Mendeliome
STR: EIF4A3_RCPS_complex Green List (high evidence)Green List (high evidence)
NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: LiteratureCreated: 5 Sep 2021, 4 p.m.
Mode of inheritance
BIALLELIC, autosomal or pseudoautosomal
Phenotypes
Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Publications
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).
STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Mendeliome. Sources: Expert Review Green,Literature paediatric-onset tags were added to STR: EIF4A3_RCPS_complex. Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
If promoting or demoting a gene, please provide comments to justify a decision to move it.
Genes included in a Genomics England gene panel for a rare disease category (green list) should fit the criteria A-E outlined below.
These guidelines were developed as a combination of the ClinGen DEFINITIVE evidence for a causal role of the gene in the disease(a), and the Developmental Disorder Genotype-Phenotype (DDG2P) CONFIRMED DD Gene evidence level(b) (please see the original references provided below for full details). These help provide a guideline for expert reviewers when assessing whether a gene should be on the green or the red list of a panel.
A. There are plausible disease-causing mutations(i) within, affecting or encompassing an interpretable functional region(ii) of this gene identified in multiple (>3) unrelated cases/families with the phenotype(iii).
OR
B. There are plausible disease-causing mutations(i) within, affecting or encompassing cis-regulatory elements convincingly affecting the expression of a single gene identified in multiple (>3) unrelated cases/families with the phenotype(iii).
OR
C. As definitions A or B but in 2 or 3 unrelated cases/families with the phenotype, with the addition of convincing bioinformatic or functional evidence of causation e.g. known inborn error of metabolism with mutation in orthologous gene which is known to have the relevant deficient enzymatic activity in other species; existence of an animal model which recapitulates the human phenotype.
AND
D. Evidence indicates that disease-causing mutations follow a Mendelian pattern of causation appropriate for reporting in a diagnostic setting(iv).
AND
E. No convincing evidence exists or has emerged that contradicts the role of the gene in the specified phenotype.
(i)Plausible disease-causing mutations: Recurrent de novo mutations convincingly affecting gene function. Rare, fully-penetrant mutations - relevant genotype never, or very rarely, seen in controls. (ii) Interpretable functional region: ORF in protein coding genes miRNA stem or loop. (iii) Phenotype: the rare disease category, as described in the eligibility statement. (iv) Intermediate penetrance genes should not be included.
It’s assumed that loss-of-function variants in this gene can cause the disease/phenotype unless an exception to this rule is known. We would like to collect information regarding exceptions. An example exception is the PCSK9 gene, where loss-of-function variants are not relevant for a hypercholesterolemia phenotype as they are associated with increased LDL-cholesterol uptake via LDLR (PMID: 25911073).
If a curated set of known-pathogenic variants is available for this gene-phenotype, please contact us at panelapp@genomicsengland.co.uk
We classify loss-of-function variants as those with the following Sequence Ontology (SO) terms:
Term descriptions can be found on the PanelApp homepage and Ensembl.
If you are submitting this evaluation on behalf of a clinical laboratory please indicate whether you report variants in this gene as part of your current diagnostic practice by checking the box
Standardised terms were used to represent the gene-disease mode of inheritance, and were mapped to commonly used terms from the different sources. Below each of the terms is described, along with the equivalent commonly-used terms.
A variant on one allele of this gene can cause the disease, and imprinting has not been implicated.
A variant on the paternally-inherited allele of this gene can cause the disease, if the alternate allele is imprinted (function muted).
A variant on the maternally-inherited allele of this gene can cause the disease, if the alternate allele is imprinted (function muted).
A variant on one allele of this gene can cause the disease. This is the default used for autosomal dominant mode of inheritance where no knowledge of the imprinting status of the gene required to cause the disease is known. Mapped to the following commonly used terms from different sources: autosomal dominant, dominant, AD, DOMINANT.
A variant on both alleles of this gene is required to cause the disease. Mapped to the following commonly used terms from different sources: autosomal recessive, recessive, AR, RECESSIVE.
The disease can be caused by a variant on one or both alleles of this gene. Mapped to the following commonly used terms from different sources: autosomal recessive or autosomal dominant, recessive or dominant, AR/AD, AD/AR, DOMINANT/RECESSIVE, RECESSIVE/DOMINANT.
A variant on one allele of this gene can cause the disease, however a variant on both alleles of this gene can result in a more severe form of the disease/phenotype.
A variant in this gene can cause the disease in males as they have one X-chromosome allele, whereas a variant on both X-chromosome alleles is required to cause the disease in females. Mapped to the following commonly used term from different sources: X-linked recessive.
A variant in this gene can cause the disease in males as they have one X-chromosome allele. A variant on one allele of this gene may also cause the disease in females, though the disease/phenotype may be less severe and may have a later-onset than is seen in males. X-linked inactivation and mosaicism in different tissues complicate whether a female presents with the disease, and can change over their lifetime. This term is the default setting used for X-linked genes, where it is not known definitately whether females require a variant on each allele of this gene in order to be affected. Mapped to the following commonly used terms from different sources: X-linked dominant, x-linked, X-LINKED, X-linked.
The gene is in the mitochondrial genome and variants within this can cause this disease, maternally inherited. Mapped to the following commonly used term from different sources: Mitochondrial.
Mapped to the following commonly used terms from different sources: Unknown, NA, information not provided.
For example, if the mode of inheritance is digenic, please indicate this in the comments and which other gene is involved.