic
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Literature
Motor Neurone Disease v1.31 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Mendeliome v1.2493 ATXN2_SCA2_CAG Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG
Mendeliome v1.2492 ATXN1_SCA1_CAG Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG
Early-onset Parkinson disease v2.18 ATXN1_SCA1_CAG Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG
Mendeliome v1.2491 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Callosome v0.541 ATXN10_SCA10_ATTCT Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Classified gene: ATXN10 as Red List (low evidence)
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Added comment: Comment on list classification: Only a single family reported
Early-onset Parkinson disease v2.17 ATXN10 Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence).
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Classified STR: ATN1_DRPLA_CAG as Green List (high evidence)
Genetic Epilepsy v1.134 ATN1_DRPLA_CAG Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence).
Genetic Epilepsy v1.133 ATN1_DRPLA_CAG Bryony Thompson STR: ATN1_DRPLA_CAG was added
STR: ATN1_DRPLA_CAG was added to Genetic Epilepsy. Sources: Expert list
Mode of inheritance for STR: ATN1_DRPLA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: ATN1_DRPLA_CAG were set to 8136840; 8136826; 29325606; 20301664
Phenotypes for STR: ATN1_DRPLA_CAG were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: ATN1_DRPLA_CAG was set to GREEN
STR: ATN1_DRPLA_CAG was marked as clinically relevant
STR: ATN1_DRPLA_CAG was marked as current diagnostic
Added comment: NM_001007026​.1:c.1462_1464CAG[X]
Toxic gain of function mechanism of disease
Benign: ≤35 repeats
Mutable normal: 20-35 repeats
Pathogenic: ≥48 repeats
Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Early-onset Dementia v1.35 ATN1_DRPLA_CAG Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Marked gene: CAPRIN1 as ready
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence)
Early-onset Dementia v1.34 CAPRIN1 Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.279 NACC1 Bryony Thompson Marked gene: NACC1 as ready
Dystonia and Chorea v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.279 NACC1 Bryony Thompson Classified gene: NACC1 as Green List (high evidence)
Dystonia and Chorea v0.279 NACC1 Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence).
Dystonia and Chorea v0.278 NAA15 Bryony Thompson Marked gene: NAA15 as ready