| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Prepair 500+ v1.326 | EIF2B1 | Zornitza Stark Phenotypes for gene: EIF2B1 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 1, with or without ovarian failure MIM#603896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.325 | EIF2B1 | Zornitza Stark Publications for gene: EIF2B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Marked gene: EIF2AK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Gene: eif2ak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.324 | EIF2AK3 | Zornitza Stark Phenotypes for gene: EIF2AK3 were changed from Wolcott-Rallison syndrome, 226980 (3) to Wolcott-Rallison syndrome MIM#226980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.323 | EIF2AK3 | Zornitza Stark Publications for gene: EIF2AK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Marked gene: EDA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Gene: eda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.322 | EDA | Zornitza Stark Phenotypes for gene: EDA were changed from Ectodermal dysplasia 1, hypohidrotic, X-linked, 305100 (3) to Ectodermal dysplasia 1, hypohidrotic, X-linked MIM#305100; Tooth agenesis, selective, X-linked 1 MIM#313500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.321 | EDA | Zornitza Stark Publications for gene: EDA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Marked gene: ECHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Gene: echs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.320 | ECHS1 | Zornitza Stark Phenotypes for gene: ECHS1 were changed from Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, 616277 (3) to Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency MIM# 616277 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.319 | ECHS1 | Zornitza Stark Publications for gene: ECHS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Marked gene: DYSF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Gene: dysf has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.318 | DYSF | Zornitza Stark Phenotypes for gene: DYSF were changed from Muscular dystrophy, limb-girdle, type 2B, 253601 (3) to Miyoshi muscular dystrophy 1 MIM#254130; MONDO:0024545; Muscular dystrophy, limb-girdle, autosomal recessive 2 MIM#253601; MONDO:0009676; Myopathy, distal, with anterior tibial onset MIM#606768; MONDO:0011721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.317 | DYSF | Zornitza Stark Publications for gene: DYSF were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Marked gene: DYNC2H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Gene: dync2h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.316 | DYNC2H1 | Zornitza Stark Phenotypes for gene: DYNC2H1 were changed from Short-rib thoracic dysplasia 3 with or without polydactyly, 613091 (3) to Short-rib thoracic dysplasia 3 with or without polydactyly, MIM#613091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.315 | DYNC2H1 | Zornitza Stark Publications for gene: DYNC2H1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Marked gene: DYM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Gene: dym has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.314 | DYM | Zornitza Stark Phenotypes for gene: DYM were changed from Dyggve-Melchior-Clausen disease, 223800 (3) to Dyggve-Melchior-Clausen disease MIM#223800; Smith-McCort dysplasia MIM#607326 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.313 | DYM | Zornitza Stark Publications for gene: DYM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Marked gene: DOK7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Gene: dok7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.312 | DOK7 | Zornitza Stark Phenotypes for gene: DOK7 were changed from Myasthenic syndrome, congenital, 10, 254300 (3) to Myasthenic syndrome, congenital, 10, MIM# 254300; Fetal akinesia deformation sequence 3, MIM# 618389 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.311 | DOK7 | Zornitza Stark Publications for gene: DOK7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Marked gene: DOCK6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Gene: dock6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.310 | DOCK6 | Zornitza Stark Phenotypes for gene: DOCK6 were changed from Adams-Oliver syndrome 2, 614219 (3) to Adams-Oliver syndrome 2, MIM# 614219 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.309 | DOCK6 | Zornitza Stark Publications for gene: DOCK6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Marked gene: DNMT3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Gene: dnmt3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.308 | DNMT3B | Zornitza Stark Phenotypes for gene: DNMT3B were changed from Immunodeficiency-centromeric instability-facial anomalies syndrome 1, 242860 (3) to Immunodeficiency-centromeric instability-facial anomalies syndrome 1 (MIM#242860) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Marked gene: DNAI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Gene: dnai2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.307 | DNAI2 | Zornitza Stark Phenotypes for gene: DNAI2 were changed from Ciliary dyskinesia, primary, 9, with or without situs inversus, 612444 (3) to Ciliary dyskinesia, primary, 9, with or without situs inversus, MIM# 612444 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.306 | DNAI2 | Zornitza Stark Publications for gene: DNAI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Marked gene: DNAI1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Gene: dnai1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.305 | DNAI1 | Zornitza Stark Phenotypes for gene: DNAI1 were changed from Ciliary dyskinesia, primary, 1, with or without situs inversus, 244400 (3) to Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.304 | DNAI1 | Zornitza Stark Publications for gene: DNAI1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Marked gene: DNAH5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Gene: dnah5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.303 | DNAH5 | Zornitza Stark Phenotypes for gene: DNAH5 were changed from Ciliary dyskinesia, primary, 3, with or without situs inversus, 608644 (3) to Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.302 | DNAH5 | Zornitza Stark Publications for gene: DNAH5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Marked gene: DNAH11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.301 | DNAH11 | Zornitza Stark Phenotypes for gene: DNAH11 were changed from Ciliary dyskinesia, primary, 7, with or without situs inversus, 611884 (3) to Ciliary dyskinesia, primary, 7, with or without situs inversus, MIM#611884 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.300 | DNAH11 | Zornitza Stark Publications for gene: DNAH11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Marked gene: DMD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Gene: dmd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.299 | DMD | Zornitza Stark Phenotypes for gene: DMD were changed from Duchenne muscular dystrophy, 310200 (3) to Duchenne muscular dystrophy MIM#310200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.298 | DMD | Zornitza Stark Publications for gene: DMD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Marked gene: DLL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Gene: dll3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.297 | DLL3 | Zornitza Stark Phenotypes for gene: DLL3 were changed from Spondylocostal dysostosis 1, autosomal recessive, 277300 (3) to Spondylocostal dysostosis 1, autosomal recessive, MIM# 277300; MONDO:0020692 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.296 | DLL3 | Zornitza Stark Publications for gene: DLL3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Marked gene: DLG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Gene: dlg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.295 | DLG3 | Zornitza Stark Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, 300850 (3) to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.294 | DLG3 | Zornitza Stark Publications for gene: DLG3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Marked gene: DLD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Gene: dld has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.293 | DLD | Zornitza Stark Phenotypes for gene: DLD were changed from Dihydrolipoamide dehydrogenase deficiency, 246900 (3) to Dihydrolipoamide dehydrogenase deficiency (MIM#246900) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.292 | DLD | Zornitza Stark Publications for gene: DLD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Marked gene: DKC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Gene: dkc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.291 | DKC1 | Zornitza Stark Phenotypes for gene: DKC1 were changed from Dyskeratosis congenita, X-linked, 305000 (3) to Dyskeratosis congenita, X-linked MIM#305000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.290 | DKC1 | Zornitza Stark Publications for gene: DKC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Marked gene: DIS3L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Gene: dis3l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.289 | DIS3L2 | Zornitza Stark Phenotypes for gene: DIS3L2 were changed from Perlman syndrome, 267000 (3) to Perlman syndrome MIM# 267000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.288 | DIS3L2 | Zornitza Stark Publications for gene: DIS3L2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Marked gene: DHDDS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Gene: dhdds has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.287 | DHDDS | Zornitza Stark Phenotypes for gene: DHDDS were changed from Retinitis pigmentosa 59, 613861 (3) to Retinitis pigmentosa 59, MIM#613861; Congenital disorder of glycosylation, type 1bb, MIM# 613861 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.286 | DHDDS | Zornitza Stark Publications for gene: DHDDS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Marked gene: DHCR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Gene: dhcr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.285 | DHCR7 | Zornitza Stark Phenotypes for gene: DHCR7 were changed from Smith-Lemli-Opitz syndrome, 270400 (3) to Smith-Lemli-Opitz syndrome (MIM#270400) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.284 | DHCR7 | Zornitza Stark Publications for gene: DHCR7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Marked gene: DHCR24 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Gene: dhcr24 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.283 | DHCR24 | Zornitza Stark Phenotypes for gene: DHCR24 were changed from Desmosterolosis, 602398 (3) to Desmosterolosis, MIM#602398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.282 | DHCR24 | Zornitza Stark Publications for gene: DHCR24 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Marked gene: DGUOK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Gene: dguok has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.281 | DGUOK | Zornitza Stark Phenotypes for gene: DGUOK were changed from Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), 251880 (3) to Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880; Portal hypertension, noncirrhotic, 1, MIM# 617068; Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.280 | DGUOK | Zornitza Stark Publications for gene: DGUOK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Marked gene: DGAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Gene: dgat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.279 | DGAT1 | Zornitza Stark Phenotypes for gene: DGAT1 were changed from ?Diarrhea 7, protein-losing enteropathy type to Diarrhoea 7, protein-losing enteropathy type, MIM# 615863; congenital diarrhea 7 with exudative enteropathy MONDO:0014375 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.278 | DGAT1 | Zornitza Stark Publications for gene: DGAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Marked gene: DDX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Gene: ddx11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.277 | DDX11 | Zornitza Stark Phenotypes for gene: DDX11 were changed from Warsaw breakage syndrome, 613398 (3) to Warsaw breakage syndrome MIM#613398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.276 | DDX11 | Zornitza Stark Publications for gene: DDX11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Marked gene: DDC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Gene: ddc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.275 | DDC | Zornitza Stark Phenotypes for gene: DDC were changed from Aromatic L-amino acid decarboxylase deficiency, 608643 (3) to Aromatic L-amino acid decarboxylase deficiency MIM#608643; Aromatic L-amino acid decarboxylase deficiency (MIM#608643) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.274 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from Lissencephaly, X-linked, 300067 (3) to Lissencephaly, X-linked MIM#300067; Subcortical laminal heterotopia, X-linked MIM#300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.273 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Marked gene: DCLRE1C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Gene: dclre1c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.272 | DCLRE1C | Zornitza Stark Phenotypes for gene: DCLRE1C were changed from Severe combined immunodeficiency, Athabascan type, 602450 (3) to Severe combined immunodeficiency, Athabascan type, MIM# 602450; Omenn syndrome, MIM# 603554 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.271 | DCLRE1C | Zornitza Stark Publications for gene: DCLRE1C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Marked gene: DCAF17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Gene: dcaf17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.270 | DCAF17 | Zornitza Stark Phenotypes for gene: DCAF17 were changed from Woodhouse-Sakati syndrome, 241080 (3) to Woodhouse-Sakati syndrome MIM#241080 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.269 | DCAF17 | Zornitza Stark Publications for gene: DCAF17 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Marked gene: DBT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Gene: dbt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.268 | DBT | Zornitza Stark Phenotypes for gene: DBT were changed from Maple syrup urine disease, type II, 248600 (3) to Maple syrup urine disease, type II, MIM#248600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Marked gene: D2HGDH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Gene: d2hgdh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.267 | D2HGDH | Zornitza Stark Phenotypes for gene: D2HGDH were changed from D-2-hydroxyglutaric aciduria, 600721 (3) to D-2-hydroxyglutaric aciduria, MIM#600721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.266 | D2HGDH | Zornitza Stark Publications for gene: D2HGDH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Marked gene: CYP7B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Gene: cyp7b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.265 | CYP7B1 | Zornitza Stark Phenotypes for gene: CYP7B1 were changed from Bile acid synthesis defect, congenital, 3, 613812 (3) to Bile acid synthesis defect, congenital, 3, MIM#613812; Spastic paraplegia 5A, MIM#270800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.264 | CYP7B1 | Zornitza Stark Publications for gene: CYP7B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Marked gene: CYP27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Gene: cyp27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.263 | CYP27A1 | Zornitza Stark Phenotypes for gene: CYP27A1 were changed from Cerebrotendinous xanthomatosis, 213700 (3) to Cerebrotendinous xanthomatosis, MIM#213700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Marked gene: CYP1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Gene: cyp1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.262 | CYP1B1 | Zornitza Stark Phenotypes for gene: CYP1B1 were changed from Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, 231300 (3) to Anterior segment dysgenesis 6, multiple subtypes, MIM#617315 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.261 | CYP1B1 | Zornitza Stark Publications for gene: CYP1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Marked gene: CYP17A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Gene: cyp17a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.260 | CYP17A1 | Zornitza Stark Phenotypes for gene: CYP17A1 were changed from 17,20-lyase deficiency, isolated, 202110 (3) to 17-alpha-hydroxylase/17,20-lyase deficiency MIM#202110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.259 | CYP17A1 | Zornitza Stark Publications for gene: CYP17A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Marked gene: CYP11B2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Gene: cyp11b2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.258 | CYP11B2 | Zornitza Stark Phenotypes for gene: CYP11B2 were changed from Hypoaldosteronism, congenital, due to CMO I deficiency, 203400 (3) to Hypoaldosteronism, congenital, due to CMO I deficiency MIM#203400; Hypoaldosteronism, congenital, due to CMO II deficiency MIM#610600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.257 | CYP11B2 | Zornitza Stark Publications for gene: CYP11B2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Marked gene: CYP11A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Gene: cyp11a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.256 | CYP11A1 | Zornitza Stark Phenotypes for gene: CYP11A1 were changed from Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete, 613743 (3) to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete MIM#613743 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.255 | CYP11A1 | Zornitza Stark Publications for gene: CYP11A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark reviewed gene: CYBB: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Chronic granulomatous disease, X-linked, MIM#306400; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Marked gene: CYBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Gene: cybb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.254 | CYBB | Zornitza Stark Phenotypes for gene: CYBB were changed from Chronic granulomatous disease, X-linked, 306400 (3) to Chronic granulomatous disease, X-linked, MIM#306400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.253 | CYBB | Zornitza Stark Publications for gene: CYBB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Marked gene: CYBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Gene: cyba has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.252 | CYBA | Zornitza Stark Phenotypes for gene: CYBA were changed from Chronic granulomatous disease, autosomal, due to deficiency of CYBA, 233690 (3) to Chronic granulomatous disease 4 MIM#233690 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.251 | CYBA | Zornitza Stark Publications for gene: CYBA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Marked gene: CUL4B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Gene: cul4b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.250 | CUL4B | Zornitza Stark Phenotypes for gene: CUL4B were changed from Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354 (3) to Intellectual developmental disorder, X-linked syndromic, Cabezas type, MIM#300354 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.249 | CUL4B | Zornitza Stark Publications for gene: CUL4B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Marked gene: CTSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Gene: ctsk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.248 | CTSK | Zornitza Stark Phenotypes for gene: CTSK were changed from Pycnodysostosis, 265800 (3) to Pycnodysostosis MIM#265800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.247 | CTSK | Zornitza Stark Publications for gene: CTSK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Marked gene: CTSD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Gene: ctsd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.246 | CTSD | Zornitza Stark Phenotypes for gene: CTSD were changed from Ceroid lipofuscinosis, neuronal, 10, 610127 (3) to Ceroid lipofuscinosis, neuronal, 10, MIM# 610127 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Marked gene: CTSC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Gene: ctsc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.245 | CTSC | Zornitza Stark Phenotypes for gene: CTSC were changed from Papillon-Lefevre syndrome, 245000 (3) to Haim-Munk syndrome MIM#245010; Papillon-Lefevre syndrome MIM#245000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Marked gene: CTSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Gene: ctsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.244 | CTSA | Zornitza Stark Phenotypes for gene: CTSA were changed from Galactosialidosis, 256540 (3) to Galactosialidosis MIM#256540 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.243 | CTSA | Zornitza Stark Publications for gene: CTSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Marked gene: CTNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Gene: ctns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.242 | CTNS | Zornitza Stark Phenotypes for gene: CTNS were changed from Cystinosis, nephropathic, 219800 (3) to Cystinosis, nephropathic MIM#219800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.241 | CTNS | Zornitza Stark Publications for gene: CTNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Marked gene: CSPP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Gene: cspp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.240 | CSPP1 | Zornitza Stark Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.239 | CSPP1 | Zornitza Stark Publications for gene: CSPP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Marked gene: CRTAP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Gene: crtap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.238 | CRTAP | Zornitza Stark Phenotypes for gene: CRTAP were changed from Osteogenesis imperfecta, type VII, 610682 (3) to Osteogenesis imperfecta, type VII MIM#610682 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.237 | CRTAP | Zornitza Stark Publications for gene: CRTAP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Marked gene: CRB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Gene: crb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.236 | CRB1 | Zornitza Stark Phenotypes for gene: CRB1 were changed from Leber congenital amaurosis 8, 613835 (3) to Leber congenital amaurosis 8, MIM#613835 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.235 | CRB1 | Zornitza Stark Publications for gene: CRB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Marked gene: CPT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Gene: cpt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.234 | CPT2 | Zornitza Stark Phenotypes for gene: CPT2 were changed from CPT II deficiency, lethal neonatal, 608836 (3) to CPT II deficiency, infantile MIM#600649; CPT II deficiency, lethal neonatal MIM#608836 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.233 | CPT2 | Zornitza Stark Publications for gene: CPT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Marked gene: CPT1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Gene: cpt1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.232 | CPT1A | Zornitza Stark Phenotypes for gene: CPT1A were changed from CPT deficiency, hepatic, type IA, 255120 (3) to CPT deficiency, hepatic, type IA, MIM#255120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.231 | CPT1A | Zornitza Stark Publications for gene: CPT1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Marked gene: CPS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Gene: cps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.230 | CPS1 | Zornitza Stark Phenotypes for gene: CPS1 were changed from Carbamoylphosphate synthetase I deficiency, 237300 (3) to Carbamoylphosphate synthetase I deficiency MIM#237300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.229 | CPS1 | Zornitza Stark Publications for gene: CPS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Marked gene: COX15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Gene: cox15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.228 | COX15 | Zornitza Stark Phenotypes for gene: COX15 were changed from Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 2, 615119 (3) to Mitochondrial complex IV deficiency, nuclear type 6, MIM #615119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.227 | COX15 | Zornitza Stark Publications for gene: COX15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Marked gene: COLQ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Gene: colq has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.226 | COLQ | Zornitza Stark Phenotypes for gene: COLQ were changed from Myasthenic syndrome, congenital, 5, 603034 (3) to Myasthenic syndrome, congenital, 5 MIM#603034; MONDO:0011281 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.225 | COLQ | Zornitza Stark Publications for gene: COLQ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Marked gene: COLEC11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Gene: colec11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.224 | COLEC11 | Zornitza Stark Phenotypes for gene: COLEC11 were changed from 3MC syndrome 2, 265050 (3) to 3MC syndrome 2, MIM# 265050; MONDO:0009927 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.223 | COLEC11 | Zornitza Stark Publications for gene: COLEC11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Marked gene: COL7A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Gene: col7a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.222 | COL7A1 | Zornitza Stark Phenotypes for gene: COL7A1 were changed from Epidermolysis bullosa dystrophica, AR, 226600 (3) to Epidermolysis bullosa dystrophica inversa MIM#226600; Epidermolysis bullosa dystrophica, autosomal recessive MIM#226600; Epidermolysis bullosa dystrophica, localisata variant MIM#226600; Epidermolysis bullosa pruriginosa MIM#604129 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.221 | COL7A1 | Zornitza Stark Publications for gene: COL7A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Marked gene: COL6A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Gene: col6a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.220 | COL6A1 | Zornitza Stark Phenotypes for gene: COL6A1 were changed from Ullrich congenital muscular dystrophy 1, 254090 (3) to Ullrich congenital muscular dystrophy 1A MIM#254090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.219 | COL6A1 | Zornitza Stark Publications for gene: COL6A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Marked gene: COL4A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Gene: col4a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.218 | COL4A5 | Zornitza Stark Phenotypes for gene: COL4A5 were changed from Alport syndrome 1, X-linked to Alport syndrome 1, X-linked, MIM#301050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.217 | COL4A5 | Zornitza Stark Publications for gene: COL4A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Marked gene: COL4A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Gene: col4a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.216 | COL4A4 | Zornitza Stark Phenotypes for gene: COL4A4 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 2, autosomal recessive MIM# 203780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.215 | COL4A4 | Zornitza Stark Publications for gene: COL4A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Marked gene: COL4A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Gene: col4a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.214 | COL4A3 | Zornitza Stark Phenotypes for gene: COL4A3 were changed from Alport syndrome, autosomal recessive, 203780 (3) to Alport syndrome 3b, autosomal recessive MIM#620536; MONDO:0957811 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.213 | COL4A3 | Zornitza Stark Publications for gene: COL4A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Marked gene: COL27A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Gene: col27a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.212 | COL27A1 | Zornitza Stark Phenotypes for gene: COL27A1 were changed from Steel Syndrome to Steel syndrome (MIM#615155) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.211 | COL27A1 | Zornitza Stark Publications for gene: COL27A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Marked gene: COL18A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Gene: col18a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.210 | COL18A1 | Zornitza Stark Phenotypes for gene: COL18A1 were changed from Knobloch syndrome, type 1, 267750 (3) to Knobloch syndrome, type 1 MIM#267750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.209 | COL18A1 | Zornitza Stark Publications for gene: COL18A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Marked gene: COL17A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Gene: col17a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.208 | COL17A1 | Zornitza Stark Phenotypes for gene: COL17A1 were changed from Epidermolysis bullosa, junctional, non-Herlitz type, 226650 (3) to Epidermolysis bullosa, junctional 4, intermediate, MIM# 619787 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.207 | COL17A1 | Zornitza Stark Publications for gene: COL17A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Marked gene: COL11A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.206 | COL11A2 | Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Deafness, autosomal recessive 53 MIM#609706; Fibrochondrogenesis 2 MIM#614524; Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.205 | COL11A2 | Zornitza Stark Publications for gene: COL11A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Marked gene: CNGB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Gene: cngb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.204 | CNGB3 | Zornitza Stark Phenotypes for gene: CNGB3 were changed from Macular degeneration, juvenile, 248200 (3) to Achromatopsia 3 MIM#262300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.203 | CNGB3 | Zornitza Stark Publications for gene: CNGB3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Marked gene: CLRN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Gene: clrn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.202 | CLRN1 | Zornitza Stark Phenotypes for gene: CLRN1 were changed from Usher syndrome, type 3A, 276902 (3) to Usher syndrome, type 3A, MIM#276902 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.201 | CLRN1 | Zornitza Stark Publications for gene: CLRN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Marked gene: CLPB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Gene: clpb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.200 | CLPB | Zornitza Stark Phenotypes for gene: CLPB were changed from 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropenia, 616271 (3) to 3-methylglutaconic aciduria, type VIIB, autosomal recessive (MIM#616271) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.199 | CLPB | Zornitza Stark Publications for gene: CLPB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Marked gene: CLP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Gene: clp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.198 | CLP1 | Zornitza Stark Phenotypes for gene: CLP1 were changed from Pontocerebellar hypoplasia, type 10, 615803 (3) to Pontocerebellar hypoplasia, type 10 MIM#615803 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.197 | CLP1 | Zornitza Stark Publications for gene: CLP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Marked gene: CLN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.196 | CLN8 | Zornitza Stark Phenotypes for gene: CLN8 were changed from Ceroid lipofuscinosis, neuronal, 8, 600143 (3) to Ceroid lipofuscinosis, neuronal, 8, MIM# 600143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Marked gene: CLN6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Gene: cln6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.195 | CLN6 | Zornitza Stark Phenotypes for gene: CLN6 were changed from Ceroid lipofuscinosis, neuronal 6, 601780 (3) to Ceroid lipofuscinosis, neuronal 6, MIM#601780 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.194 | CLN6 | Zornitza Stark Publications for gene: CLN6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Marked gene: CLN5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Gene: cln5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.193 | CLN5 | Zornitza Stark Phenotypes for gene: CLN5 were changed from Ceroid lipofuscinosis, neuronal, 5, 256731 (3) to Ceroid lipofuscinosis, neuronal, 5, MIM# 256731; MONDO:0009745 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Marked gene: CLCN7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Gene: clcn7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.192 | CLCN7 | Zornitza Stark Phenotypes for gene: CLCN7 were changed from Osteopetrosis, autosomal recessive 4, 611490 (3) to Osteopetrosis, autosomal recessive 4, MIM#611490 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.191 | CLCN7 | Zornitza Stark Publications for gene: CLCN7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Marked gene: CLCN5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Gene: clcn5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.190 | CLCN5 | Zornitza Stark Phenotypes for gene: CLCN5 were changed from Dent disease, 300009 (3) to Dent disease, MIM#300009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Marked gene: CKAP2L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Gene: ckap2l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.189 | CKAP2L | Zornitza Stark Phenotypes for gene: CKAP2L were changed from Filippi syndrome, 272440 (3) to Filippi syndrome MIM#272440 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.188 | CKAP2L | Zornitza Stark Publications for gene: CKAP2L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Marked gene: CIITA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Gene: ciita has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.187 | CIITA | Zornitza Stark Phenotypes for gene: CIITA were changed from Bare lymphocyte syndrome, type II, complementation group A, 209920 (3) to MHC class II deficiency 1 MIM#209920 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.186 | CIITA | Zornitza Stark Publications for gene: CIITA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Marked gene: CHRNG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Gene: chrng has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.185 | CHRNG | Zornitza Stark Phenotypes for gene: CHRNG were changed from Escobar syndrome, 265000 (3) to Escobar syndrome (MIM# 265000); Multiple pterygium syndrome, lethal type, (MIM# 253290) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.184 | CHRNG | Zornitza Stark Publications for gene: CHRNG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Marked gene: CHRNE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Gene: chrne has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.183 | CHRNE | Zornitza Stark Phenotypes for gene: CHRNE were changed from Myasthenic syndrome, congenital, 4A, slow-channel, 605809 (3) to Myasthenic syndrome, congenital, 4A, slow-channel MIM#605809; Myasthenic syndrome, congenital, 4B, fast-channel MIM#616324; Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency MIM#608931 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.182 | CHRNE | Zornitza Stark Publications for gene: CHRNE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Marked gene: CHAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Gene: chat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.181 | CHAT | Zornitza Stark Phenotypes for gene: CHAT were changed from Myasthenic syndrome, congenital, 6, presynaptic, 254210 (3) to Myasthenic syndrome, congenital, 6, presynaptic MIM#254210 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.180 | CHAT | Zornitza Stark Publications for gene: CHAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Marked gene: CFTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Gene: cftr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.179 | CFTR | Zornitza Stark Phenotypes for gene: CFTR were changed from Cystic fibrosis, 219700 (3) to Cystic fibrosis, MIM#219700; MONDO:0009061 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.178 | CFTR | Zornitza Stark Publications for gene: CFTR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Marked gene: CEP41 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Gene: cep41 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.177 | CEP41 | Zornitza Stark Phenotypes for gene: CEP41 were changed from Joubert syndrome 15, 614464 (3) to Joubert syndrome 15, MIM# 614464 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.176 | CEP41 | Zornitza Stark Publications for gene: CEP41 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Marked gene: CEP290 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Gene: cep290 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.175 | CEP290 | Zornitza Stark Phenotypes for gene: CEP290 were changed from Joubert syndrome 5, 610188 (3) to CEP290-related ciliopathy MONDO:0100451; Bardet-Biedl syndrome 14, MIM# 615991; Joubert syndrome 5 610188; Leber congenital amaurosis 10, MIM# 611755; Meckel syndrome 4, MIM# 611134; Senior-Loken syndrome 6, MIM# 610189 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.174 | CEP290 | Zornitza Stark Publications for gene: CEP290 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Marked gene: CEP152 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Gene: cep152 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.173 | CEP152 | Zornitza Stark Phenotypes for gene: CEP152 were changed from Seckel syndrome 5, 613823 (3) to Microcephaly 9, primary, autosomal recessive, MIM# 614852; MONDO:0013923; Seckel syndrome 5, MIM# 613823; MONDO:0013443 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.172 | CEP152 | Zornitza Stark Publications for gene: CEP152 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Marked gene: CENPJ as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Gene: cenpj has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.171 | CENPJ | Zornitza Stark Phenotypes for gene: CENPJ were changed from Microcephaly 6, primary, autosomal recessive, 608393 (3) to Microcephaly 6, primary MIM#608393; Seckel syndrome 4 MIM#613676 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.170 | CENPJ | Zornitza Stark Publications for gene: CENPJ were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Marked gene: CDH23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Gene: cdh23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.169 | CDH23 | Zornitza Stark Phenotypes for gene: CDH23 were changed from Usher syndrome, type 1D, 601067 (3) to Usher syndrome, type 1D (MIM#601067) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.168 | CDH23 | Zornitza Stark Publications for gene: CDH23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Marked gene: CD40LG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Gene: cd40lg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.167 | CD40LG | Zornitza Stark Phenotypes for gene: CD40LG were changed from Immunodeficiency, X-linked, with hyper-IgM, 308230 (3) to Immunodeficiency, X-linked, with hyper-IgM MIM# 308230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.166 | CD40LG | Zornitza Stark Publications for gene: CD40LG were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.56 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.283 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.283 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.68 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.68 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 | Krithika Murali Gene: ift57 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Marked gene: IFT57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.12 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2519 | IFT57 | Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2518 | IFT57 | Krithika Murali Phenotypes for gene: IFT57 were changed from Orofaciodigital syndrome XVIII, MIM# 617927 to Orofaciodigital syndrome XVIII, MIM# 617927; Bardet-Bield syndrome; ciliopathy - MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2517 | IFT57 | Krithika Murali Classified gene: IFT57 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2517 | IFT57 | Krithika Murali Gene: ift57 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.120 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID:40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.146 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.85 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.305 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.305 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2516 | UGGT1 | Krithika Murali Phenotypes for gene: UGGT1 were changed from to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2515 | UGGT1 | Krithika Murali Publications for gene: UGGT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2514 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2513 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2513 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.66 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.207 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.207 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.442 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.442 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.441 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.441 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.11 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.11 | UGGT1 | Krithika Murali Mode of inheritance for gene: UGGT1 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Marked gene: UGGT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Classified gene: UGGT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.10 | UGGT1 | Krithika Murali Gene: uggt1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali changed review comment from: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature; to: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Differences of Sex Development v1.9 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Differences of Sex Development. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: Genitourinary anomalies such as cryptorchidism reported -- PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies; hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.440 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.84 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Renal Macrocystic Disease. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to AMBER Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants and CDG/multisystem disorder with clinical features including GDD/ID, microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies).Supportive functional evidence also provided. Of note, two individuals reported with cystic renal dysplasia and hepatobiliary anomalies that were similar in apperaance to ARPKD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.206 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Autism. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD). More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.304 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Microcephaly. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID:40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.65 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Congenital Disorders of Glycosylation. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.119 | UGGT1 |
Krithika Murali gene: UGGT1 was added gene: UGGT1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: UGGT1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: UGGT1 were set to PMID: 40267907 Phenotypes for gene: UGGT1 were set to Congenital disorder of glycosylation - MONDO:0015286; UGGT1-CDG Review for gene: UGGT1 was set to GREEN Added comment: PMID: 40267907 Dardas et al 2025 report 15 affected individuals from 10 unrelated families with biallelic UGGT1 variants. Affected individuals had GDD and intellectual disability of varying severity. Other cardinal clinical features included microcephaly, seizures, craniofacial dysmorphism, and behavioral abnormalities (autism, ADHD) . More variable features included congenital heart disease, cryptorchism; renal anomalies (cystic/dysplastic kidneys in 2 individuals simiilar in appearance to ARPKD); hepatomegaly; recurrent infections; and skeletal anomalies (scoliosis and/or vertebral anomalies). Supportive functional evidence also provided. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | UGGT1 | Krithika Murali reviewed gene: UGGT1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 40267907; Phenotypes: Congenital disorder of glycosylation - MONDO:0015286, UGGT1-CDG; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | IFT57 | Krithika Murali reviewed gene: IFT57: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID:40273360; Phenotypes: Bardet-Bield syndrome, ciliopathy - MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.67 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Ciliopathies. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Learning difficulties - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polydactyly v0.282 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Polydactyly. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Learning difficulties - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.55 | IFT57 |
Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Learning difficulties - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.11 | IFT57 |
Krithika Murali changed review comment from: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature; to: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Learning difficulties - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cone-rod Dystrophy v0.55 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Cone-rod Dystrophy. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bardet Biedl syndrome v1.11 | IFT57 |
Krithika Murali gene: IFT57 was added gene: IFT57 was added to Bardet Biedl syndrome. Sources: Literature Mode of inheritance for gene: IFT57 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: IFT57 were set to PMID:40273360 Phenotypes for gene: IFT57 were set to Bardet-Bield syndrome; ciliopathy - MONDO:0005308 Review for gene: IFT57 was set to AMBER Added comment: PMID:40273360 Nitoiu et al 2025 report a male with clinical features of Bardet-Biedl syndrome. Phenotypic features include: - Vision issues - night vision loss, progressive cone-rod dystrophy leading to legal blindness - Post-axial polydactyly - Obesity and type 2 diabetes - Moderate sensorineural hearing loss Biallelic IFT57 variants were identified on short-read genomic sequencing after negative panel-based clinical testing - NM_018010.4 (IFT57): c.1190 T>A;p.(Val397Glu) and c.675del; p.(Lys225Asnfs∗17). Patient-derived fibroblasts had fewer primary cilia, abnormal ciliary morphology and abnormal anterograde transport in the primary cilia. IFT57 knockout mouse models did not form primary cilia. Treatment with IFT57-WT restored cilia formation while IFT57-Val397Glu only partially rescued cilia formation in Ift57-KO-mouse cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v1.0 | APOB | Zornitza Stark Marked gene: APOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Familial hypercholesterolaemia v1.0 | APOB | Zornitza Stark Gene: apob has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.118 | DLG3 | Lilian Rudd Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2512 | DLG3 | Lilian Rudd Phenotypes for gene: DLG3 were changed from Mental retardation, X-linked 90, MIM#300850 to Intellectual developmental disorder, X-linked 90 MIM#300850 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Marked gene: CD40 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Gene: cd40 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.165 | CD40 | Zornitza Stark Phenotypes for gene: CD40 were changed from Immunodeficiency with hyper-IgM, type 3, 606843 (3) to Immunodeficiency with hyper-IgM, type 3, MIM# 606843 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Marked gene: CD3D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Gene: cd3d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.164 | CD3D | Zornitza Stark Phenotypes for gene: CD3D were changed from Immunodeficiency 19, 615617 (3) to Immunodeficiency 19, severe combined MIM# 615617 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Marked gene: CCDC88C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Gene: ccdc88c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.163 | CCDC88C | Zornitza Stark Phenotypes for gene: CCDC88C were changed from Hydrocephalus, nonsyndromic, autosomal recessive, 236600 (3) to Hydrocephalus, congenital, 1 MIM#236600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.162 | CCDC88C | Zornitza Stark Publications for gene: CCDC88C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Marked gene: CCDC39 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Gene: ccdc39 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.161 | CCDC39 | Zornitza Stark Phenotypes for gene: CCDC39 were changed from Ciliary dyskinesia, primary, 14, 613807 (3) to Ciliary dyskinesia, primary, 14 MIM#613807 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.160 | CCDC39 | Zornitza Stark Publications for gene: CCDC39 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Marked gene: CCDC103 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Gene: ccdc103 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.159 | CCDC103 | Zornitza Stark Phenotypes for gene: CCDC103 were changed from Ciliary dyskinesia, primary, 17, 614679 (3) to Primary ciliary dyskinesia-17, MIM # 614679 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.158 | CCDC103 | Zornitza Stark Publications for gene: CCDC103 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Marked gene: CCBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Gene: ccbe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.157 | CCBE1 | Zornitza Stark Phenotypes for gene: CCBE1 were changed from Hennekam lymphangiectasia-lymphedema syndrome 1, 235510 (3) to Hennekam lymphangiectasia-lymphoedema syndrome 1 MIM#235510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.156 | CCBE1 | Zornitza Stark Publications for gene: CCBE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Marked gene: CC2D2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Gene: cc2d2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.155 | CC2D2A | Zornitza Stark Phenotypes for gene: CC2D2A were changed from Joubert syndrome 9, 612285 (3) to COACH syndrome, MIM#216360; Joubert syndrome 9, MIM#612285; Meckel syndrome 6, MIM#612284; Retinitis pigmentosa 93, MIM# 619845 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.154 | CC2D2A | Zornitza Stark Publications for gene: CC2D2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Marked gene: CC2D1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Gene: cc2d1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.153 | CC2D1A | Zornitza Stark Phenotypes for gene: CC2D1A were changed from Mental retardation, autosomal recessive 3, 608443 (3) to Intellectual developmental disorder, autosomal recessive 3, MIM# 608443 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.152 | CC2D1A | Zornitza Stark Publications for gene: CC2D1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Marked gene: CASQ2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Gene: casq2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.151 | CASQ2 | Zornitza Stark Phenotypes for gene: CASQ2 were changed from Ventricular tachycardia, catecholaminergic polymorphic, 2, 611938 (3) to Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Marked gene: CASK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Gene: cask has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.150 | CASK | Zornitza Stark Phenotypes for gene: CASK were changed from Mental retardation, with or without nystagmus to X-linked syndromic intellectual disability MONDO:0020119 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.149 | CASK | Zornitza Stark Publications for gene: CASK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Marked gene: GNE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Gene: gne has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.148 | GNE | Zornitza Stark Phenotypes for gene: GNE were changed from Inclusion body myopathy, autosomal recessive, 600737 (3) to Nonaka myopathy MIM#605820; Thrombocytopenia 12 with or without myopathy MIM#620757 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.147 | GNE | Zornitza Stark Publications for gene: GNE were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.146 | GNE | Zornitza Stark Classified gene: GNE as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.146 | GNE | Zornitza Stark Gene: gne has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.145 | CLN3 | Zornitza Stark Phenotypes for gene: CLN3 were changed from Ceroid lipofuscinosis, neuronal, 3, 204200 (3) to Ceroid lipofuscinosis, neuronal, 3, MIM# 204200; MONDO:0008767 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.144 | CLN3 | Zornitza Stark Publications for gene: CLN3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.143 | CLN3 | Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.143 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | GPR143 | Zornitza Stark Tag for review tag was added to gene: GPR143. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NUDT2 | Sangavi Sivagnanasundram reviewed gene: NUDT2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder with or without peripheral neuropathy, MONDO:0859240; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NLRP2 | Sangavi Sivagnanasundram reviewed gene: NLRP2: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Oocyte/zygote/embryo maturation arrest 18, MONDO:0957230; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NKAP | Sangavi Sivagnanasundram reviewed gene: NKAP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NDUFAF8 | Sangavi Sivagnanasundram reviewed gene: NDUFAF8: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Leigh Syndrome MONDO:0009723; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | NDUFAF7 | Sangavi Sivagnanasundram reviewed gene: NDUFAF7: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Pathological Myopia MONDO:0001383; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.256 | THAP11_SCA51_CAG | Bryony Thompson THAP11_SCA_CAG was changed to THAP11_SCA51_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Marked STR: RAPGEF2_FAME7_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Classified STR: RAPGEF2_FAME7_TTTCA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.145 | RAPGEF2_FAME7_TTTCA | Bryony Thompson Str: rapgef2_fame7_tttca has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.144 | RAPGEF2_FAME7_TTTCA |
Bryony Thompson STR: RAPGEF2_FAME7_TTTCA was added STR: RAPGEF2_FAME7_TTTCA was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for STR: RAPGEF2_FAME7_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: RAPGEF2_FAME7_TTTCA were set to 29507423; 30351492; 33791773 Phenotypes for STR: RAPGEF2_FAME7_TTTCA were set to Epilepsy, familial adult myoclonic, 7 MIM#618075 Review for STR: RAPGEF2_FAME7_TTTCA was set to AMBER Added comment: TTTCA expansion (without TTTTA expansion) identified in 3 affected individuals in a Chinese FAME family and another unrelated Japanese proband. Now 3 families reported. The expanded (TTTTA)exp(TTTCA)exp(TTTTA)n allele was identified in a single case with myoclonic epilepsy. The repeat is similar to the SAMD12 FAME1 TTTTA/TTTCA pentanucleotide repeat. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.117 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2511 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.27 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2510 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.64 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Marked STR: XYLT1_DBQD2_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.116 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Classified STR: XYLT1_DBQD2_GGC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.309 | XYLT1_DBQD2_GGC | Bryony Thompson Str: xylt1_dbqd2_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v1.63 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Congenital Disorders of Glycosylation. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.115 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.308 | XYLT1_DBQD2_GGC |
Bryony Thompson STR: XYLT1_DBQD2_GGC was added STR: XYLT1_DBQD2_GGC was added to Skeletal dysplasia. Sources: Literature Mode of inheritance for STR: XYLT1_DBQD2_GGC was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: XYLT1_DBQD2_GGC were set to 30554721 Phenotypes for STR: XYLT1_DBQD2_GGC were set to Desbuquois dysplasia 2 MIM#615777 Review for STR: XYLT1_DBQD2_GGC was set to GREEN STR: XYLT1_DBQD2_GGC was marked as clinically relevant STR: XYLT1_DBQD2_GGC was marked as current diagnostic Added comment: 10 patients from 8 families with homozygosity or compound heterozygosity for a (GGC)n repeat expansion in the XYLT1 promoter region, resulting in hypermethylation of XYLT1 exon 1. The GGC repeat region contains (GGC)n-AGC-(GGC)n-(GGA)n. Other loss of function variants in this gene also cause disease. Normal: 9-20 GGC repeats Pathogenic: 120-800 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Corneal Dystrophy v1.12 | TCF4_FECD3_CTG | Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Marked STR: TBP_SCA17_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Classified STR: TBP_SCA17_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.35 | TBP_SCA17_CAG | Bryony Thompson Str: tbp_sca17_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.34 | TBP_SCA17_CAG |
Bryony Thompson STR: TBP_SCA17_CAG was added STR: TBP_SCA17_CAG was added to Early-onset Parkinson disease. Sources: Expert list Mode of inheritance for STR: TBP_SCA17_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: TBP_SCA17_CAG were set to 10484774; 20301611; 29325606; 27172828; 14638975; 11313753; 11914409 Phenotypes for STR: TBP_SCA17_CAG were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: TBP_SCA17_CAG was set to GREEN STR: TBP_SCA17_CAG was marked as clinically relevant STR: TBP_SCA17_CAG was marked as current diagnostic Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.577 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2509 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.39 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.33 | TAF1_XDP_CCCTCT | Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.143 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2508 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.142 | SAMD12_FAME1_TTTCA | Bryony Thompson Classified STR: SAMD12_FAME1_TTTCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.142 | SAMD12_FAME1_TTTCA | Bryony Thompson Str: samd12_fame1_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2507 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.141 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2506 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.58 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4_RILPL1_CGG was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Marked STR: ATXN8OS_SCA8_CTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Classified STR: ATXN8OS_SCA8_CTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.32 | ATXN8OS_SCA8_CTG | Bryony Thompson Str: atxn8os_sca8_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.31 | ATXN8OS_SCA8_CTG |
Bryony Thompson STR: ATXN8OS_SCA8_CTG was added STR: ATXN8OS_SCA8_CTG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN8OS_SCA8_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN8OS_SCA8_CTG were set to 24285970; 20301445; 10192387 Phenotypes for STR: ATXN8OS_SCA8_CTG were set to Spinocerebellar ataxia 8 MIM#608768 Review for STR: ATXN8OS_SCA8_CTG was set to GREEN STR: ATXN8OS_SCA8_CTG was marked as clinically relevant STR: ATXN8OS_SCA8_CTG was marked as current diagnostic Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X] ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats Alleles of questionable significance: 50-70 repeats. Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Marked STR: PPP2R2B_SCA12_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Classified STR: PPP2R2B_SCA12_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.30 | PPP2R2B_SCA12_CAG | Bryony Thompson Str: ppp2r2b_sca12_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.29 | PPP2R2B_SCA12_CAG |
Bryony Thompson STR: PPP2R2B_SCA12_CAG was added STR: PPP2R2B_SCA12_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: PPP2R2B_SCA12_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PPP2R2B_SCA12_CAG were set to 31286011; 27864267; 33811808; 10581021 Phenotypes for STR: PPP2R2B_SCA12_CAG were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: PPP2R2B_SCA12_CAG was set to GREEN STR: PPP2R2B_SCA12_CAG was marked as clinically relevant STR: PPP2R2B_SCA12_CAG was marked as current diagnostic Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead affects the expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Uncertain: ~40-50 repeats have been reported, 43 repeats is the lowest reported in an established affected individual in a family with SCA12 Established pathogenic (used as diagnostic cut-off): ≥51 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2505 | PPP2R2B_SCA12_CAG | Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2504 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV_PLIN4 was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.57 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Classified STR: PABPN1_OPMD_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.56 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.55 | PABPN1_OPMD_GCN |
Bryony Thompson STR: PABPN1_OPMD_GCN was added STR: PABPN1_OPMD_GCN was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list Mode of inheritance for STR: PABPN1_OPMD_GCN was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for STR: PABPN1_OPMD_GCN were set to 9462747; 20301305 Phenotypes for STR: PABPN1_OPMD_GCN were set to Oculopharyngeal muscular dystrophy MIM#164300 Review for STR: PABPN1_OPMD_GCN was set to GREEN STR: PABPN1_OPMD_GCN was marked as clinically relevant STR: PABPN1_OPMD_GCN was marked as current diagnostic Added comment: NM_004643.3:c.4_6[X] Expected gain of function mechanism of disease Normal allele: (GCN)10 / Ala10 Autosomal recessive: (GCN)11/Ala11 Autosomal dominant: (GCN)12-17 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Marked STR: PABPN1_OPMD_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | PABPN1_OPMD_GCN | Bryony Thompson Str: pabpn1_opmd_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Marked STR: NUTM2B-AS1_OPDM_CCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Classified STR: NUTM2B-AS1_OPDM_CCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.54 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson Str: nutm2b-as1_opdm_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.53 | NUTM2B-AS1_OPDM_CCG |
Bryony Thompson STR: NUTM2B-AS1_OPDM_CCG was added STR: NUTM2B-AS1_OPDM_CCG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Literature Mode of inheritance for STR: NUTM2B-AS1_OPDM_CCG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: NUTM2B-AS1_OPDM_CCG were set to 31332380; 37923380; 39308795; 38159879 Phenotypes for STR: NUTM2B-AS1_OPDM_CCG were set to Oculopharyngodistal myopathy MONDO:0025193 Review for STR: NUTM2B-AS1_OPDM_CCG was set to GREEN STR: NUTM2B-AS1_OPDM_CCG was marked as clinically relevant Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes. NR_120611.1:n.192CCG[X] 4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Marked STR: NOTCH2NLC_NIID_GGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson Str: notch2nlc_niid_ggc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.38 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.28 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2503 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.576 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.26 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.52 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Regression v0.575 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2502 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Marked STR: MARCH6_FAME3_TTTCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Classified STR: MARCH6_FAME3_TTTCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.140 | MARCH6_FAME3_TTTCA | Bryony Thompson Str: march6_fame3_tttca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.139 | MARCH6_FAME3_TTTCA |
Bryony Thompson STR: MARCH6_FAME3_TTTCA was added STR: MARCH6_FAME3_TTTCA was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for STR: MARCH6_FAME3_TTTCA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MARCH6_FAME3_TTTCA were set to 31664039 Phenotypes for STR: MARCH6_FAME3_TTTCA were set to Epilepsy, familial adult myoclonic, 3 MIM#613608 Review for STR: MARCH6_FAME3_TTTCA was set to GREEN STR: MARCH6_FAME3_TTTCA was marked as clinically relevant STR: MARCH6_FAME3_TTTCA was marked as current diagnostic Added comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.51 | LRP12_OPDM1_CGG | Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.33 | LRP12_ALS_CGG | Bryony Thompson LRP12-ALS_CGG was changed to LRP12_ALS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Marked STR: JPH3_HDL2_CTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Classified STR: JPH3_HDL2_CTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.27 | JPH3_HDL2_CTG | Bryony Thompson Str: jph3_hdl2_ctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.26 | JPH3_HDL2_CTG |
Bryony Thompson changed review comment from: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29 Sources: Literature; to: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included Full penetrance: ≥40 repeats |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.26 | JPH3_HDL2_CTG |
Bryony Thompson STR: JPH3_HDL2_CTG was added STR: JPH3_HDL2_CTG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: JPH3_HDL2_CTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: JPH3_HDL2_CTG were set to 11558794; 20301701 Phenotypes for STR: JPH3_HDL2_CTG were set to Huntington disease-like 2 MIM#606438 Review for STR: JPH3_HDL2_CTG was set to GREEN STR: JPH3_HDL2_CTG was marked as clinically relevant STR: JPH3_HDL2_CTG was marked as current diagnostic Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.37 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2501 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.25 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.316 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.138 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.114 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Marked STR: GLS_GDPAG_GCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.137 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Classified STR: GLS_GDPAG_GCA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.135 | GLS_GDPAG_GCA | Bryony Thompson Str: gls_gdpag_gca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.113 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Aminoacidopathy v1.134 | GLS_GDPAG_GCA |
Bryony Thompson STR: GLS_GDPAG_GCA was added STR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list Mode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: GLS_GDPAG_GCA were set to 30970188 Phenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Review for STR: GLS_GDPAG_GCA was set to GREEN STR: GLS_GDPAG_GCA was marked as clinically relevant STR: GLS_GDPAG_GCA was marked as current diagnostic Added comment: NM_014905.5(GLS):c.-212_-210GCA[X] 3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous Metabolic Disorders v1.49 | GLS_GDPAG_GCA | Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2500 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.50 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Marked STR: FXN_FRDA_GAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Marked STR: FXN_FRDA_GAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.25 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Classified STR: FXN_FRDA_GAA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.973 | FXN_FRDA_GAA | Bryony Thompson Str: fxn_frda_gaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.24 | FXN_FRDA_GAA |
Bryony Thompson STR: FXN_FRDA_GAA was added STR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916 Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300 Review for STR: FXN_FRDA_GAA was set to GREEN STR: FXN_FRDA_GAA was marked as clinically relevant STR: FXN_FRDA_GAA was marked as current diagnostic Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.972 | FXN_FRDA_GAA |
Bryony Thompson STR: FXN_FRDA_GAA was added STR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list Mode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FXN_FRDA_GAA were set to 20301458; 8596916 Phenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300 Review for STR: FXN_FRDA_GAA was set to GREEN STR: FXN_FRDA_GAA was marked as clinically relevant STR: FXN_FRDA_GAA was marked as current diagnostic Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.23 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.3 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Marked STR: FOXL2_BPES_GCN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Classified STR: FOXL2_BPES_GCN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.347 | FOXL2_BPES_GCN | Bryony Thompson Str: foxl2_bpes_gcn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Blepharophimosis v1.2 | FOXL2_BPES_GCN |
Bryony Thompson STR: FOXL2_BPES_GCN was added STR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808 Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996 Review for STR: FOXL2_BPES_GCN was set to GREEN STR: FOXL2_BPES_GCN was marked as clinically relevant STR: FOXL2_BPES_GCN was marked as current diagnostic Added comment: NM_023067.2:c.661_702[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 14 Pathogenic repeat number: 19-24 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.346 | FOXL2_BPES_GCN |
Bryony Thompson STR: FOXL2_BPES_GCN was added STR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature Mode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808 Phenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996 Review for STR: FOXL2_BPES_GCN was set to GREEN STR: FOXL2_BPES_GCN was marked as clinically relevant STR: FOXL2_BPES_GCN was marked as current diagnostic Added comment: NM_023067.2:c.661_702[X] Mechanism of disease is polyAlanine tract leading to a loss of function of the protein Normal repeat number: 14 Pathogenic repeat number: 19-24 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Marked STR: FMR1_FXS_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Classified STR: FMR1_FXS_CGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.112 | FMR1_FXS_CGG | Bryony Thompson Str: fmr1_fxs_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.24 | FMR1_FXTAS_CGG | Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.111 | FMR1_FXS_CGG |
Bryony Thompson STR: FMR1_FXS_CGG was added STR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184 Phenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome MIM#300624 Review for STR: FMR1_FXS_CGG was set to GREEN STR: FMR1_FXS_CGG was marked as clinically relevant STR: FMR1_FXS_CGG was marked as current diagnostic Added comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] Loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson Marked STR: FMR1_FXPOI_CGG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.345 | FMR1_FXPOI_CGG | Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Marked STR: EIF4A3_RCPS_complex as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.49 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.264 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.14 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Classified STR: EIF4A3_RCPS_complex as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.110 | EIF4A3_RCPS_complex | Bryony Thompson Str: eif4a3_rcps_complex has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pierre Robin Sequence v0.48 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clefting disorders v0.263 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mandibulofacial Acrofacial dysostosis v1.13 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.109 | EIF4A3_RCPS_complex |
Bryony Thompson STR: EIF4A3_RCPS_complex was added STR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243 Phenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: EIF4A3_RCPS_complex was set to GREEN STR: EIF4A3_RCPS_complex was marked as clinically relevant STR: EIF4A3_RCPS_complex was marked as current diagnostic Added comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Marked gene: CAPN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Gene: capn3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.142 | CAPN3 | Zornitza Stark Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.141 | CAPN3 | Zornitza Stark Publications for gene: CAPN3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Marked gene: CANT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Gene: cant1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.140 | CANT1 | Zornitza Stark Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.139 | CANT1 | Zornitza Stark Publications for gene: CANT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Marked gene: C5orf42 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Gene: c5orf42 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.138 | C5orf42 | Zornitza Stark Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.137 | C5orf42 | Zornitza Stark Publications for gene: C5orf42 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEIOB |
Jasmine Chew gene: MEIOB was added gene: MEIOB was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MEIOB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MEIOB were set to 28206990; 34392356; 35991565; 37715646; 31000419; 39545410; 30838384 Phenotypes for gene: MEIOB were set to Premature ovarian failure 23, MIM# 620686; Spermatogenic failure 22, MIM# 617706 Review for gene: MEIOB was set to GREEN Added comment: Literature in OMIM- PMID: 28206990; 34392356; 35991565; 37715646; 31000419- multiple unrelated infertile males due to spermatogenic failure and females due to premature ovarian failure carrying biallelic variants, supported by functional evidence. New papers: i) PMID: 39545410- previously reported homozygous nonsense p.(Arg272*) in proband 2136 (Egyptian), with a history of 6 early miscarriages, 3 failed intracytoplasmic sperm injection cycles, 1 HM, and low anti-Müllerian hormone (AMH) (2 times ≤0.2 ng/mL). ii) PMID: 30838384- A novel homozygous frameshift variant in two brothers of Arab ethnicity. This frame-shift is predicted to result in a truncated MEIOB protein, which lacks the conserved C-terminal DNA binding domain. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | SYCP2 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for Hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature; to: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | SYCP2 |
Jasmine Chew gene: SYCP2 was added gene: SYCP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SYCP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYCP2 were set to 31866047; 39202451; 38511217; 37337432; 39545410 Phenotypes for gene: SYCP2 were set to Spermatogenic failure 1, MIM# 258150; Hydatidiform mole Review for gene: SYCP2 was set to GREEN Added comment: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants. New papers (monoallelic and biallelic variants for male infertility): i) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. ii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11). iii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. New paper (biallelic variant for Hydatidiform mole): i) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410- Compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125) Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | CCDC155 |
Jasmine Chew gene: CCDC155 was added gene: CCDC155 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CCDC155 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCDC155 were set to 29790874; 35674372; 36864840; 35708642; 39545410 Phenotypes for gene: CCDC155 were set to Premature ovarian failure 22, MIM# 620548; Spermatogenic failure 88, MIM# 620547 Review for gene: CCDC155 was set to GREEN Added comment: Note- HGNC Approved Gene Symbol: KASH5 Literature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants New paper: i) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | C11orf80 | Jasmine Chew edited their review of gene: C11orf80: Changed publications: 30388401, 36732965 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MAJIN |
Jasmine Chew gene: MAJIN was added gene: MAJIN was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MAJIN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MAJIN were set to 39545410; 33211200 Phenotypes for gene: MAJIN were set to Recurrent hydatidiform mole, non-obstructive azoospermia Review for gene: MAJIN was set to AMBER Added comment: New papers (biallelic variant for HM/male infertility): i) PMID: 39545410- Novel homozygous splice donor site variant c.349+1G>T in patient 1824 (Italian) with 2 HMs followed by secondary infertility and substantially reduced bilateral ovarian volumes. MAJIN codes for a junction protein that forms a complex with TERB1 and TERB2, which together bind to telomeres and anchor them to the inner nuclear membrane components KASH5 and SUN1. This attachment of chromosomes to the nuclear envelope is essential for homologous chromosome movement and synapsis. In mice, both male and female null mutants Majin are infertile (PMID: 26548954). In humans, biallelic mutations in MAJIN have been reported in infertile males. ii) PMID: 33211200- A homozygous p.Arg53His in NOA-affected male (Individual 4- M1646) with high CADD scores and low gnomad freq. Mice disrupted for either Majin or Terb2 display impaired synapsis, zygotene arrest, a lack of postmeiotic cells and infertility (Shibuya et al. 2015; Zhang et al. 2017). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | C11orf80 |
Jasmine Chew gene: C11orf80 was added gene: C11orf80 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: C11orf80 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C11orf80 were set to Recurrent hydatidiform mole 4, MIM # 618432 Review for gene: C11orf80 was set to AMBER Added comment: Note: HGNC Approved Gene Symbol- TOP6BL Literature in OMIM- PubMed: 30388401- Two unrelated females with RHMs carrying a homozygous p.Glu262∗ and p.Ser501Pro, respectively. New paper (biallelic variants for OZEMA/NOA) i) PMID: 36732965- A homozygous LOF p.E162* in four infertile siblings born to a consanguineous marriage, with three brothers suffering from non-obstructive azoospermia and one sister suffering from unexplained infertility. Mouse models carrying similar mutations to that in patients recapitulated the spermatogenic abnormalities of the patient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | DNAAF4 |
Jasmine Chew gene: DNAAF4 was added gene: DNAAF4 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAAF4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAAF4 were set to 23872636; 37674365; 37147940; 36583018; 35903363 Phenotypes for gene: DNAAF4 were set to Primary ciliary dyskinesia 25, MIM# 615482 Review for gene: DNAAF4 was set to GREEN Added comment: Literature in OMIM- PMID: 23872636- biallelic variants reported for PCD, and reduced fertility was observed. New papers (biallelic variants reported for PCD/ infertility): i) PMID: 37674365- A novel homozygous splice acceptor site variant in DNAAF4 in two brother with asthenozoospermia. Functional assay revealed the absence of any exon 7-containing DNAAF4 transcripts in the sperm from P1, unlike in a normal control sample, consistent with the dysfunction or loss of DNAAF4 protein expression that may explain the abnormal sperm phenotypes in this patient. ii) PMID: 37147940- Novel compound heterozygous splice site c.784-1G>A and 20.1 Kb deletion in a male with PCD and asthenoteratozoospermia, resulting in a truncated and functionless DNAAF4 protein. mmunofluorescence analysis indicated that the inner dynein arm was not present in the sperm flagellum, and sperm morphological analysis revealed small sperm with twisted and curved flagella or lacking flagella. iii) PMID: 36583018- A novel homozygous p. G373E variant in a female patient with PCD who was born in a consanguineous family. Functional assays showed that the variant lead to PCD by reducing the stability of DNAAF4 protein. iv) PMID: 35903363- Two homozygous variants, Arg330Trp and p.Arg245*, identified in two unrelated male and female with PCD. The affected male had asthenoteratozoospermia while female with primary infertility. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | TBPL2 |
Jasmine Chew gene: TBPL2 was added gene: TBPL2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TBPL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TBPL2 were set to 37804378; 33966269; 33893736; 33541821 Phenotypes for gene: TBPL2 were set to Oocyte maturation arrest Review for gene: TBPL2 was set to GREEN Added comment: New papers reporting biallelic variants in infertile women: i) PMID: 37804378- Compound heterozygous novel p.Arg268Ter and recurrent p.Arg233Ter in a female with impaired ovarian folliculogenesis. Structure prediction by molecular modeling demonstrated that three-dimensional structure of TBPL2 was destabilized in mutant proteins. ii) PMID: 33966269- Homozygous missense mutation p.C299R in two infertile sisters with oocyte maturation arrest and degeneration from a consanguineous family. Functional assays showed that the transcriptional level of ZP3 was not completely blocked but severely reduced by the regulation of the mutant TBPL2, while the transcriptional level of H2Bc was significantly reduced but to a less severe extent compared with that of ZP3, suggesting that the missense had a damage to the transcription initiation function of TBPL2 and its downstream targeted genes got involved in different degrees. The mutant protein also has less stability, which contributes to the lower activity of transcription initiation in the mutant form. iii) PMID: 33893736- Homozygous splicing variant (c.788 + 3A>G) in two unrelated families characterized by oocyte maturation defects. Functional assays showed that the variant disrupted the integrity of TBPL2 mRNA and affected oocytes showed that vital genes for oocyte maturation and fertilization were widely and markedly downregulated, suggesting that a mutation in TBPL2, led to global gene alterations in oocytes; the same variant reported before in PMID: 33541821 in three affected females with diminished ovarian reserve from 3 independent families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 |
Jasmine Chew changed review comment from: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others- PMID: 32741963, PMID: 36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature; to: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others: PMID: 32741963;36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 | Jasmine Chew edited their review of gene: MEI1: Changed publications: 30388401, 38416203, 34037756, 36759719, 32741963, 36017582 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | MEI1 |
Jasmine Chew gene: MEI1 was added gene: MEI1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MEI1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MEI1 were set to 30388401 Phenotypes for gene: MEI1 were set to Recurrent hydatidiform mole 3, MIM# 618431; Non-obstructive azoospermia Review for gene: MEI1 was set to GREEN Added comment: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA) New papers (biallelic variants for OZEMA): i) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. ii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1. New papers (biallelic variants for NOA): i) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro. - others- PMID: 32741963, PMID: 36017582 Note: Moderate evidence for OZEMA and HM in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | FOXL2 |
Jasmine Chew gene: FOXL2 was added gene: FOXL2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FOXL2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: FOXL2 were set to 12149404; 19429596; 38558253; 36793102; 39545410 Phenotypes for gene: FOXL2 were set to Premature ovarian failure 3, #MIM 608996 Added comment: Literature in OMIM- PubMed: 12149404; 19429596- multiple patients with isolated POF carrying monoallelic variants New papers (monoallelic variants for POI): i) PMID: 38558253- One in-frame deletion and 13 missense variants, including two recurrent ones (p.(Pro212Ala) and p.(Arg349Gly) in 14 patients with POI/DOR. Two variants, (p.(Gly187Asp) and p.(Arg349Gly) have been previously identified in patients with non-syndromic POI (PMID: 19429596 and PMID: 36793102). ii) PMID: 36793102- Sixteen POI patients carrying four different heterozygous variants, including the recurrent p.(Arg349Gly). Functional assay on the recurrent variant showed that the mutant FOXL2 did not present with the transcriptional repressive effect on CYP17A1 expression as shown by wild-type protein. New paper (biallelic variants for HM): i) PMID: 39545410- A novel homozygous missense p.(Phe167Ser) in patient 1690 (South Asian) with 5 CHMs, 3 miscarriages, 1 stillbirth, and 1 live birth. FOXL2 is essential for granulosa cell differentiation and proliferation, as well as ovarian maintenance and function.Therefore, its impairment may affect indirectly the meiotic maturation of oocytes, and may consequently lead to molar pregnancies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | KEL | Achchuthan Shanmugasundram reviewed gene: KEL: Rating: AMBER; Mode of pathogenicity: None; Publications: 30578106, 37978175; Phenotypes: vein of Galen aneurysm, MONDO:0015196; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | NOS3 | Achchuthan Shanmugasundram reviewed gene: NOS3: Rating: AMBER; Mode of pathogenicity: None; Publications: 36941667, 37383439; Phenotypes: Moyamoya disease, MONDO:0016820; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Marked gene: NLRP7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Classified gene: NLRP7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.77 | NLRP7 | Zornitza Stark Gene: nlrp7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Marked gene: MOS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Gene: mos has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Classified gene: MOS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.76 | MOS | Zornitza Stark Gene: mos has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Marked gene: MUSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Added comment: Comment when marking as ready: Severe fetal anomalies can lead to pregnancy loss; however, this is more in scope for the Fetal Anomalies panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Classified gene: MUSK as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.75 | MUSK | Zornitza Stark Gene: musk has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Marked gene: DNAH11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Classified gene: DNAH11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.74 | DNAH11 | Zornitza Stark Gene: dnah11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Marked gene: LHCGR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Classified gene: LHCGR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.73 | LHCGR | Zornitza Stark Gene: lhcgr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Marked gene: FRAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Added comment: Comment when marking as ready: Severe fetal abnormalities can cause pregnancy loss. However, this is more in scope for Fetal anomalies panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Classified gene: FRAS1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.72 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Marked gene: GBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Added comment: Comment when marking as ready: Mechanism of pregnancy loss unclear, could be chance observation. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Marked gene: GBE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Classified gene: GBE1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.71 | GBE1 | Zornitza Stark Gene: gbe1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Marked gene: BTK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Gene: btk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.136 | BTK | Zornitza Stark Phenotypes for gene: BTK were changed from Agammaglobulinemia and isolated hormone deficiency, 307200 (3) to Agammaglobulinemia, X-linked 1 MIM#300755; Bruton-type agammaglobulinemia MONDO:0010421; Isolated growth hormone deficiency, type III, with agammaglobulinemia MIM#307200 MONDO:0010615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.135 | BTK | Zornitza Stark Publications for gene: BTK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Marked gene: BSND as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Gene: bsnd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.134 | BSND | Zornitza Stark Phenotypes for gene: BSND were changed from Bartter syndrome, type 4a, 602522 (3) to Bartter syndrome, type 4a MIM#602522 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.133 | BSND | Zornitza Stark Publications for gene: BSND were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Marked gene: BRWD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Gene: brwd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.132 | BRWD3 | Zornitza Stark Phenotypes for gene: BRWD3 were changed from Mental retardation, X-linked 93, 300659 (3) to Intellectual developmental disorder, X-linked 93 MIM#300659 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.131 | BRWD3 | Zornitza Stark Publications for gene: BRWD3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Marked gene: BRAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Gene: brat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.130 | BRAT1 | Zornitza Stark Phenotypes for gene: BRAT1 were changed from Rigidity and multifocal seizure syndrome, lethal neonatal, 614498 (3) to Rigidity and multifocal seizure syndrome, lethal neonatal, MIM#614498; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.129 | BRAT1 | Zornitza Stark Publications for gene: BRAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Marked gene: BLM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Gene: blm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.128 | BLM | Zornitza Stark Phenotypes for gene: BLM were changed from Bloom syndrome, 210900 (3) to Bloom Syndrome MIM# 210900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.127 | BLM | Zornitza Stark Publications for gene: BLM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Marked gene: BCS1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Gene: bcs1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.126 | BCS1L | Zornitza Stark Phenotypes for gene: BCS1L were changed from GRACILE syndrome, 603358 (3) to GRACILE syndrome, MIM#603358; Mitochondrial complex III deficiency, nuclear type 1, MIM#124000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.125 | BCS1L | Zornitza Stark Publications for gene: BCS1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Marked gene: BCKDHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Gene: bckdhb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.124 | BCKDHB | Zornitza Stark Phenotypes for gene: BCKDHB were changed from Maple syrup urine disease, type Ib, 248600 (3) to Maple syrup urine disease, type Ib 620698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.123 | BCKDHB | Zornitza Stark Publications for gene: BCKDHB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Marked gene: BCKDHA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Gene: bckdha has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.122 | BCKDHA | Zornitza Stark Phenotypes for gene: BCKDHA were changed from Maple syrup urine disease, type Ia, 248600 (3) to Maple syrup urine disease, type Ia, MIM# 248600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.121 | BCKDHA | Zornitza Stark Publications for gene: BCKDHA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Marked gene: BBS9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Gene: bbs9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.120 | BBS9 | Zornitza Stark Phenotypes for gene: BBS9 were changed from Bardet-Biedl syndrome 9, 615986 (3) to Bardet-Biedl syndrome 9 MIM#615986 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.119 | BBS9 | Zornitza Stark Publications for gene: BBS9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Marked gene: BBS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Gene: bbs7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.118 | BBS7 | Zornitza Stark Phenotypes for gene: BBS7 were changed from Bardet-Biedl syndrome 7, 615984 (3) to Bardet-Biedl syndrome 7, MIM# 615984; MONDO:0014435 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.117 | BBS7 | Zornitza Stark Publications for gene: BBS7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Marked gene: BBS5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Gene: bbs5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.116 | BBS5 | Zornitza Stark Phenotypes for gene: BBS5 were changed from Bardet-Biedl syndrome 5, 615983 (3) to Bardet-Biedl syndrome 5, MIM#615983; MONDO:0014434 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.115 | BBS5 | Zornitza Stark Publications for gene: BBS5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Marked gene: BBS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Gene: bbs4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.114 | BBS4 | Zornitza Stark Phenotypes for gene: BBS4 were changed from Bardet-Biedl syndrome 4, 615982 (3) to Bardet-Biedl syndrome 4, MIM#615982 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Marked gene: BBS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Gene: bbs2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.113 | BBS2 | Zornitza Stark Phenotypes for gene: BBS2 were changed from Bardet-Biedl syndrome 2, 615981 (3) to Bardet-Biedl syndrome 2, MIM#615981 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Marked gene: BBS12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Gene: bbs12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.112 | BBS12 | Zornitza Stark Phenotypes for gene: BBS12 were changed from Bardet-Biedl syndrome 12, 615989 (3) to Bardet-Biedl syndrome 12, MIM#615989 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Marked gene: BBS10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Gene: bbs10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.111 | BBS10 | Zornitza Stark Phenotypes for gene: BBS10 were changed from Bardet-Biedl syndrome 10, 615987 (3) to Bardet-Biedl syndrome 10 (MIM#615987) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.110 | BBS10 | Zornitza Stark Publications for gene: BBS10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Marked gene: BBS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Gene: bbs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.109 | BBS1 | Zornitza Stark Phenotypes for gene: BBS1 were changed from Bardet-Biedl syndrome 1, 209900 (3) to Bardet-Biedl syndrome 1, MIM# 209900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.108 | BBS1 | Zornitza Stark Publications for gene: BBS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Marked gene: B3GLCT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Gene: b3glct has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.107 | B3GLCT | Zornitza Stark Phenotypes for gene: B3GLCT were changed from Peters-plus syndrome, 261540 (3) to Peters-plus syndrome (MIM#261540) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.106 | B3GLCT | Zornitza Stark Publications for gene: B3GLCT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.49 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.108 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2499 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2498 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson Marked STR: DAB1_SCA37_ATTTC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson Str: dab1_sca37_atttc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.542 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.136 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Marked STR: CSTB_EPM1_CCCCGCCCCGCG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Classified STR: CSTB_EPM1_CCCCGCCCCGCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.21 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson Str: cstb_epm1_ccccgccccgcg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Progressive Myoclonic Epilepsy v0.20 | CSTB_EPM1_CCCCGCCCCGCG |
Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added STR: CSTB_EPM1_CCCCGCCCCGCG was added to Progressive Myoclonic Epilepsy. Sources: Expert list Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745 Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.135 | CSTB_EPM1_CCCCGCCCCGCG |
Bryony Thompson STR: CSTB_EPM1_CCCCGCCCCGCG was added STR: CSTB_EPM1_CCCCGCCCCGCG was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: CSTB_EPM1_CCCCGCCCCGCG was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CSTB_EPM1_CCCCGCCCCGCG were set to 29325606; 20301321; 9126745 Phenotypes for STR: CSTB_EPM1_CCCCGCCCCGCG were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: CSTB_EPM1_CCCCGCCCCGCG was set to GREEN STR: CSTB_EPM1_CCCCGCCCCGCG was marked as clinically relevant STR: CSTB_EPM1_CCCCGCCCCGCG was marked as current diagnostic Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Marked STR: CNBP_DM2_CCTG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Classified STR: CNBP_DM2_CCTG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.48 | CNBP_DM2_CCTG | Bryony Thompson Str: cnbp_dm2_cctg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.47 | CNBP_DM2_CCTG |
Bryony Thompson STR: CNBP_DM2_CCTG was added STR: CNBP_DM2_CCTG was added to Limb-Girdle Muscular Dystrophy and Distal Myopathy. Sources: Expert list Mode of inheritance for STR: CNBP_DM2_CCTG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CNBP_DM2_CCTG were set to 20301639; 11486088 Phenotypes for STR: CNBP_DM2_CCTG were set to Myotonic dystrophy 2 MIM#602668 Review for STR: CNBP_DM2_CCTG was set to GREEN STR: CNBP_DM2_CCTG was marked as clinically relevant STR: CNBP_DM2_CCTG was marked as current diagnostic Added comment: HGVS nomenclature: NM_003418.4:c.-14-833_-14-830[X] Toxic gain of function RNA expected mechanism of disease Normal: ≤30 uninterrupted CCTG repeats, 11-26 CCTG repeats with any GCTC or TCTG interruptions Unknown significance (normal vs. mutable): 27-29 CCTG repeats Mutable normal (premutation) alleles. ~30-~54 CCTG repeats Unknown significance (premutation vs pathogenic): ~55-74 CCTG repeats Pathogenic: ~75-11,000 CCTG repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2497 | CNBP_DM2_CCTG | Bryony Thompson DM2 was changed to CNBP_DM2_CCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.280 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Incidentalome v0.315 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.23 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.32 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.36 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2496 | BEAN1_SCA31_TGGAA | Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2495 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.223 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Marked STR: ATXN3_SCA3_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Classified STR: ATXN3_SCA3_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.22 | ATXN3_SCA3_CAG | Bryony Thompson Str: atxn3_sca3_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.21 | ATXN3_SCA3_CAG |
Bryony Thompson STR: ATXN3_SCA3_CAG was added STR: ATXN3_SCA3_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN3_SCA3_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN3_SCA3_CAG were set to 11176969; 7574470; 7874163; 20301375; 29325606 Phenotypes for STR: ATXN3_SCA3_CAG were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3 Review for STR: ATXN3_SCA3_CAG was set to GREEN STR: ATXN3_SCA3_CAG was marked as clinically relevant STR: ATXN3_SCA3_CAG was marked as current diagnostic Added comment: NM_004993.5:c.886_888CAG[X] Toxic aggregation and mislocalization in neurons is mechanism of disease Normal: ≤44 repeats, mostly <31 repeats Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3 Pathogenic (full penetrance): ≥60 repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2494 | ATXN3_SCA3_CAG | Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Marked STR: ATXN2_SCA2_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Classified STR: ATXN2_SCA2_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.20 | ATXN2_SCA2_CAG | Bryony Thompson Str: atxn2_sca2_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.19 | ATXN2_SCA2_CAG |
Bryony Thompson STR: ATXN2_SCA2_CAG was added STR: ATXN2_SCA2_CAG was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: ATXN2_SCA2_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATXN2_SCA2_CAG were set to 11761482; 17923635; 8896555; 29325606; 20301452 Phenotypes for STR: ATXN2_SCA2_CAG were set to Spinocerebellar ataxia 2 MIM#183090 Review for STR: ATXN2_SCA2_CAG was set to GREEN STR: ATXN2_SCA2_CAG was marked as clinically relevant STR: ATXN2_SCA2_CAG was marked as current diagnostic Added comment: NM_002973.3:c.496_498CAG[X] Toxic protein aggregation is mechanism of disease Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2) Uncertain: 32 repeats ALS risk allele: 30-32 repeats Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life Full penetrance: ≥35 repeats Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.31 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2493 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2492 | ATXN1_SCA1_CAG | Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.18 | ATXN1_SCA1_CAG | Bryony Thompson ATXN1_CAG was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2491 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.541 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Classified gene: ATXN10 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Added comment: Comment on list classification: Only a single family reported | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.17 | ATXN10 | Bryony Thompson Gene: atxn10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Marked STR: ATN1_DRPLA_CAG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Classified STR: ATN1_DRPLA_CAG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.134 | ATN1_DRPLA_CAG | Bryony Thompson Str: atn1_drpla_cag has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.133 | ATN1_DRPLA_CAG |
Bryony Thompson STR: ATN1_DRPLA_CAG was added STR: ATN1_DRPLA_CAG was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ATN1_DRPLA_CAG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: ATN1_DRPLA_CAG were set to 8136840; 8136826; 29325606; 20301664 Phenotypes for STR: ATN1_DRPLA_CAG were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: ATN1_DRPLA_CAG was set to GREEN STR: ATN1_DRPLA_CAG was marked as clinically relevant STR: ATN1_DRPLA_CAG was marked as current diagnostic Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.35 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Marked gene: CAPRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Classified gene: CAPRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.34 | CAPRIN1 | Bryony Thompson Gene: caprin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Marked gene: NACC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Classified gene: NACC1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.279 | NACC1 | Bryony Thompson Gene: nacc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Marked gene: NAA15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Classified gene: NAA15 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.278 | NAA15 | Bryony Thompson Gene: naa15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Marked gene: PAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Classified gene: PAH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.277 | PAH | Bryony Thompson Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.107 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.132 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Marked STR: ARX_EIEE1_GCN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Classified STR: ARX_EIEE1_GCN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.276 | ARX_EIEE1_GCN2 | Bryony Thompson Str: arx_eiee1_gcn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.106 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.131 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.275 | ARX_EIEE1_GCN2 |
Bryony Thompson STR: ARX_EIEE1_GCN2 was added STR: ARX_EIEE1_GCN2 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN2 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN2 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN2 was set to GREEN STR: ARX_EIEE1_GCN2 was marked as clinically relevant STR: ARX_EIEE1_GCN2 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.429GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 2 of 2 polyAla tracts associated with disease Normal repeat number: 12 Pathogenic repeat number: 20 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.130 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.130 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.105 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.129 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.129 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Marked STR: ARX_EIEE1_GCN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.274 | ARX_EIEE1_GCN1 | Bryony Thompson Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.104 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.128 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Genetic Epilepsy. Sources: Expert list Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.273 | ARX_EIEE1_GCN1 |
Bryony Thompson STR: ARX_EIEE1_GCN1 was added STR: ARX_EIEE1_GCN1 was added to Dystonia - complex. Sources: Expert Review Mode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808 Phenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510 Review for STR: ARX_EIEE1_GCN1 was set to GREEN STR: ARX_EIEE1_GCN1 was marked as clinically relevant STR: ARX_EIEE1_GCN1 was marked as current diagnostic Added comment: NM_139058.3(ARX):c.306GGC[X] Mechanism of disease is polyAlanine tract associated with dominant-negative effect PolyAla tract 1 of 2 polyAla tracts associated with disease Normal repeat number: 16 Pathogenic repeat number: 23 Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia and Chorea v0.272 | ARX | Bryony Thompson Tag STR tag was added to gene: ARX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.30 | AR_SBMA_CAG | Bryony Thompson SBMA was changed to AR_SBMA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Marked STR: AFF2_FRAXE_GCC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Classified STR: AFF2_FRAXE_GCC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2490 | AFF2_FRAXE_GCC | Bryony Thompson Str: aff2_fraxe_gcc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2489 | AFF2_FRAXE_GCC |
Bryony Thompson STR: AFF2_FRAXE_GCC was added STR: AFF2_FRAXE_GCC was added to Mendeliome. Sources: Expert list Mode of inheritance for STR: AFF2_FRAXE_GCC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: AFF2_FRAXE_GCC were set to 8334699; 8673085; 11388762 Phenotypes for STR: AFF2_FRAXE_GCC were set to Intellectual developmental disorder, X-linked 109 MIM#309548 Review for STR: AFF2_FRAXE_GCC was set to GREEN STR: AFF2_FRAXE_GCC was marked as clinically relevant STR: AFF2_FRAXE_GCC was marked as current diagnostic Added comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25) Loss of function through methylation silencing is the mechanism of disease Normal - 5-44 repeats Inconclusive - 45-54 repeats Premutation - 55-200 repeats Abnormal - >200 or >230 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.103 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2488 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v1.46 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Marked STR: PRNP_CJD_octapeptide as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Classified STR: PRNP_CJD_octapeptide as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.16 | PRNP_CJD_octapeptide | Bryony Thompson Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.15 | PRNP_CJD_octapeptide |
Bryony Thompson STR: PRNP_CJD_octapeptide was added STR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407 Phenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP_CJD_octapeptide was set to GREEN STR: PRNP_CJD_octapeptide was marked as clinically relevant STR: PRNP_CJD_octapeptide was marked as current diagnostic Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v1.33 | PRNP_CJD_octapeptide | Bryony Thompson CJD was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.255 | ZIC3_VACTERLX_GCC | Bryony Thompson VACTERLX was changed to ZIC3_VACTERLX_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.254 | NUTM2B-AS1_OPDM_CCG | Bryony Thompson NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.253 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.252 | NUTM2B-AS1_OPML1_CCG | Bryony Thompson OPML1 was changed to NUTM2B-AS1_OPML1_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.251 | NIPA1_ALS_GCG | Bryony Thompson NIPA1 was changed to NIPA1_ALS_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.250 | TMEM185A_FRAXF_GCC | Bryony Thompson FRAXF was changed to TMEM185A_FRAXF_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.249 | CBL_FRA11B_CCG | Bryony Thompson FRA11B was changed to CBL_FRA11B_CCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.248 | C11orf80_FRA11A_CGG | Bryony Thompson FRA11A was changed to C11orf80_FRA11A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.247 | TNRC6A_FAME6_TTTCA | Bryony Thompson FAME6 was changed to TNRC6A_FAME6_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.246 | YEATS2_FAME4_TTTCA | Bryony Thompson FAME4 was changed to YEATS2_FAME4_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.245 | SAMD12_FAME1_TTTGA | Bryony Thompson FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.244 | THAP11_SCA_CAG | Bryony Thompson SCA_THAP11_CAG was changed to THAP11_SCA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.243 | ZNF713_FRA7A_CGG | Bryony Thompson FRA7A was changed to ZNF713_FRA7A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.242 | AFF3_FRA2A_CGG | Bryony Thompson FRA2A was changed to AFF3_FRA2A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.241 | DIP2B_FRA12A_CGG | Bryony Thompson FRA12A was changed to DIP2B_FRA12A_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.240 | RAPGEF2_FAME7_TTTCA | Bryony Thompson FAME7 was changed to RAPGEF2_FAME7_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.239 | DMD_DMD_GAA | Bryony Thompson DMD was changed to DMD_DMD_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.238 | RUNX2_CCD_GCN | Bryony Thompson CCD was changed to RUNX2_CCD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.14 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v2.13 | RFC1_CANVAS_ANNGN |
Bryony Thompson STR: RFC1_CANVAS_ANNGN was added STR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature Mode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364 Phenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180 Review for STR: RFC1_CANVAS_ANNGN was set to GREEN STR: RFC1_CANVAS_ANNGN was marked as clinically relevant STR: RFC1_CANVAS_ANNGN was marked as current diagnostic Added comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2487 | Bryony Thompson removed STR:CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2486 | CANVAS_ACAGG | Bryony Thompson Classified STR: CANVAS_ACAGG as No list | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2486 | CANVAS_ACAGG | Bryony Thompson Str: canvas_acagg has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.22 | Bryony Thompson removed STR:CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.21 | RFC1_CANVAS_ANNGN | Bryony Thompson Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson Marked STR: RFC1_CANVAS_ANNGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson Str: rfc1_canvas_anngn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Neuropathy v1.20 | RFC1_CANVAS_ANNGN | Bryony Thompson CANVAS was changed to RFC1_CANVAS_ANNGN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.237 | Bryony Thompson removed STR:RFC1_CANVAS_ACAGG from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.236 | RFC1_CANVAS_ANNGN | Bryony Thompson Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN | Bryony Thompson commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.235 | RFC1_CANVAS_ANNGN |
Bryony Thompson RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.234 | RFC1_CANVAS_AAGGG | Bryony Thompson Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2485 | RFC1_CANVAS_ANNGN |
Bryony Thompson RFC1_CANVAS_ANNGG was changed to RFC1_CANVAS_ANNGN Repeated Sequence for RFC1_CANVAS_ANNGN was changed from ANNGG to ANNGN. Publications for STR: RFC1_CANVAS_ANNGN were changed from 33237689; 32694621; 33103729; 35355059 to 33237689; 32694621; 33103729; 35355059; 37450567 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2484 | RFC1_CANVAS_ANNGG | Bryony Thompson RFC1_CANVAS_AMRGG was changed to RFC1_CANVAS_ANNGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2483 | RFC1_CANVAS_AMRGG |
Bryony Thompson CANVAS was changed to RFC1_CANVAS_AMRGG Repeated Sequence for RFC1_CANVAS_AMRGG was changed from AAGGG to ANNGG. Publications for STR: RFC1_CANVAS_AMRGG were changed from 30926972; 32851396 to 33237689; 32694621; 33103729; 35355059 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.233 | RFC1_CANVAS_ACAGG | Bryony Thompson Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.232 | RFC1_CANVAS_ACAGG | Bryony Thompson Str: rfc1_canvas_acagg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.231 | RFC1_CANVAS_ACAGG | Bryony Thompson CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.230 | TAF1_XDP_CCCTCT | Bryony Thompson XDP was changed to TAF1_XDP_CCCTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.229 | TBX1_TOF_GCN | Bryony Thompson TOF was changed to TBX1_TOF_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.228 | HOXD13_SPD1_GCG | Bryony Thompson SPD1 was changed to HOXD13_SPD1_GCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.227 | ATXN8OS_SCA8_CTG | Bryony Thompson SCA8 was changed to ATXN8OS_SCA8_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.226 | ATXN7_SCA7_CAG | Bryony Thompson SCA7 was changed to ATXN7_SCA7_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.225 | CACNA1A_SCA6_CAG | Bryony Thompson SCA6 was changed to CACNA1A_SCA6_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.224 | ZFHX3_SCA4_GGC | Bryony Thompson SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.223 | DAB1_SCA37_ATTTC | Bryony Thompson SCA37 was changed to DAB1_SCA37_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.222 | NOP56_SCA36_GGCCTG | Bryony Thompson SCA36 was changed to NOP56_SCA36_GGCCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.221 | BEAN1_SCA31_TGGAA | Bryony Thompson SCA31 was changed to BEAN1_SCA31_TGGAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.220 | ATXN3_SCA3_CAG | Bryony Thompson SCA3 was changed to ATXN3_SCA3_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.219 | FGF14_SCA27B_GAA | Bryony Thompson SCA27B was changed to FGF14_SCA27B_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.218 | ATXN2_SCA2_CAG | Bryony Thompson SCA2 was changed to ATXN2_SCA2_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.217 | TBP_SCA17_CAG | Bryony Thompson SCA17 was changed to TBP_SCA17_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.216 | PPP2R2B_SCA12_CAG | Bryony Thompson SCA12 was changed to PPP2R2B_SCA12_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.215 | ATXN10_SCA10_ATTCT | Bryony Thompson SCA10 was changed to ATXN10_SCA10_ATTCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.214 | ATXN1_SCA1_CAG | Bryony Thompson SCA1 was changed to ATXN1_SCA1_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.213 | AR_SBMA_CAG | Bryony Thompson SBMA was changed to AR_SBMA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.212 | EIF4A3_RCPS_complex | Bryony Thompson RCPS was changed to EIF4A3_RCPS_complex | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.211 | SOX3_PHPX_GCN | Bryony Thompson PHPX was changed to SOX3_PHPX_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.210 | ABCD3_OPDM_GCC | Bryony Thompson OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.209 | PABPN1_OPMD_GCN | Bryony Thompson OPMD was changed to PABPN1_OPMD_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.208 | RILPL1_OPDM4_CGG | Bryony Thompson OPDM4 was changed to RILPL1_OPDM4_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.207 | GIPC1_OPDM2_CGG | Bryony Thompson OPDM2 was changed to GIPC1_OPDM2_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.206 | LRP12_OPDM1_CGG | Bryony Thompson OPDM1 was changed to LRP12_OPDM1_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.205 | NOTCH2NLC_NIID_GGC | Bryony Thompson NIID was changed to NOTCH2NLC_NIID_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.204 | PLIN4_MRUPAV_33-mer | Bryony Thompson MRUPAV was changed to PLIN4_MRUPAV_33-mer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.203 | RFC1_CANVAS_AAGGG | Bryony Thompson RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.202 | COMP_MEDPSACH_GAC | Bryony Thompson MEDPSACH was changed to COMP_MEDPSACH_GAC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.201 | PRDM12_HSAN8_GCC | Bryony Thompson HSAN8 was changed to PRDM12_HSAN8_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.200 | ZIC2_HPE5_GCN | Bryony Thompson HPE5 was changed to ZIC2_HPE5_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.199 | VWA1_HMNMYO_GCGCGGAGCG | Bryony Thompson HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.198 | HOXA13_HFGS_GCN3 | Bryony Thompson HFGS_tract3 was changed to HOXA13_HFGS_GCN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.197 | HOXA13_HFGS_GCN2 | Bryony Thompson HFGS_tract2 was changed to HOXA13_HFGS_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.196 | HOXA13_HFGS_GCN1 | Bryony Thompson HFGS_tract1 was changed to HOXA13_HFGS_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.195 | JPH3_HDL2_CTG | Bryony Thompson HDL2 was changed to JPH3_HDL2_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.194 | HTT_HD_CAG | Bryony Thompson HD was changed to HTT_HD_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.193 | GLS_GDPAG_GCA | Bryony Thompson GDPAG was changed to GLS_GDPAG_GCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.192 | FMR1_FXTAS_CGG | Bryony Thompson FXTAS was changed to FMR1_FXTAS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.191 | FMR1_FXS_CGG | Bryony Thompson FXS was changed to FMR1_FXS_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.190 | FMR1_FXPOI_CGG | Bryony Thompson FXPOI was changed to FMR1_FXPOI_CGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.189 | C9orf72_FTDALS_GGGGCC | Bryony Thompson FTDALS was changed to C9orf72_FTDALS_GGGGCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.188 | FXN_FRDA_GAA | Bryony Thompson FRDA was changed to FXN_FRDA_GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.187 | AFF2_FRAXE_GCC | Bryony Thompson FRAXE was changed to AFF2_FRAXE_GCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.186 | TCF4_FECD3_CTG | Bryony Thompson FECD3 was changed to TCF4_FECD3_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.185 | MARCH6_FAME3_TTTCA | Bryony Thompson FAME3 was changed to MARCH6_FAME3_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.184 | STARD7_FAME2_ATTTC | Bryony Thompson FAME2 was changed to STARD7_FAME2_ATTTC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.183 | SAMD12_FAME1_TTTCA | Bryony Thompson FAME1 was changed to SAMD12_FAME1_TTTCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.182 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson CSTB_EPM1_dodecamer was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.181 | CSTB_EPM1_dodecamer | Bryony Thompson CSTB_EPM1_CCCCGCCCCGCG was changed to CSTB_EPM1_dodecamer | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.180 | CSTB_EPM1_CCCCGCCCCGCG | Bryony Thompson EPM1 was changed to CSTB_EPM1_CCCCGCCCCGCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.179 | ARX_EIEE1_GCN2 | Bryony Thompson EIEE1_tract2 was changed to ARX_EIEE1_GCN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.178 | ARX_EIEE1_GCN1 | Bryony Thompson EIEE1_tract1 was changed to ARX_EIEE1_GCN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.177 | ATN1_DRPLA_CAG | Bryony Thompson DRPLA was changed to ATN1_DRPLA_CAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.176 | CNBP_DM2_CCTG | Bryony Thompson DM2 was changed to CNBP_DM2_CCTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.175 | DMPK_DM1_CTG | Bryony Thompson DM1 was changed to DMPK_DM1_CTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.174 | XYLT1_DBQD2_GGC | Bryony Thompson DBQD2 was changed to XYLT1_DBQD2_GGC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.173 | PRNP_CJD_octapeptide | Bryony Thompson PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT was changed to PRNP_CJD_octapeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.172 | PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | Bryony Thompson CJD was changed to PRNP_CJD_GGTGGTGGCTGGGGGCAGCCTCAT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.171 | PHOX2B_CCHS_GCN | Bryony Thompson CCHS was changed to PHOX2B_CCHS_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Marked gene: AUH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Gene: auh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.105 | AUH | Zornitza Stark Phenotypes for gene: AUH were changed from 3-methylglutaconic aciduria, type I, 250950 (3) to 3-methylglutaconic aciduria, type I, MIM# 250950; MONDO:0009610 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.104 | AUH | Zornitza Stark Publications for gene: AUH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Marked gene: ATRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Gene: atrx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.103 | ATRX | Zornitza Stark Phenotypes for gene: ATRX were changed from Mental retardation-hypotonic facies syndrome, X-linked, 309580 (3) to Alpha thalassemia X-linked intellectual disability syndrome MONDO:0010519 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.102 | ATRX | Zornitza Stark Publications for gene: ATRX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Marked gene: ATR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Gene: atr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.101 | ATR | Zornitza Stark Phenotypes for gene: ATR were changed from Seckel syndrome 1, 210600 (3) to Seckel syndrome 1(MIM#210600) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.100 | ATR | Zornitza Stark Publications for gene: ATR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Marked gene: ATP8B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Gene: atp8b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.99 | ATP8B1 | Zornitza Stark Phenotypes for gene: ATP8B1 were changed from Cholestasis, progressive familial intrahepatic 1, 211600 (3) to Cholestasis, progressive familial intrahepatic 1, MIM#211600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Marked gene: ATP7B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Gene: atp7b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.98 | ATP7B | Zornitza Stark Phenotypes for gene: ATP7B were changed from Wilson disease, 277900 (3) to Wilson disease (MIM#277900) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.97 | ATP7B | Zornitza Stark Publications for gene: ATP7B were set to 28433102 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Marked gene: ATP7A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Gene: atp7a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.96 | ATP7A | Zornitza Stark Phenotypes for gene: ATP7A were changed from Menkes disease, 309400 (3) to Menkes disease(MIM#309400); Occipital horn syndrome(MIM#304150) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.95 | ATP7A | Zornitza Stark Publications for gene: ATP7A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Marked gene: ATP6V1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Gene: atp6v1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.94 | ATP6V1B1 | Zornitza Stark Phenotypes for gene: ATP6V1B1 were changed from Renal tubular acidosis with deafness, 267300 (3) to Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM# 267300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Marked gene: ATM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Gene: atm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.93 | ATM | Zornitza Stark Phenotypes for gene: ATM were changed from Ataxia-telangiectasia, 208900 (3) to Ataxia-telangiectasia, MIM# 208900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.92 | ATM | Zornitza Stark Publications for gene: ATM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Marked gene: ASS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Gene: ass1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.91 | ASS1 | Zornitza Stark Phenotypes for gene: ASS1 were changed from Citrullinemia, 215700 (3) to Citrullinaemia (MIM# 215700) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.90 | ASS1 | Zornitza Stark Publications for gene: ASS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Marked gene: ASPM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Gene: aspm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.89 | ASPM | Zornitza Stark Phenotypes for gene: ASPM were changed from Microcephaly 5, primary, autosomal recessive, 608716 (3) to Microcephaly 5, primary, autosomal recessive (MIM#608716) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.88 | ASPM | Zornitza Stark Publications for gene: ASPM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Marked gene: ASPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Gene: aspa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.87 | ASPA | Zornitza Stark Phenotypes for gene: ASPA were changed from Canavan disease, 271900 (3) to Canavan disease MIM#271900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.86 | ASPA | Zornitza Stark Publications for gene: ASPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Marked gene: ASNS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Gene: asns has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.85 | ASNS | Zornitza Stark Phenotypes for gene: ASNS were changed from Asparagine synthetase deficiency, 615574 (3) to Asparagine synthetase deficiency, MIM#615574 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.84 | ASNS | Zornitza Stark Publications for gene: ASNS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Marked gene: ASL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Gene: asl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.83 | ASL | Zornitza Stark Phenotypes for gene: ASL were changed from Argininosuccinic aciduria, 207900 (3) to Argininosuccinic aciduria MIM#207900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.82 | ASL | Zornitza Stark Publications for gene: ASL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.81 | ARX | Zornitza Stark Phenotypes for gene: ARX were changed from Hydranencephaly with abnormal genitalia, 300215 (3) to Epileptic encephalopathy, early infantile, 1 MIM#308350; Hydranencephaly with abnormal genitalia MIM#300215; Lissencephaly, X-linked 2 MIM#300215; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510; Proud syndrome MIM#300004 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.80 | ARX | Zornitza Stark Publications for gene: ARX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Marked gene: ARSB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Gene: arsb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.79 | ARSB | Zornitza Stark Phenotypes for gene: ARSB were changed from Mucopolysaccharidosis type VI (Maroteaux-Lamy), 253200 (3) to Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.78 | ARSB | Zornitza Stark Publications for gene: ARSB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Marked gene: ARSA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Gene: arsa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.77 | ARSA | Zornitza Stark Phenotypes for gene: ARSA were changed from Metachromatic leukodystrophy, 250100 (3) to Metachromatic leukodystrophy, MIM# 250100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.76 | ARSA | Zornitza Stark Publications for gene: ARSA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Marked gene: ARL6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Gene: arl6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.75 | ARL6 | Zornitza Stark Phenotypes for gene: ARL6 were changed from Bardet-Biedl syndrome 3, 600151 (3) to Bardet-Biedl syndrome 3, MIM# 600151 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.74 | ARL6 | Zornitza Stark Publications for gene: ARL6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Marked gene: ARL13B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Gene: arl13b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.73 | ARL13B | Zornitza Stark Phenotypes for gene: ARL13B were changed from Joubert syndrome 8, 612291 (3) to Joubert syndrome 8, MIM# 612291 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.72 | ARL13B | Zornitza Stark Publications for gene: ARL13B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Marked gene: ARG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Gene: arg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.71 | ARG1 | Zornitza Stark Phenotypes for gene: ARG1 were changed from Argininemia, 207800 (3) to Argininemia MIM# 207800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.70 | ARG1 | Zornitza Stark Publications for gene: ARG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Marked gene: AQP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Gene: aqp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.69 | AQP2 | Zornitza Stark Phenotypes for gene: AQP2 were changed from Diabetes insipidus, nephrogenic, 125800 (3) to Diabetes insipidus, nephrogenic, type 2 MIM# 125800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.68 | AQP2 | Zornitza Stark Publications for gene: AQP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Marked gene: AP1S2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Gene: ap1s2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.67 | AP1S2 | Zornitza Stark Publications for gene: AP1S2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Marked gene: FOXP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Classified gene: FOXP3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.70 | FOXP3 | Zornitza Stark Gene: foxp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Marked gene: FGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Added comment: Comment when marking as ready: Variants are missense/indels with limited other supporting information, hence Amber rating. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Classified gene: FGA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.69 | FGA | Zornitza Stark Gene: fga has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Marked gene: KPNA7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Classified gene: KPNA7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.68 | KPNA7 | Zornitza Stark Gene: kpna7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Marked gene: CHEK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Classified gene: CHEK1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.67 | CHEK1 | Zornitza Stark Gene: chek1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Marked gene: BTG4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Classified gene: BTG4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.66 | BTG4 | Zornitza Stark Gene: btg4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Marked gene: ASTL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Gene: astl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Classified gene: ASTL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.65 | ASTL | Zornitza Stark Gene: astl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Marked gene: AIRE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Gene: aire has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Classified gene: AIRE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.64 | AIRE | Zornitza Stark Gene: aire has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Marked gene: AMT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Gene: amt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.66 | AMT | Zornitza Stark Phenotypes for gene: AMT were changed from Glycine encephalopathy, 605899 (3) to Glycine encephalopathy MIM#620398 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.65 | AMT | Zornitza Stark Publications for gene: AMT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Marked gene: AMPD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Gene: ampd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.64 | AMPD2 | Zornitza Stark Phenotypes for gene: AMPD2 were changed from Pontocerebellar hypoplasia, type 9, 615809 (3) to Pontocerebellar hypoplasia, type 9, MIM#615809 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.63 | AMPD2 | Zornitza Stark Publications for gene: AMPD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Marked gene: ALPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Gene: alpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.62 | ALPL | Zornitza Stark Phenotypes for gene: ALPL were changed from Hypophosphatasia, infantile, 241500 (3) to Hypophosphatasia, childhood (MIM#241510); Hypophosphatasia, infantile (MIM#241500) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.61 | ALPL | Zornitza Stark Publications for gene: ALPL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Marked gene: ALMS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Gene: alms1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.60 | ALMS1 | Zornitza Stark Phenotypes for gene: ALMS1 were changed from Alstrom syndrome, 203800 (3) to Alstrom syndrome, MIM# 203800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Marked gene: ALG6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Gene: alg6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.59 | ALG6 | Zornitza Stark Phenotypes for gene: ALG6 were changed from Congenital disorder of glycosylation, type Ic, 603147 (3) to Congenital disorder of glycosylation, type Ic, MIM#603147 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.58 | ALG6 | Zornitza Stark Publications for gene: ALG6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Marked gene: ALG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Gene: alg3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.57 | ALG3 | Zornitza Stark Phenotypes for gene: ALG3 were changed from Congenital disorder of glycosylation, type Id, 601110 (3) to Congenital disorder of glycosylation, type Id, MIM#601110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.56 | ALG3 | Zornitza Stark Publications for gene: ALG3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Marked gene: ALG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.55 | ALG1 | Zornitza Stark Phenotypes for gene: ALG1 were changed from Congenital disorder of glycosylation, type Ik, 608540 (3) to Congenital disorder of glycosylation, type Ik, MIM# 608540 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.54 | ALG1 | Zornitza Stark Publications for gene: ALG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Marked gene: ALDOB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Gene: aldob has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.53 | ALDOB | Zornitza Stark Phenotypes for gene: ALDOB were changed from Fructose intolerance, 229600 (3) to Fructose intolerance, hereditary, MIM# 229600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.52 | ALDOB | Zornitza Stark Publications for gene: ALDOB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Marked gene: ALDH7A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Gene: aldh7a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.51 | ALDH7A1 | Zornitza Stark Phenotypes for gene: ALDH7A1 were changed from Epilepsy, pyridoxine-dependent, 266100 (3) to Epilepsy, early-onset, 4, vitamin B6-dependent MIM #266100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.50 | ALDH7A1 | Zornitza Stark Publications for gene: ALDH7A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.49 | ALDH5A1 | Zornitza Stark Marked gene: ALDH5A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.49 | ALDH5A1 | Zornitza Stark Gene: aldh5a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.49 | ALDH5A1 | Zornitza Stark Phenotypes for gene: ALDH5A1 were changed from Succinic semialdehyde dehydrogenase deficiency, 271980 (3) to Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.48 | ALDH5A1 | Zornitza Stark Publications for gene: ALDH5A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.47 | ALDH3A2 | Zornitza Stark Marked gene: ALDH3A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.47 | ALDH3A2 | Zornitza Stark Gene: aldh3a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.47 | ALDH3A2 | Zornitza Stark Phenotypes for gene: ALDH3A2 were changed from Sjogren-Larsson syndrome, 270200 (3) to Sjogren-Larsson syndrome (MIM#270200) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.46 | ALDH18A1 | Zornitza Stark Marked gene: ALDH18A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.46 | ALDH18A1 | Zornitza Stark Gene: aldh18a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.46 | ALDH18A1 | Zornitza Stark Phenotypes for gene: ALDH18A1 were changed from Spastic paraplegia 9B, autosomal recessive, 616586 (3) to Cutis laxa, autosomal recessive, type IIIA (MIM#219150); Spastic paraplegia 9B, autosomal recessive (MIM#616586) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.45 | ALDH18A1 | Zornitza Stark Publications for gene: ALDH18A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.44 | AK2 | Zornitza Stark Marked gene: AK2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.44 | AK2 | Zornitza Stark Gene: ak2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.44 | AK2 | Zornitza Stark Phenotypes for gene: AK2 were changed from Reticular dysgenesis, 267500 (3) to Reticular dysgenesis MIM# 267500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.43 | AK2 | Zornitza Stark Publications for gene: AK2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.42 | AIPL1 | Zornitza Stark Marked gene: AIPL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.42 | AIPL1 | Zornitza Stark Gene: aipl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.42 | AIPL1 | Zornitza Stark Phenotypes for gene: AIPL1 were changed from Cone-rod dystrophy, 604393 (3) to Leber congenital amaurosis 4, 604393; Cone-rod dystrophy, 604393; Retinitis pigmentosa, juvenile, 604393 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.41 | AIPL1 | Zornitza Stark Publications for gene: AIPL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.40 | AIFM1 | Zornitza Stark Marked gene: AIFM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.40 | AIFM1 | Zornitza Stark Gene: aifm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.40 | AIFM1 | Zornitza Stark Phenotypes for gene: AIFM1 were changed from Cowchock syndrome, 310490 (3) to Combined oxidative phosphorylation deficiency 6, 300816; Cowchock syndrome, 310490; Deafness, X-linked 5, 300614; Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.39 | AIFM1 | Zornitza Stark Publications for gene: AIFM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.38 | AHI1 | Zornitza Stark Marked gene: AHI1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.38 | AHI1 | Zornitza Stark Gene: ahi1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.38 | AHI1 | Zornitza Stark Phenotypes for gene: AHI1 were changed from Joubert syndrome-3, 608629 (3) to Joubert syndrome 3 MIM#608629 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.37 | AHI1 | Zornitza Stark Publications for gene: AHI1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.36 | AGXT | Zornitza Stark Marked gene: AGXT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.36 | AGXT | Zornitza Stark Gene: agxt has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.36 | AGXT | Zornitza Stark Phenotypes for gene: AGXT were changed from Hyperoxaluria, primary, type 1, 259900 (3) to Hyperoxaluria, primary, type 1 MIM #259900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.35 | AGXT | Zornitza Stark Publications for gene: AGXT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.34 | AGPS | Zornitza Stark Marked gene: AGPS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.34 | AGPS | Zornitza Stark Gene: agps has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.34 | AGPS | Zornitza Stark Phenotypes for gene: AGPS were changed from Chondrodysplasia punctata, rhizomelic, type 3, 600121 (3) to Rhizomelic chondrodysplasia punctata, type 3, MIM# 600121 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.33 | AGPS | Zornitza Stark Publications for gene: AGPS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.32 | AGL | Zornitza Stark Marked gene: AGL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.32 | AGL | Zornitza Stark Gene: agl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.32 | AGL | Zornitza Stark Phenotypes for gene: AGL were changed from Glycogen storage disease IIIa, 232400 (3) to Glycogen storage disease IIIa and IIIb, MIM#232400 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.31 | AGL | Zornitza Stark Publications for gene: AGL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.30 | AGK | Zornitza Stark Marked gene: AGK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.30 | AGK | Zornitza Stark Gene: agk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.30 | AGK | Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.29 | AGA | Zornitza Stark Marked gene: AGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.29 | AGA | Zornitza Stark Gene: aga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.29 | AGA | Zornitza Stark Phenotypes for gene: AGA were changed from Aspartylglucosaminuria, 208400 (3) to Aspartylglucosaminuria, MIM# 208400, MONDO:0008830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.28 | AGA | Zornitza Stark Publications for gene: AGA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.27 | ADSL | Zornitza Stark Marked gene: ADSL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.27 | ADSL | Zornitza Stark Gene: adsl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.27 | ADSL | Zornitza Stark Phenotypes for gene: ADSL were changed from Adenylosuccinase deficiency, 103050 (3) to Adenylosuccinase deficiency MIM#103050 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.26 | ADSL | Zornitza Stark Publications for gene: ADSL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.25 | ADGRV1 | Zornitza Stark Marked gene: ADGRV1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.25 | ADGRV1 | Zornitza Stark Gene: adgrv1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.25 | ADGRV1 | Zornitza Stark Phenotypes for gene: ADGRV1 were changed from Usher syndrome, type 2C, 605472 (3) to Usher syndrome, type 2C, MIM# 605472 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.24 | ADGRV1 | Zornitza Stark Publications for gene: ADGRV1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.23 | ADGRG1 | Zornitza Stark Marked gene: ADGRG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.23 | ADGRG1 | Zornitza Stark Gene: adgrg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.23 | ADGRG1 | Zornitza Stark Phenotypes for gene: ADGRG1 were changed from Polymicrogyria, bilateral frontoparietal, 606854 (3) to Polymicrogyria, bilateral frontoparietal, MIM#606854 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.22 | ADGRG1 | Zornitza Stark Publications for gene: ADGRG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.21 | ADAR | Zornitza Stark Marked gene: ADAR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.21 | ADAR | Zornitza Stark Gene: adar has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.21 | ADAR | Zornitza Stark Phenotypes for gene: ADAR were changed from Aicardi-Goutieres syndrome 6, 615010 (3) to Aicardi-Goutieres syndrome 6, MIM#615010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.20 | ADAMTS2 | Zornitza Stark Marked gene: ADAMTS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.20 | ADAMTS2 | Zornitza Stark Gene: adamts2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.20 | ADAMTS2 | Zornitza Stark Phenotypes for gene: ADAMTS2 were changed from Ehlers-Danlos syndrome, type VIIC, 225410 (3) to Ehlers-Danlos syndrome, dermatosparaxis type (MIM# 225410) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.19 | ADAMTS2 | Zornitza Stark Publications for gene: ADAMTS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.18 | ADA | Zornitza Stark Marked gene: ADA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.18 | ADA | Zornitza Stark Gene: ada has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.18 | ADA | Zornitza Stark Phenotypes for gene: ADA were changed from Adenosine deaminase deficiency, partial, 102700 (3) to Severe combined immunodeficiency due to ADA deficiency MIM#102700; Adenosine deaminase deficiency, partial MIM#102700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.17 | ADA | Zornitza Stark Publications for gene: ADA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.16 | ACOX1 | Zornitza Stark Marked gene: ACOX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.16 | ACOX1 | Zornitza Stark Gene: acox1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.16 | ACOX1 | Zornitza Stark Phenotypes for gene: ACOX1 were changed from Peroxisomal acyl-CoA oxidase deficiency, 264470 (3) to Peroxisomal acyl-CoA oxidase deficiency, MIM#264470 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.15 | ACOX1 | Zornitza Stark Publications for gene: ACOX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.14 | ACAT1 | Zornitza Stark Marked gene: ACAT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.14 | ACAT1 | Zornitza Stark Gene: acat1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.14 | ACAT1 | Zornitza Stark Phenotypes for gene: ACAT1 were changed from Alpha-methylacetoacetic aciduria, 203750 (3) to Alpha-methylacetoacetic aciduria, MIM#203750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.13 | ACAT1 | Zornitza Stark Publications for gene: ACAT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.12 | ACADVL | Zornitza Stark Marked gene: ACADVL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.12 | ACADVL | Zornitza Stark Gene: acadvl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.12 | ACADVL | Zornitza Stark Phenotypes for gene: ACADVL were changed from VLCAD deficiency, 201475 (3) to VLCAD deficiency (MIM#201475) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.11 | ACADM | Zornitza Stark Marked gene: ACADM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.11 | ACADM | Zornitza Stark Gene: acadm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.11 | ACADM | Zornitza Stark Publications for gene: ACADM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.10 | ACAD9 | Zornitza Stark Marked gene: ACAD9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.10 | ACAD9 | Zornitza Stark Gene: acad9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.10 | ACAD9 | Zornitza Stark Phenotypes for gene: ACAD9 were changed from Mitochondrial complex I deficiency due to ACAD9 deficiency, 611126 (3) to Mitochondrial complex I deficiency, nuclear type 20 (MIM#611126) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.9 | ACAD9 | Zornitza Stark Publications for gene: ACAD9 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCD1 | Zornitza Stark Marked gene: ABCD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCD1 | Zornitza Stark Gene: abcd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.127 | USP25 | Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.127 | USP25 | Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2482 | USP25 | Zornitza Stark Classified gene: USP25 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2482 | USP25 | Zornitza Stark Gene: usp25 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCC8 | Zornitza Stark Marked gene: ABCC8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCC8 | Zornitza Stark Gene: abcc8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCB4 | Zornitza Stark Marked gene: ABCB4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCB4 | Zornitza Stark Gene: abcb4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCB11 | Zornitza Stark Marked gene: ABCB11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCB11 | Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCA3 | Zornitza Stark Marked gene: ABCA3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCA3 | Zornitza Stark Gene: abca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCA12 | Zornitza Stark Marked gene: ABCA12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | ABCA12 | Zornitza Stark Gene: abca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | AARS2 | Zornitza Stark Marked gene: AARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | AAAS | Zornitza Stark Marked gene: AAAS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.8 | AAAS | Zornitza Stark Gene: aaas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | ZNF469 | Zornitza Stark Tag for review tag was added to gene: ZNF469. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | TRAPPC12 | Zornitza Stark Tag for review tag was added to gene: TRAPPC12. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | PUS7 | Zornitza Stark Tag for review tag was added to gene: PUS7. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | PTPN23 | Zornitza Stark Tag for review tag was added to gene: PTPN23. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | RARB | Zornitza Stark Marked gene: RARB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | RARB | Zornitza Stark Gene: rarb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.7 | RARB | Zornitza Stark Phenotypes for gene: RARB were changed from Microphthalmia, syndromic 12, 615524 (3), Autosomal recessive to Microphthalmia, syndromic 12 MIM#615524 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.6 | RARB | Zornitza Stark Publications for gene: RARB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.5 | TMEM94 | Zornitza Stark Marked gene: TMEM94 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.5 | TMEM94 | Zornitza Stark Gene: tmem94 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.5 | TMEM94 | Zornitza Stark Publications for gene: TMEM94 were set to 30526868 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.4 | FAM20C | Zornitza Stark Marked gene: FAM20C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.4 | FAM20C | Zornitza Stark Gene: fam20c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.4 | FAM20C | Zornitza Stark Phenotypes for gene: FAM20C were changed from Raine syndrome, 259775 (3) to Raine syndrome MIM#259775 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.3 | FAM20C | Zornitza Stark Publications for gene: FAM20C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.2 | EIF2B3 | Zornitza Stark Marked gene: EIF2B3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.2 | EIF2B3 | Zornitza Stark Gene: eif2b3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.2 | EIF2B3 | Zornitza Stark Phenotypes for gene: EIF2B3 were changed from Leukoencephalopathy with vanishing white matter, 603896 (3) to Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.1 | EIF2B3 | Zornitza Stark Publications for gene: EIF2B3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.0 | CLN8 | Zornitza Stark Marked gene: CLN8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.0 | CLN8 | Zornitza Stark Gene: cln8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.0 | CLN8 | Zornitza Stark reviewed gene: CLN8: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ceroid lipofuscinosis, neuronal, 8, MIM# 600143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v2.0 | Zornitza Stark promoted panel to version 2.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2159 | SCN1B | Zornitza Stark Marked gene: SCN1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2159 | SCN1B | Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2159 | SCN1B | Zornitza Stark Classified gene: SCN1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2159 | SCN1B | Zornitza Stark Gene: scn1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2158 | POLR1D | Zornitza Stark Marked gene: POLR1D as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2158 | POLR1D | Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2158 | POLR1D | Zornitza Stark Mode of inheritance for gene: POLR1D was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2157 | POLR1D | Zornitza Stark Classified gene: POLR1D as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2157 | POLR1D | Zornitza Stark Gene: polr1d has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2156 | POLR1D | Zornitza Stark reviewed gene: POLR1D: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Treacher Collins syndrome 2 MIM#613717; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2156 | POLE | Zornitza Stark Marked gene: POLE as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2156 | POLE | Zornitza Stark Gene: pole has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2156 | POLE | Zornitza Stark Classified gene: POLE as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2156 | POLE | Zornitza Stark Gene: pole has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2155 | OXCT1 | Zornitza Stark Classified gene: OXCT1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2155 | OXCT1 | Zornitza Stark Gene: oxct1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2154 | HPDL | Zornitza Stark Marked gene: HPDL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2154 | HPDL | Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2154 | HPDL | Zornitza Stark Phenotypes for gene: HPDL were changed from to Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities MIM#619026; Spastic paraplegia 83, autosomal recessive MIM#619027; Leigh syndrome MONDO:0009723 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2153 | HPDL | Zornitza Stark Classified gene: HPDL as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2153 | HPDL | Zornitza Stark Gene: hpdl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2152 | DLAT | Zornitza Stark Classified gene: DLAT as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2152 | DLAT | Zornitza Stark Gene: dlat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2151 | DBR1 | Zornitza Stark Phenotypes for gene: DBR1 were changed from to Xerosis and growth failure with immune and pulmonary dysfunction syndrome MIM#620510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2150 | DBR1 | Zornitza Stark Publications for gene: DBR1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2149 | DBR1 | Zornitza Stark Classified gene: DBR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2149 | DBR1 | Zornitza Stark Gene: dbr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2148 | BRIP1 | Zornitza Stark Phenotypes for gene: BRIP1 were changed from Fanconi Anaemia to Fanconi Anaemia, complementation group J, MIM# 609054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2147 | BRIP1 | Zornitza Stark Classified gene: BRIP1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2147 | BRIP1 | Zornitza Stark Gene: brip1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | BRIP1 | Zornitza Stark edited their review of gene: BRIP1: Added comment: Consider for inclusion in V3 together with all FA genes.; Changed rating: RED; Changed phenotypes: Fanconi Anaemia, complementation group J, MIM# 609054; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | MBTPS1 | Zornitza Stark Tag for review was removed from gene: MBTPS1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.170 | RFC1_CANVAS_ AAGGG | Bryony Thompson CANVAS was changed to RFC1_CANVAS_ AAGGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Repeat Disorders v0.169 | FOXL2_BPES_GCN | Bryony Thompson BPES was changed to FOXL2_BPES_GCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CYP19A1 |
Jasmine Chew gene: CYP19A1 was added gene: CYP19A1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CYP19A1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CYP19A1 were set to 32318648 Phenotypes for gene: CYP19A1 were set to Aromatase deficiency, MIM# 613546 Review for gene: CYP19A1 was set to GREEN Added comment: Primary amenorrhea (feature of POI) and hypergonadotropic hypogonadism are observed in the presence of aromatase deficiency. New papers: i) PMID: 32318648- Novel biallelic CYP19A1 variants in 4 girls manifesting either at birth with atypical genitalia or puberty with poor breast development, clitoromegaly, abnormal menstrual bleeding, polycystic ovaries, and ovarian torsion. All variants except one missense showed a LOF. Protein structure and dynamics studies were in line with functional assays. The 2 female patients with delins variants manifested with ambiguous genitalia at birth. Histologic investigation revealed normal ovarian tissue on one side and a streak gonad on the other. Two female patients presented with abnormal pubertal development and polycystic ovaries. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CYP17A1 |
Jasmine Chew changed review comment from: Primary amenorrhea is a feature of POI/POF- Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation. New papers reported female with primary infertility (PI): i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic. ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys. Sources: Literature; to: Primary amenorrhea is a feature of POI/POF, which is present in 17-alpha-hydroxylase/17,20-lyase deficiency. Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation. New papers reported female with primary infertility (PI): i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic. ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CYP17A1 |
Jasmine Chew gene: CYP17A1 was added gene: CYP17A1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CYP17A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP17A1 were set to 17-alpha-hydroxylase/17,20-lyase deficiency, MIM# 202110 Review for gene: CYP17A1 was set to GREEN Added comment: Primary amenorrhea is a feature of POI/POF- Literature in OMIM- PubMed: 15811924- homozygous truncating p.Y27X in a 20-yr-old female Turkish patient (46,XX) presented with primary amenorrhea, sexual infantilism, and easy fatigability. The patient's steroid metabolism showed increased levels of mineralocorticoid precursors and low or undetectable plasma concentrations of 17-alpha-hydroxycorticoids, androgens, and estrogens before and after ACTH stimulation. New papers reported female with primary infertility (PI): i) PMID: 36385415-reported a case (C29) with PI and recurrent implantation failure (RIF) carrying a homozygous missense p.Arg496His called likely pathogenic. ii) PMID: 39039557- Two Caucasian Israeli-Arab females with PI carrying homozygous missense P.Arg496Cys. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | AIRE |
Jasmine Chew gene: AIRE was added gene: AIRE was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: AIRE was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: AIRE were set to 39318439; 38808199; 30150985 Phenotypes for gene: AIRE were set to Autoimmune polyendocrinopathy syndrome, type I, with or without reversible metaphyseal dysplasia, MIM# 240300 Review for gene: AIRE was set to GREEN Added comment: Hypogonadism in both males and females New papers reporting biallelic variants in affected females with POI as part of the clinical manifestation of Autoimmune Polyglandular Syndrome 1- PMID: 39318439; 38808199; 30150985 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | LHCGR | Jasmine Chew edited their review of gene: LHCGR: Changed publications: 10714363, 8559204, 21683950, 39162678, 37462066, 32860205, 29912377, 30016538 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | LHCGR |
Jasmine Chew gene: LHCGR was added gene: LHCGR was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: LHCGR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: LHCGR were set to 10714363, 8559204, 21683950; 39162678; 37462066; 32860205; 29912377; 30016538 Phenotypes for gene: LHCGR were set to Luteinizing hormone resistance, female/ Leydig cell hypoplasia with pseudohermaphroditism/ Leydig cell hypoplasia with hypergonadotropic hypogonadism, MIM# 238320 Review for gene: LHCGR was set to GREEN Added comment: Literature in OMIM- PMID:10714363, 8559204, 21683950 New papers: i) PMID: 39162678- most recent review paper on LHCGR inactivating variants and reported phenotypes for affected males and females- oligoazoospermia and infertility with arrested spermatogenesis observed in some male patients and oligo-amenorrhea, anovulatory infertility, and failure of oocyte retrieval with hCG treatment despite multi-follicular development on ovulation induction in almost all females ii)PMID: 37462066, PMID: 32860205, PMID: 29912377- novel biallelic variants in affected females with with empty follicle syndrome iii) PMID: 30016538- homozygous truncating variant associated with primary ovarian insufficiency Note: strong evidence for Oocyte/zygote/embryo maturation arrest (OZEMA) and moderate evidence for POI in FeRGI database. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | ITGA3 | Seb Lunke Tag for review was removed from gene: ITGA3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | IGHM | Seb Lunke Tag for review was removed from gene: IGHM. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | ERBB3 | Seb Lunke Tag for review was removed from gene: ERBB3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | TSPYL1 | Seb Lunke Tag review was removed from gene: TSPYL1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | TTN | Seb Lunke Tag for review was removed from gene: TTN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | CERKL | Seb Lunke Tag for review was removed from gene: CERKL. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | CLN3 | Seb Lunke Tag for review was removed from gene: CLN3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | LRSAM1 | Seb Lunke Tag for review was removed from gene: LRSAM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | NCF1 | Seb Lunke Tag for review was removed from gene: NCF1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | RARB | Seb Lunke Tag for review was removed from gene: RARB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | SLC9A3 | Seb Lunke Tag for review was removed from gene: SLC9A3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | FYCO1 | Zornitza Stark Tag review was removed from gene: FYCO1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | PRICKLE1 | Seb Lunke Tag for review was removed from gene: PRICKLE1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | TSPYL1 | Seb Lunke Classified gene: TSPYL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | TSPYL1 | Seb Lunke Added comment: Comment on list classification: Assessed, meets conditions as additional non-founder variants identified | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2146 | TSPYL1 | Seb Lunke Gene: tspyl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | B9D1 | Zornitza Stark Tag for review was removed from gene: B9D1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | ADPRHL2 | Zornitza Stark Tag for review was removed from gene: ADPRHL2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | ACY1 | Zornitza Stark Tag for review was removed from gene: ACY1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | PEX19 | Lilian Rudd Classified gene: PEX19 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | PEX19 | Lilian Rudd Gene: pex19 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | SCO1 | Seb Lunke Classified gene: SCO1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2145 | SCO1 | Seb Lunke Gene: sco1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2144 | PIEZO1 | Zornitza Stark Marked gene: PIEZO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2144 | PIEZO1 | Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2144 | SCO1 | Seb Lunke Tag for review was removed from gene: SCO1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2144 | PIEZO1 | Zornitza Stark Classified gene: PIEZO1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2144 | PIEZO1 | Zornitza Stark Gene: piezo1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2143 | PIEZO1 | Zornitza Stark Tag for review was removed from gene: PIEZO1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2143 | PDHX | Zornitza Stark Classified gene: PDHX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2143 | PDHX | Zornitza Stark Gene: pdhx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2143 | OTULIN | Seb Lunke Classified gene: OTULIN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2143 | OTULIN | Seb Lunke Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | PDHX | Zornitza Stark Tag for review was removed from gene: PDHX. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | OTULIN | Seb Lunke Tag for review was removed from gene: OTULIN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | MTPAP | Zornitza Stark Classified gene: MTPAP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | MTPAP | Zornitza Stark Gene: mtpap has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | CHMP1A | Lilian Rudd Classified gene: CHMP1A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2142 | CHMP1A | Lilian Rudd Gene: chmp1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2141 | MTPAP | Zornitza Stark Tag for review was removed from gene: MTPAP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2141 | CHMP1A | Lilian Rudd Tag for review was removed from gene: CHMP1A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2141 | APC2 | Seb Lunke Classified gene: APC2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2141 | APC2 | Seb Lunke Gene: apc2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | APC2 | Seb Lunke Tag for review was removed from gene: APC2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | AMN | Zornitza Stark Marked gene: AMN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | AMN | Zornitza Stark Added comment: Comment when marking as ready: Treatable, relatively mild disorder, not suitable for inclusion on a reproductive carrier screen. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | AMN | Zornitza Stark Gene: amn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | AMN | Zornitza Stark Classified gene: AMN as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2140 | AMN | Zornitza Stark Gene: amn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2139 | AMN | Zornitza Stark Tag for review was removed from gene: AMN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2139 | AGTR1 | Zornitza Stark Classified gene: AGTR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2139 | AGTR1 | Zornitza Stark Gene: agtr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2138 | YIF1B | Seb Lunke Tag for review was removed from gene: YIF1B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2138 | YIF1B | Seb Lunke Classified gene: YIF1B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2138 | YIF1B | Seb Lunke Gene: yif1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2137 | AGTR1 | Zornitza Stark Tag for review was removed from gene: AGTR1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2137 | UQCRC2 | Zornitza Stark Marked gene: UQCRC2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2137 | UQCRC2 | Zornitza Stark Added comment: Comment when marking as ready: Borderline gene-disease association, keep Amber in the screening context. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2137 | UQCRC2 | Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2137 | UQCRC2 | Zornitza Stark Publications for gene: UQCRC2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2136 | UQCRC2 | Zornitza Stark Classified gene: UQCRC2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2136 | UQCRC2 | Zornitza Stark Gene: uqcrc2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2135 | UQCRC2 | Zornitza Stark Tag for review was removed from gene: UQCRC2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2135 | TRAPPC6B | Seb Lunke Classified gene: TRAPPC6B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2135 | TRAPPC6B | Seb Lunke Gene: trappc6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2134 | TP53RK | Lilian Rudd Classified gene: TP53RK as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2134 | TP53RK | Lilian Rudd Gene: tp53rk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2133 | TRAPPC6B | Seb Lunke Tag for review was removed from gene: TRAPPC6B. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2133 | TP53RK | Lilian Rudd Tag for review was removed from gene: TP53RK. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2133 | TPRKB | Zornitza Stark Marked gene: TPRKB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2133 | TPRKB | Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2133 | TPRKB | Zornitza Stark Publications for gene: TPRKB were set to 30053862; 28805828 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2132 | TPRKB | Zornitza Stark Classified gene: TPRKB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2132 | TPRKB | Zornitza Stark Gene: tprkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | TPRKB | Zornitza Stark Tag for review was removed from gene: TPRKB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | TBC1D20 | Lilian Rudd Tag for review was removed from gene: TBC1D20. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | PKD1L1 | Zornitza Stark Marked gene: PKD1L1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | PKD1L1 | Zornitza Stark Gene: pkd1l1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | PKD1L1 | Zornitza Stark Tag for review was removed from gene: PKD1L1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | TBC1D20 | Lilian Rudd Classified gene: TBC1D20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2131 | TBC1D20 | Lilian Rudd Gene: tbc1d20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2130 | PKD1L1 | Zornitza Stark reviewed gene: PKD1L1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Heterotaxy, visceral, 8, autosomal MIM#617205; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2130 | MFRP | Zornitza Stark Classified gene: MFRP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2130 | MFRP | Zornitza Stark Gene: mfrp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2129 | MFRP | Zornitza Stark Tag for review was removed from gene: MFRP. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2129 | ITGA3 | Lilian Rudd Classified gene: ITGA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2129 | ITGA3 | Lilian Rudd Gene: itga3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2128 | ISCA1 | Zornitza Stark Marked gene: ISCA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2128 | ISCA1 | Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2128 | ISCA1 | Zornitza Stark Classified gene: ISCA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2128 | ISCA1 | Zornitza Stark Gene: isca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2127 | ISCA1 | Zornitza Stark Tag for review was removed from gene: ISCA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2127 | IMPG2 | Zornitza Stark Marked gene: IMPG2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2127 | IMPG2 | Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2127 | IMPG2 | Zornitza Stark Publications for gene: IMPG2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2126 | IMPG2 | Zornitza Stark Classified gene: IMPG2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2126 | IMPG2 | Zornitza Stark Gene: impg2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | IMPG2 | Zornitza Stark Tag for review was removed from gene: IMPG2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA2 | Seb Lunke Tag SV/CNV tag was added to gene: HBA2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA2 | Zornitza Stark Marked gene: HBA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA2 | Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA2 | Zornitza Stark Gene: hba2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA2 | Zornitza Stark Tag for review was removed from gene: HBA2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA1 | Seb Lunke Tag SV/CNV tag was added to gene: HBA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA1 | Zornitza Stark Marked gene: HBA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA1 | Zornitza Stark Added comment: Comment when marking as ready: Discussed again: remains technically challenging therefore not suitable for inclusion. Other screening publicly available in pregnancy. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | HBA1 | Zornitza Stark Gene: hba1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | GTPBP2 | Lilian Rudd Classified gene: GTPBP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2125 | GTPBP2 | Lilian Rudd Gene: gtpbp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2124 | HBA1 | Zornitza Stark Tag for review was removed from gene: HBA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2124 | GTPBP2 | Lilian Rudd Tag for review was removed from gene: GTPBP2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2124 | IGHM | Seb Lunke Classified gene: IGHM as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2124 | IGHM | Seb Lunke Added comment: Comment on list classification: Caution: Gene has annotation issues due to lack of refseq transcript annotation and maybe missed by some analysis pipelines. Checked ok for prepair+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2124 | IGHM | Seb Lunke Gene: ighm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2123 | FITM2 | Zornitza Stark Marked gene: FITM2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2123 | FITM2 | Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2123 | FITM2 | Zornitza Stark Classified gene: FITM2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2123 | FITM2 | Zornitza Stark Gene: fitm2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2122 | FITM2 | Zornitza Stark Tag for review was removed from gene: FITM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2122 | CSMD1 | Lilian Rudd Classified gene: CSMD1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2122 | CSMD1 | Lilian Rudd Gene: csmd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2121 | CSMD1 | Lilian Rudd Tag for review was removed from gene: CSMD1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2121 | COG5 | Zornitza Stark Classified gene: COG5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2121 | COG5 | Zornitza Stark Gene: cog5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | COG5 | Zornitza Stark Tag for review was removed from gene: COG5. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | CHM | Zornitza Stark Marked gene: CHM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | CHM | Zornitza Stark Added comment: Comment when marking as ready: Not suitable for reproductive carrier screening. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | CHM | Zornitza Stark Gene: chm has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | BCAP31 | Lilian Rudd Classified gene: BCAP31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2120 | BCAP31 | Lilian Rudd Gene: bcap31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2119 | BCAP31 | Lilian Rudd Tag for review was removed from gene: BCAP31. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2119 | CHM | Zornitza Stark Tag for review was removed from gene: CHM. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2119 | ACY1 | Zornitza Stark Classified gene: ACY1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2119 | ACY1 | Zornitza Stark Gene: acy1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2118 | TTN | Zornitza Stark Phenotypes for gene: TTN were changed from Myopathy, early-onset, with fatal cardiomyopathy, 611705 (3) to TTN-related myopathy MONDO:0100175 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2117 | XPNPEP3 | Lilian Rudd Classified gene: XPNPEP3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2117 | XPNPEP3 | Lilian Rudd Gene: xpnpep3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2116 | TTN | Zornitza Stark Publications for gene: TTN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2115 | XPNPEP3 | Lilian Rudd Tag for review was removed from gene: XPNPEP3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2115 | TTN | Zornitza Stark Classified gene: TTN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2115 | TTN | Zornitza Stark Gene: ttn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2114 | TTN | Zornitza Stark reviewed gene: TTN: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: TTN-related myopathy MONDO:0100175; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2114 | TMEM94 | Lilian Rudd Classified gene: TMEM94 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2114 | TMEM94 | Lilian Rudd Gene: tmem94 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | TMEM94 | Lilian Rudd Tag for review was removed from gene: TMEM94. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Marked gene: POLA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Added comment: Comment when marking as ready: Inclusion assumes appropriate coverage by capture method (checked for Prepair+) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Tag for review was removed from gene: POLA1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Classified gene: POLA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2113 | POLA1 | Zornitza Stark Gene: pola1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2112 | NTNG2 | Lilian Rudd Classified gene: NTNG2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2112 | NTNG2 | Lilian Rudd Gene: ntng2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | NTNG2 | Lilian Rudd Tag for review was removed from gene: NTNG2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | NCF1 | Zornitza Stark Marked gene: NCF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | NCF1 | Zornitza Stark Added comment: Comment when marking as ready: Remains technically challenging, therefore exclude from V2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | NCF1 | Zornitza Stark Gene: ncf1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | MOGS | Lilian Rudd Classified gene: MOGS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2111 | MOGS | Lilian Rudd Gene: mogs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2110 | MOGS | Lilian Rudd Tag for review was removed from gene: MOGS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2110 | MBTPS1 | Zornitza Stark Phenotypes for gene: MBTPS1 were changed from ?Spondyloepiphyseal dysplasia, Kondo-Fu type, MIM #618392 to Spondyloepiphyseal dysplasia, Kondo-Fu type MIM#618392 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2109 | MBTPS1 | Zornitza Stark Classified gene: MBTPS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2109 | MBTPS1 | Zornitza Stark Gene: mbtps1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2108 | DYNC1I2 | Seb Lunke Classified gene: DYNC1I2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2108 | DYNC1I2 | Seb Lunke Gene: dync1i2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2107 | DYNC1I2 | Seb Lunke Tag for review was removed from gene: DYNC1I2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2107 | ERBB3 | Zornitza Stark Phenotypes for gene: ERBB3 were changed from Visceral neuropathy, familial, 1, autosomal recessive MIM#243180 to Visceral neuropathy, familial, 1, autosomal recessive MIM#243180; Lethal congenital contractural syndrome 2 MIM#607598 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2106 | CSTB | Seb Lunke Tag for review was removed from gene: CSTB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2106 | ERBB3 | Zornitza Stark Classified gene: ERBB3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2106 | ERBB3 | Zornitza Stark Gene: erbb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2105 | CERKL | Lilian Rudd commented on gene: CERKL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2105 | B9D1 | Zornitza Stark Classified gene: B9D1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2105 | B9D1 | Zornitza Stark Gene: b9d1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2104 | ADPRHL2 | Seb Lunke Classified gene: ADPRHL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2104 | ADPRHL2 | Seb Lunke Gene: adprhl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2103 | VKORC1 | Zornitza Stark Marked gene: VKORC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2103 | VKORC1 | Zornitza Stark Added comment: Comment when marking as ready: Treatable condition, vast majority receive Vitamin K at birth; not in scope for panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2103 | VKORC1 | Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2103 | VKORC1 | Zornitza Stark Phenotypes for gene: VKORC1 were changed from Vitamin K-dependent clotting factors, combined deficiency of, 2, 607473 (3) to Vitamin K-dependent clotting factors, combined deficiency of, 2, MIM#607473 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2102 | VKORC1 | Zornitza Stark Publications for gene: VKORC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2101 | VKORC1 | Zornitza Stark Classified gene: VKORC1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2101 | VKORC1 | Zornitza Stark Gene: vkorc1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | RNU4ATAC | Lilian Rudd commented on gene: RNU4ATAC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | VKORC1 | Zornitza Stark Tag for review was removed from gene: VKORC1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | PATL2 | Jasmine Chew edited their review of gene: PATL2: Changed phenotypes: Oocyte/zygote/embryo maturation arrest 4, MIM# 617743 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | RNU4ATAC | Lilian Rudd Tag for review was removed from gene: RNU4ATAC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | SURF1 | Zornitza Stark Tag for review was removed from gene: SURF1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | SLC9A3 | Seb Lunke Classified gene: SLC9A3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2100 | SLC9A3 | Seb Lunke Gene: slc9a3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2099 | RCBTB1 | Zornitza Stark Marked gene: RCBTB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2099 | RCBTB1 | Zornitza Stark Added comment: Comment when marking as ready: Currently, onset appears to mostly in adulthood. Demote and review in the future re new reports with earlier onset. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2099 | RCBTB1 | Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2099 | RCBTB1 | Zornitza Stark Phenotypes for gene: RCBTB1 were changed from Retinal dystrophy with or without extraocular anomalies, 617175 (3), Autosomal recessive to Retinal dystrophy with or without extraocular anomalies (MIM#617175) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2098 | RCBTB1 | Zornitza Stark Publications for gene: RCBTB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2097 | RCBTB1 | Zornitza Stark Classified gene: RCBTB1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2097 | RCBTB1 | Zornitza Stark Gene: rcbtb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2096 | RCBTB1 | Zornitza Stark Tag for review was removed from gene: RCBTB1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2096 | RARB | Seb Lunke Classified gene: RARB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2096 | RARB | Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2096 | RARB | Seb Lunke Gene: rarb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2095 | PRICKLE1 | Zornitza Stark Marked gene: PRICKLE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2095 | PRICKLE1 | Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2095 | PRICKLE1 | Zornitza Stark Phenotypes for gene: PRICKLE1 were changed from Epilepsy, progressive myoclonic 1B, 612437 (3) to Epilepsy, progressive myoclonic 1B, MIM# 612437 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2094 | PRICKLE1 | Zornitza Stark Classified gene: PRICKLE1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2094 | PRICKLE1 | Zornitza Stark Gene: prickle1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2093 | LRSAM1 | Seb Lunke Classified gene: LRSAM1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2093 | LRSAM1 | Seb Lunke Added comment: Comment on list classification: Insufficient evidence for recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2093 | LRSAM1 | Seb Lunke Gene: lrsam1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2092 | LIPC | Zornitza Stark Marked gene: LIPC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2092 | LIPC | Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2092 | LIPC | Zornitza Stark Phenotypes for gene: LIPC were changed from Hepatic lipase deficiency, 614025 (3) to Hepatic lipase deficiency, MIM# 614025 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2091 | LIPC | Zornitza Stark Tag for review was removed from gene: LIPC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2091 | LIPC | Zornitza Stark Classified gene: LIPC as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2091 | LIPC | Zornitza Stark Gene: lipc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2090 | LIPC | Zornitza Stark edited their review of gene: LIPC: Changed rating: RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2090 | LCAT | Lilian Rudd Classified gene: LCAT as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2090 | LCAT | Lilian Rudd Added comment: Comment on list classification: Adult onset | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2090 | LCAT | Lilian Rudd Gene: lcat has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2089 | LCAT | Lilian Rudd Tag for review was removed from gene: LCAT. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2089 | HPD | Zornitza Stark Tag for review was removed from gene: HPD. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2089 | HBB | Zornitza Stark Marked gene: HBB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2089 | HBB | Zornitza Stark Gene: hbb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2089 | HBB | Zornitza Stark Phenotypes for gene: HBB were changed from Thalassemias, beta-, 613985 (3) to Thalassemias, beta-, 613985; Sickle cell anaemia, MIM# 603903 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2088 | CSTB | Seb Lunke Tag STR tag was added to gene: CSTB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2088 | HBB | Zornitza Stark Tag for review was removed from gene: HBB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2088 | GNE | Lilian Rudd Classified gene: GNE as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2088 | GNE | Lilian Rudd Added comment: Comment on list classification: Adult onset | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2088 | GNE | Lilian Rudd Gene: gne has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | GNE | Lilian Rudd Tag for review was removed from gene: GNE. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CTSF | Zornitza Stark Marked gene: CTSF as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CTSF | Zornitza Stark Added comment: Comment when marking as ready: Generally adult onset, out of scope for panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CTSF | Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CSTB | Seb Lunke Classified gene: CSTB as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CSTB | Seb Lunke Added comment: Comment on list classification: Common dodecamer repeat accounts for 90% of variants, not detectable | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2087 | CSTB | Seb Lunke Gene: cstb has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2086 | CTSF | Zornitza Stark Tag for review was removed from gene: CTSF. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2086 | CTSF | Zornitza Stark Classified gene: CTSF as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2086 | CTSF | Zornitza Stark Gene: ctsf has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2085 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2085 | CLN3 | Zornitza Stark Added comment: Comment when marking as ready: Downgrade to Amber until CNV analysis included. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2085 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2085 | CLN3 | Zornitza Stark Classified gene: CLN3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2085 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2084 | CLCNKB | Zornitza Stark Phenotypes for gene: CLCNKB were changed from Bartter syndrome, type 4b, digenic, 613090 (3) to Bartter syndrome, type 3 MIM#607364 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CLCNKB | Zornitza Stark Marked gene: CLCNKB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CLCNKB | Zornitza Stark Added comment: Comment when marking as ready: Digenic forms out of scope for this panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CLCNKB | Zornitza Stark Gene: clcnkb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CLCNKB | Zornitza Stark Tag for review was removed from gene: CLCNKB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CCDC8 | Zornitza Stark Tag for review was removed from gene: CCDC8. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | CHMP1A | Zornitza Stark Tag for review tag was added to gene: CHMP1A. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | BRIP1 | Zornitza Stark Marked gene: BRIP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | BRIP1 | Zornitza Stark Added comment: Comment when marking as ready: Other FA genes not included in panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | BRIP1 | Zornitza Stark Gene: brip1 has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | BRIP1 | Zornitza Stark Tag for review tag was added to gene: BRIP1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | AMN | Zornitza Stark Tag for review tag was added to gene: AMN. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TRAPPC12 | Zornitza Stark Marked gene: TRAPPC12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TRAPPC12 | Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TRAPPC12 | Zornitza Stark Gene: trappc12 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TBC1D20 | Zornitza Stark Marked gene: TBC1D20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TBC1D20 | Zornitza Stark Added comment: Comment when marking as ready: Upgrade to Green in V2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TBC1D20 | Zornitza Stark Gene: tbc1d20 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | TBC1D20 | Zornitza Stark Tag for review tag was added to gene: TBC1D20. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | OPN1LW | Zornitza Stark Marked gene: OPN1LW as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | OPN1LW | Zornitza Stark Gene: opn1lw has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2083 | OPN1LW | Zornitza Stark Publications for gene: OPN1LW were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2082 | SLC39A4 | Zornitza Stark Marked gene: SLC39A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2082 | SLC39A4 | Zornitza Stark Gene: slc39a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2082 | SLC39A4 | Zornitza Stark Phenotypes for gene: SLC39A4 were changed from Acrodermatitis enteropathica, 201100 (3) to Acrodermatitis enteropathica, MIM# 201100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2081 | SLC39A4 | Zornitza Stark Publications for gene: SLC39A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2080 | SLC39A4 | Zornitza Stark reviewed gene: SLC39A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 19370757; Phenotypes: Acrodermatitis enteropathica, MIM# 201100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2080 | SLC30A10 | Zornitza Stark Marked gene: SLC30A10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2080 | SLC30A10 | Zornitza Stark Gene: slc30a10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2080 | SLC30A10 | Zornitza Stark Phenotypes for gene: SLC30A10 were changed from Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 (3) to Hypermanganesemia with dystonia 1, MIM#613280 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2079 | SLC30A10 | Zornitza Stark Publications for gene: SLC30A10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2078 | SLC12A5 | Zornitza Stark Marked gene: SLC12A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2078 | SLC12A5 | Zornitza Stark Gene: slc12a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2078 | SLC12A5 | Zornitza Stark Phenotypes for gene: SLC12A5 were changed from Epileptic encephalopathy, early infantile, 34, 616645 (3), Autosomal recessive to Developmental and epileptic encephalopathy 34 MIM#616645 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2077 | SLC12A5 | Zornitza Stark Publications for gene: SLC12A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2076 | SEC23B | Zornitza Stark Marked gene: SEC23B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2076 | SEC23B | Zornitza Stark Gene: sec23b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2076 | SEC23B | Zornitza Stark Phenotypes for gene: SEC23B were changed from Dyserythropoietic anemia, congenital, type II, 224100 (3) to Dyserythropoietic anaemia, congenital, type II MIM#224100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2075 | SEC23B | Zornitza Stark Publications for gene: SEC23B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2074 | SCNN1B | Zornitza Stark Marked gene: SCNN1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2074 | SCNN1B | Zornitza Stark Gene: scnn1b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2074 | SCNN1B | Zornitza Stark Phenotypes for gene: SCNN1B were changed from Pseudohypoaldosteronism, type I, 264350 (3) to Pseudohypoaldosteronism, type IB2, autosomal recessive, MIM#620125 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2073 | SCNN1B | Zornitza Stark Publications for gene: SCNN1B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2072 | SCN9A | Zornitza Stark Marked gene: SCN9A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2072 | SCN9A | Zornitza Stark Gene: scn9a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2072 | SCN9A | Zornitza Stark Phenotypes for gene: SCN9A were changed from Insensitivity to pain, congenital, 243000 (3) to Insensitivity to pain, congenital, MIM# 243000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2071 | SCN9A | Zornitza Stark Publications for gene: SCN9A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2070 | SAMHD1 | Zornitza Stark Marked gene: SAMHD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2070 | SAMHD1 | Zornitza Stark Gene: samhd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2070 | SAMHD1 | Zornitza Stark Phenotypes for gene: SAMHD1 were changed from Aicardi-Goutieres syndrome 5, 612952 (3) to Aicardi-Goutieres syndrome 5, MIM# 612952 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2069 | SAMHD1 | Zornitza Stark reviewed gene: SAMHD1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Aicardi-Goutieres syndrome 5, MIM# 612952; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2069 | RRM2B | Zornitza Stark Marked gene: RRM2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2069 | RRM2B | Zornitza Stark Gene: rrm2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2069 | RRM2B | Zornitza Stark Phenotypes for gene: RRM2B were changed from Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075 (3) to Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075; Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2068 | RRM2B | Zornitza Stark reviewed gene: RRM2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075, Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | RNF212B | Jasmine Chew edited their review of gene: RNF212B: Changed phenotypes: Female and male infertility with recurrent medically assisted reproduction (MAR) failures | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | RNF212B |
Jasmine Chew gene: RNF212B was added gene: RNF212B was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: RNF212B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RNF212B were set to 40259604; 37124137 Phenotypes for gene: RNF212B were set to Female and male infertility with recurrent medically assisted reproduction (MAR) failures. Review for gene: RNF212B was set to AMBER Added comment: Based on available evidence so far, it seems to be affecting Ashkenazi Jewish population specifically: i) PMID: 40259604- homozygous stop gained variant p.Arg150Ter in a young Ashkenazi Jewish female with a history of RPL underwent five in vitro fertilization cycles with nearly complete arrest of blastocyst development and ubiquitous aneuploidy of maternal origin in arrested embryos. ii) PMID: 37124137- homozygous nonsense variant R150X in two brothers of Turkish Jewish descent and one unrelated Ashkenazi Jewish male with oligoasthenotheratozoospermia and infertility who had undergone numerous fertility treatments and failed IVF cycles. Single-cell RNA sequencing data analysis demonstrated expression of the pathogenic variant during various steps of spermatogenesis and consequent severe genomic instability in their sperm and embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Pneumothorax v1.1 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | PDCD2 |
Jasmine Chew gene: PDCD2 was added gene: PDCD2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PDCD2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDCD2 were set to 40208938 Phenotypes for gene: PDCD2 were set to Non-immune hydrops fetalis, MONDO:0009369; Recurrent pregnancy loss susceptibility, MONDO:0000144 Review for gene: PDCD2 was set to AMBER Added comment: PMID: 40208938- Novel biallelic PDCD2 variants associated with hydrops fetalis and early pregnancy loss in two affected families. Family 1 with RPL had three fetuses with NIHF who were all homozygous for p.(Pro28Ser) in PDCD2, while Family 2 had p.(Pro28Ser) in trans with p.(Arg34Pro) in two fetuses with NIHF. Family 2 was additionally notable for having a healthy child who was homozygous for the reference allele, consistent with appropriate disease segregation with the PDCD2 variants. Functional studies using primary fetal fibroblasts and human cell lines for both variants showed reduced PDCD2 mRNA level in affected patients' fibroblasts, reduced cellular accumulation of mutant proteins with impaired ability to associate with the 40S subunit ribosomal protein uS5, and further depletion of PDCD2 in fibroblast cells severely impacted ribosome biogenesis. It is notable that formation of the PDCD2-uS5 complex was not completely abolished by the patient variants and that rRNA processing was only partially impaired, as indicated by levels of 40S pre-rRNAs. We thus suspect that the PDCD2 pathogenic variants p.(Pro28Ser) and p.(Arg34Pro) are hypomorphic alleles, with a low level of residual function allowing for cellular differentiation and growth to a certain extent. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | MUSK |
Jasmine Chew gene: MUSK was added gene: MUSK was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MUSK was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MUSK were set to 25612909; 25537362; 31750350; 38566418 Phenotypes for gene: MUSK were set to Fetal akinesia deformation sequence 1, MIM# 208150 Review for gene: MUSK was set to AMBER Added comment: i) PMID: 25612909- First to report homozygous frameshift variant p.Thr14Asnfs*9 in all affected fetuses with FADS in an affected family which also has two miscarriages. This variant leads to a complete loss of protein expression. Of note, incomplete loss of MuSK function will cause a CMS phenotype, whereas complete loss of function is lethal. ii) PMID: 25537362- Homozygous missense variant p.Ile575Thr in the intracellular domain of MUSK in 11 out of 14 affected fetuses with lethal FADS (only 11 have DNA available) with a common ancestry from 11 families, suggesting founder effect. iii) PMID: 31750350- Compound heterozygous variants in an affected fetus with lethal FADS (the mother also had previous abortion due to similarly affected fetus) iv) Ding et al, 2020 (DOI: 10.22541/au.160097884.45196854)-novel compound heterozygous in a FADS affected fetus (mother also had two previous pregnancies with similarly affected fetuses, terminated) v) PMID: 38566418- Reviewed previously reported MUSK pathogenic variants (46 patients in total with 29 unique disease-causing variants) appeared in four of the seven MuSK domains, including the Ig1, Frz-like, juxtamembrane, and kinase domains. Homozygous loss-of-function variants resulted in the most severe phenotype (FADS). Note: Classified as amber since most of the reported cases were TOP rather than IUFD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CHRNA1 |
Jasmine Chew changed review comment from: Spontaneous abortion reported before. New papers: i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF. ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L. Sources: Literature; to: Spontaneous abortion reported before. Other papers: i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF. ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CHRNA1 |
Jasmine Chew gene: CHRNA1 was added gene: CHRNA1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CHRNA1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHRNA1 were set to 23037934; 18252226 Phenotypes for gene: CHRNA1 were set to Multiple pterygium syndrome, lethal type, MIM# 253290 Added comment: Spontaneous abortion reported before. New papers: i) PMID: 23037934- A novel homozygous p.R254C variant in a family with recurrent fetal loss due to NIHF. ii) PMID: 18252226- Family CHRNA1-F1 had a family history of spontaneous abortions (IV-2 within the family) and two of the affected fetus (IV-1 stillbirth and IV-3 TOP) carried homozygous R234L. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TTN |
Jasmine Chew changed review comment from: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester. - Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing." ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester. iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, 3 were IUFD. Sources: Literature; to: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester. - Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing." ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester. iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, three members were IUFD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TTN |
Jasmine Chew gene: TTN was added gene: TTN was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TTN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TTN were set to 36977548; 38148006; 29575618 Phenotypes for gene: TTN were set to Lethal congenital contracture syndrome, MONDO:0017436 Review for gene: TTN was set to GREEN Added comment: i) PMID: 36977548- Reported 10 cases from six unrelated families showing different TTN combinations and four of those cases (F3-iii.1, F6-II.1, F6.ii.3, F6.ii.4) died in utero between 2nd-3rd trimester. - Quoted that "Probably, we are still missing the most severe end spectrum of titinopathies, as we are used to studying fetuses from late miscarriages or dead infants, while only few investigations are usually performed on early miscarriages. Moreover, prenatal tests often do not include TTN sequencing." ii)PMID: 38148006- com het p.Arg33743Ter and p.Gln34752Ter in a fetus with with hydrops fetalis and arthrogryposis multiplex congenita, which died in utero in 3rd trimester. iii) PMID: 29575618- homozygous c.36122delC (p. P12041Lfs*20) variant in 8 members of a consanguineous family affected with a lethal congenital contracture syndrome and among those 8, 3 were IUFD. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | STIL |
Jasmine Chew changed review comment from: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans. ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development. Sources: Literature; to: i) PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Functional study showed impairment of the normal regulation of centriole lengthening. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans. ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2068 | ROR2 | Zornitza Stark Marked gene: ROR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2068 | ROR2 | Zornitza Stark Gene: ror2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2068 | ROR2 | Zornitza Stark Phenotypes for gene: ROR2 were changed from Robinow syndrome, autosomal recessive, 268310 (3) to Robinow syndrome, autosomal recessive MIM# 268310 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2067 | ROR2 | Zornitza Stark reviewed gene: ROR2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Robinow syndrome, autosomal recessive MIM# 268310; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | STIL |
Jasmine Chew changed review comment from: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans. ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development Sources: Literature; to: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans. ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | STIL |
Jasmine Chew gene: STIL was added gene: STIL was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: STIL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: STIL were set to 29230157; 33772059 Phenotypes for gene: STIL were set to Recurrent pregnancy loss susceptibility, MONDO:0000144; Primary microcephaly 7, autosomal recessive, MIM# 612703 Review for gene: STIL was set to AMBER Added comment: PMID: 29230157- In a family with multiple miscarriages and 2 terminations of pregnancy due to marked fetal microcephaly, delayed cortical gyrification, and dysgenesis of the corpus callosum, compound heterozygous missense variants (p.H411D and p.M124V) identified in two affected male fetuses with partial agenesis of the corpus callosum. Concluded that the compound heterozygous STIL mutations found by WES in the affected fetuses cause the severe neurodevelopmental defects observed by fetal ultrasound and MRI, possibly also causing the recurrent miscarriages for the couple. The 5 miscarriages occurring in the family may suggest a causal relationship between the STIL mutations and embryonic lethality in humans. ii) PMID: 33772059- A homozygous missense variant p.338H>Y in case 93272, an Iranian family with 4 miscarriages. Fetal autopsy not available for this family. PMID: 10385121 disrupted STIL in mice and the homozygous mutant caused death with neural tube defects, holoprosencephaly and left–right development abnormalities during embryonic development Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2067 | RNASET2 | Zornitza Stark Marked gene: RNASET2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2067 | RNASET2 | Zornitza Stark Gene: rnaset2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2067 | RNASET2 | Zornitza Stark Phenotypes for gene: RNASET2 were changed from Leukoencephalopathy, cystic, without megalencephaly, 612951 (3) to Leukoencephalopathy, cystic, without megalencephaly MIM#612951 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2066 | RNASET2 | Zornitza Stark Publications for gene: RNASET2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2065 | RNASEH2A | Zornitza Stark Marked gene: RNASEH2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2065 | RNASEH2A | Zornitza Stark Gene: rnaseh2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2065 | RNASEH2A | Zornitza Stark Phenotypes for gene: RNASEH2A were changed from Aicardi-Goutieres syndrome 4, 610333 (3) to Aicardi-Goutieres syndrome 4 MIM#610333; RNASEH2A-related type 1 interferonopathy MONDO:0700259 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2064 | RNASEH2A | Zornitza Stark Publications for gene: RNASEH2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2063 | RFX6 | Zornitza Stark Marked gene: RFX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2063 | RFX6 | Zornitza Stark Gene: rfx6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2063 | RFX6 | Zornitza Stark Phenotypes for gene: RFX6 were changed from Mitchell-Riley syndrome, 615710 (3) to Mitchell-Riley syndrome, MIM# 615710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2062 | RFX6 | Zornitza Stark reviewed gene: RFX6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitchell-Riley syndrome, MIM# 615710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2062 | RFT1 | Zornitza Stark Marked gene: RFT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2062 | RFT1 | Zornitza Stark Gene: rft1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2062 | RFT1 | Zornitza Stark Phenotypes for gene: RFT1 were changed from Congenital disorder of glycosylation, type In, 612015 (3) to Congenital disorder of glycosylation, type In, MIM# 612015 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2061 | RFT1 | Zornitza Stark Publications for gene: RFT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RFT1 | Zornitza Stark reviewed gene: RFT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18313027, 19701946, 19856127, 23111317, 30071302, 29923091, 27927990, 26892341; Phenotypes: Congenital disorder of glycosylation, type In, MIM# 612015; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RD3 | Zornitza Stark Marked gene: RD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RD3 | Zornitza Stark Gene: rd3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RD3 | Zornitza Stark reviewed gene: RD3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Leber congenital amaurosis 12, MIM#610612; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RARB | Zornitza Stark Tag for review tag was added to gene: RARB. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RAG1 | Zornitza Stark Marked gene: RAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RAG1 | Zornitza Stark Gene: rag1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2060 | RAG1 | Zornitza Stark Phenotypes for gene: RAG1 were changed from Severe combined immunodeficiency, B cell-negative, 601457 (3) to Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889; Combined cellular and humoral immune defects with granulomas MIM# 233650; Omenn syndrome MIM# 603554; Severe combined immunodeficiency, B cell-negative MIM# 601457 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2059 | RAG1 | Zornitza Stark reviewed gene: RAG1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889, Combined cellular and humoral immune defects with granulomas MIM# 233650, Omenn syndrome MIM# 603554, Severe combined immunodeficiency, B cell-negative MIM# 601457; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TIMP2 |
Jasmine Chew gene: TIMP2 was added gene: TIMP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TIMP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TIMP2 were set to 20847186; 34756330 Phenotypes for gene: TIMP2 were set to Recurrent pregnancy loss susceptibility, MONDO:0000144 Review for gene: TIMP2 was set to AMBER Added comment: i) PMID: 20847186- In family 6, TIMP2 partial duplication (involves Ex1-2) in mother and 4 out of 5 miscarriages. They have not yet been associated with RPL in humans, however, overexpression of TIMP2 was detected in a mouse model of RPL (Dixon et al., 2006). The TIMP2 disruption in miscarriages in Family 6 may have affected the placental development, but the possibility remains that maternal disruption of TIMP2 may contribute to RPL by impairing the remodeling of the endometrium in early pregnancy. Functional study was performed by PMID: 25674159, which showed reduced RNA and protein expression in chorionic villi cultures from miscarriages with the CNV. ii) PMID: 34756330- de novo damaging heterozygous missense TIMP2 variant, c.[553G>A]; p.[Gly185Arg] in an eight-week euploid embryonic loss. The MMP2/TIMP2 complex is involved in several gestational processes including implantation and placentation. iii) PMID: 11912288- The disruption of the TIMP2 gene was considered to be relevant for recurrent miscarriage due to its critical role in modulating invasion of the trophoblast into maternal endometrium and in vascular remodeling and angiogenesis of maternal and placenta tissues in the first trimester. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2059 | PYCR1 | Zornitza Stark Marked gene: PYCR1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2059 | PYCR1 | Zornitza Stark Gene: pycr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2059 | PYCR1 | Zornitza Stark Phenotypes for gene: PYCR1 were changed from Cutis laxa, autosomal recessive, type IIB, 612940 (3) to Cutis laxa, autosomal recessive, type IIB MIM#612940; Cutis laxa, autosomal recessive, type IIIB MIM#614438 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2058 | PYCR1 | Zornitza Stark reviewed gene: PYCR1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cutis laxa, autosomal recessive, type IIB MIM#612940, Cutis laxa, autosomal recessive, type IIIB MIM#614438; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2058 | PSMB8 | Zornitza Stark Marked gene: PSMB8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2058 | PSMB8 | Zornitza Stark Gene: psmb8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2058 | PSMB8 | Zornitza Stark Phenotypes for gene: PSMB8 were changed from Autoinflammation, lipodystrophy, and dermatosis syndrome, 256040 (3) to Proteasome-associated autoinflammatory syndrome 1, MIM# 256040; MONDO:0054698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2057 | PSMB8 | Zornitza Stark Publications for gene: PSMB8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2056 | PSMB8 | Zornitza Stark reviewed gene: PSMB8: Rating: GREEN; Mode of pathogenicity: None; Publications: 21129723, 21881205, 21852578, 21953331; Phenotypes: Proteasome-associated autoinflammatory syndrome 1, MIM# 256040, MONDO:0054698; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2056 | PROS1 | Zornitza Stark Marked gene: PROS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2056 | PROS1 | Zornitza Stark Gene: pros1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2056 | PROS1 | Zornitza Stark Phenotypes for gene: PROS1 were changed from Thrombophilia due to protein S deficiency, autosomal recessive, 614514 (3) to Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2055 | PROS1 | Zornitza Stark reviewed gene: PROS1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Thrombophilia 5 due to protein S deficiency, autosomal recessive #614514; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2055 | PPIB | Zornitza Stark Marked gene: PPIB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2055 | PPIB | Zornitza Stark Gene: ppib has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2055 | PPIB | Zornitza Stark Phenotypes for gene: PPIB were changed from Osteogenesis imperfecta, type IX, #259440 to Osteogenesis imperfecta, type IX MIM#259440 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2054 | PPIB | Zornitza Stark Publications for gene: PPIB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2053 | POMT2 | Zornitza Stark Marked gene: POMT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2053 | POMT2 | Zornitza Stark Gene: pomt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2053 | POMT2 | Zornitza Stark Phenotypes for gene: POMT2 were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, 613150 (3) to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150; Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 2, MIM# 613156 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2052 | POMT2 | Zornitza Stark Publications for gene: POMT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2051 | POLG | Zornitza Stark Marked gene: POLG as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2051 | POLG | Zornitza Stark Gene: polg has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2051 | POLG | Zornitza Stark Phenotypes for gene: POLG were changed from Mitochondrial DNA depletion syndrome 4A (Alpers type), 203700 (3) to Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700; Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2050 | POLG | Zornitza Stark reviewed gene: POLG: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700, Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM#613662; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | KIF14 | Jasmine Chew edited their review of gene: KIF14: Changed phenotypes: Autosomal recessive lethal fetal ciliopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | KIF14 |
Jasmine Chew gene: KIF14 was added gene: KIF14 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: KIF14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KIF14 were set to 24128419; 30388224 Review for gene: KIF14 was set to GREEN Added comment: i) PMID: 24128419- First human phenotype associated with biallelic inactivating mutations of KIF14, reported 2 affected fetuses in a family with a recurrent fetal pattern of multiple congenital anomalies (MCA), which was considered to be lethal because of distinct brain and kidney malformations, which were both terminated before 20 weeks carrying LOF com het p.Glu584Ilefs*16 and p.Arg594*.Very recently, homozygous mutations in Kif14 (G/A substitution at the 3′ splice acceptor site of Kif14 exon 5) were identified in a novel spontaneous mouse mutant, laggard (lag). which recapitulated most of the fetal phenotypes including the brain malformations, reduced brain size, general growth restriction and early lethality seen in this family (PMID: 23308235). ii) PMID: 30388224- Novel biallelic KIF14 variants in fetuses (IUFD) from 4 unrelated families presenting with strikingly similar severe brain and kidney phenotypes- renal hypodysplasia and microcephaly, diagnosed as lethal, highly penetrant syndromic CAKUT with microcephaly. Functional studies using transfection study and zebrafish models are supportive that loss of KIF14 result in defects in cytokinesis, microcephaly and ciliopathy-related phenotypes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2050 | PNPLA6 | Zornitza Stark Marked gene: PNPLA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2050 | PNPLA6 | Zornitza Stark Gene: pnpla6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2050 | PNPLA6 | Zornitza Stark Phenotypes for gene: PNPLA6 were changed from Boucher-Neuhauser syndrome, 215470 (3) to Boucher-Neuhauser syndrome MIM#215470; Oliver-McFarlane syndrome MIM#275400; Spastic paraplegia 39, autosomal recessive MIM#612020 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2049 | PNPLA6 | Zornitza Stark Publications for gene: PNPLA6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2048 | PNP | Zornitza Stark Marked gene: PNP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2048 | PNP | Zornitza Stark Gene: pnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2048 | PNP | Zornitza Stark Publications for gene: PNP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2047 | PNP | Zornitza Stark edited their review of gene: PNP: Changed publications: 3029074, 1384322, 11453975, 32695102, 32514656 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2047 | PNP | Zornitza Stark Phenotypes for gene: PNP were changed from Immunodeficiency due to purine nucleoside phosphorylase deficiency, 613179 (3) to Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2046 | PNP | Zornitza Stark reviewed gene: PNP: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2046 | PHF6 | Zornitza Stark Marked gene: PHF6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2046 | PHF6 | Zornitza Stark Gene: phf6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2046 | PHF6 | Zornitza Stark Phenotypes for gene: PHF6 were changed from Borjeson-Forssman-Lehmann syndrome, 301900 (3) to Borjeson-Forssman-Lehmann syndrome, MIM# 301900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2045 | PHF6 | Zornitza Stark reviewed gene: PHF6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Borjeson-Forssman-Lehmann syndrome, MIM# 301900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | GBE1 |
Jasmine Chew gene: GBE1 was added gene: GBE1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GBE1 were set to 33772059; 25489661; 26166723 Phenotypes for gene: GBE1 were set to Glycogen storage disease IV, MIM# 232500 Review for gene: GBE1 was set to GREEN Added comment: i) PMID: 33772059- one Iranian family with RPL (Fam 90759 , a 13-week fetus with hydrops fetalis observed in ultrasonography) carrying compound heterozygous p.156R>H and c.-35_-54del GCTCAGGCCCCACTCGACCC. ii) PMID: 25489661- compound heterozygous c.1937delT and c.691+2T>C in a female with spontaneous miscarriage at 8 weeks of gestation with diagnosis of Glycogen storage disease type IV (GSD IV) supported by pathological examination of immature villi. iii) PMID: 26166723-ompound heterozygous c.691+2T>C and p.R524X in A 30-yr-old woman presented with 2 consecutive miscarriages within 7 month with diagnosis of Glycogen storage disease type IV (GSD IV) supported by pathological examination of placental tissues. Concluded that glycogen storage disease Type IV can cause early miscarriage and that diagnosis can initially be made on histopathologic examination. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2045 | PET100 | Zornitza Stark Marked gene: PET100 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2045 | PET100 | Zornitza Stark Gene: pet100 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2045 | PET100 | Zornitza Stark Phenotypes for gene: PET100 were changed from Mitochondrial complex IV deficiency, 220110 (3) to Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2044 | PET100 | Zornitza Stark reviewed gene: PET100: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2044 | PDP1 | Zornitza Stark Marked gene: PDP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2044 | PDP1 | Zornitza Stark Gene: pdp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2044 | PDP1 | Zornitza Stark Phenotypes for gene: PDP1 were changed from Pyruvate dehydrogenase phosphatase deficiency, 608782 (3) to Pyruvate dehydrogenase phosphatase deficiency,MIM#608782 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2043 | PDP1 | Zornitza Stark Publications for gene: PDP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2042 | PCSK1 | Zornitza Stark Marked gene: PCSK1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2042 | PCSK1 | Zornitza Stark Gene: pcsk1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2042 | PCSK1 | Zornitza Stark Phenotypes for gene: PCSK1 were changed from Obesity with impaired prohormone processing, 600955 (3) to Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SCN5A |
Jasmine Chew gene: SCN5A was added gene: SCN5A was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SCN5A was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SCN5A were set to 33772059; 32421437; 23571586; 15184283 Review for gene: SCN5A was set to GREEN Added comment: i) PMID: 33772059- An Iranian family with RPL (Fam 94947) without fetal autopsy carrying homozygous missense p.1250T>M. The parents were both carriers with a history of cardiac events in the family. This variant has been reported to cause long QT syndrome 3 (LQT3) (#603830) in the heterozygous state. Homozygous mutations in SCN5A in mice cause intrauterine lethality mostly during organogenesis due to heart defects (PMID: 11972032). ii) PMID: 32421437- de novo SCN5A variants in four cases which all died and three of them died in utero. iii) PMID: 23571586- 5 intrauterine fetal deaths hosted SCN5A rare nonsynonymous genetic variants (p.T220I, p.R1193Q, involving 2 cases, and p.P2006A, involving 2 cases). iv) PMID: 15184283- A case of recurrent third-trimester fetal loss and maternal mosaicism for long-QT syndrome- low level mosaic R1623Q present in mom and cord blood from the third fetus also harbored the mutant allele, suggesting that all 3 cases of late-term fetal distress resulted from germ-line transfer of the LQTS-associated mutation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2041 | PCSK1 | Zornitza Stark Publications for gene: PCSK1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2040 | PCCA | Zornitza Stark Marked gene: PCCA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2040 | PCCA | Zornitza Stark Gene: pcca has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2040 | PCCA | Zornitza Stark Phenotypes for gene: PCCA were changed from Propionicacidemia, 606054 (3) to Propionicacidemia, MIM#606054 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2039 | PCCA | Zornitza Stark Publications for gene: PCCA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2038 | PAK3 | Zornitza Stark Marked gene: PAK3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2038 | PAK3 | Zornitza Stark Gene: pak3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2038 | PAK3 | Zornitza Stark Phenotypes for gene: PAK3 were changed from Mental retardation, X-linked 30/47, 300558 (3) to Intellectual developmental disorder, X-linked 30 MIM#300558 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2037 | PAK3 | Zornitza Stark Publications for gene: PAK3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | FRAS1 |
Jasmine Chew changed review comment from: New papers: i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M. ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss. Sources: Literature; to: New papers: i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M. ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss due to oligohydramnios, renal agenesis and other congenital anomalies. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | FRAS1 |
Jasmine Chew gene: FRAS1 was added gene: FRAS1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FRAS1 were set to 33772059; 32643034 Phenotypes for gene: FRAS1 were set to Fraser syndrome 1, MIM# 219000 Review for gene: FRAS1 was set to GREEN Added comment: New papers: i) PMID: 33772059- An Iranian family with RPL (Fam 90377 with fetal autopsy showing 17 weeks male with Fraser syndrome and Bartsocas-Papas syndrome- syndactyly, dysplastic ears, right kidney agenesis, club foot, flexion contracture of the hip, and atretic external auditory canals) carrying a homozygous missense variant, p.135T>M. ii) PMID: 32643034- Four affected fetus from 4 independent families carrying novel homozygous LOF variants (p.His2995Profs*3, c.9780+2T>C, c.8098+2T>A, c.5217+1G>C) All these affected families had history of miscarriages/ intrauterine fetal loss. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2036 | PAH | Zornitza Stark Marked gene: PAH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2036 | PAH | Zornitza Stark Gene: pah has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2036 | PAH | Zornitza Stark Phenotypes for gene: PAH were changed from Phenylketonuria, 261600 (3) to Phenylketonuria, MIM#261600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2035 | PAH | Zornitza Stark Publications for gene: PAH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2034 | OTUD6B | Zornitza Stark Marked gene: OTUD6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2034 | OTUD6B | Zornitza Stark Gene: otud6b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2034 | OTUD6B | Zornitza Stark Phenotypes for gene: OTUD6B were changed from Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, 617452 (3), Autosomal recessive to Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2033 | OTUD6B | Zornitza Stark Publications for gene: OTUD6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2032 | LRSAM1 | Lilian Rudd Marked gene: LRSAM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2032 | LRSAM1 | Lilian Rudd Added comment: Comment when marking as ready: Only single AR family reported, insufficient evidence, downgrade to RED | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2032 | LRSAM1 | Lilian Rudd Gene: lrsam1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2032 | LRSAM1 | Lilian Rudd Publications for gene: LRSAM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2031 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2031 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2031 | OSGEP | Zornitza Stark Phenotypes for gene: OSGEP were changed from Galloway-Mowat syndrome 3, 617729 (3), Autosomal recessive to Galloway-Mowat syndrome 3, MIM# 617729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2030 | OSGEP | Zornitza Stark Publications for gene: OSGEP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2029 | OSGEP | Zornitza Stark reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2029 | OPA1 | Zornitza Stark Marked gene: OPA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2029 | OPA1 | Zornitza Stark Gene: opa1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2029 | OPA1 | Zornitza Stark Phenotypes for gene: OPA1 were changed from Behr syndrome, 210000 (3), Autosomal recessive to Behr syndrome, MIM#210000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2028 | OPA1 | Zornitza Stark Publications for gene: OPA1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | PUS7 | Lilian Rudd Marked gene: PUS7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | PUS7 | Lilian Rudd Added comment: Comment when marking as ready: Upgrade to green | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | PUS7 | Lilian Rudd Gene: pus7 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | NUP107 | Zornitza Stark Marked gene: NUP107 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | NUP107 | Zornitza Stark Gene: nup107 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2027 | NUP107 | Zornitza Stark Phenotypes for gene: NUP107 were changed from Nephrotic syndrome, type 11, 616730 (3), Autosomal recessive to Galloway-Mowat syndrome 7, MIM#618348; Nephrotic syndrome, type 11, MIM#616730 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2026 | NUP107 | Zornitza Stark Publications for gene: NUP107 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2025 | NUBPL | Zornitza Stark Marked gene: NUBPL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2025 | NUBPL | Zornitza Stark Gene: nubpl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2025 | NUBPL | Zornitza Stark Phenotypes for gene: NUBPL were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 21, MIM#618242 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2024 | NUBPL | Zornitza Stark Publications for gene: NUBPL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2023 | NR0B1 | Zornitza Stark Marked gene: NR0B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2023 | NR0B1 | Zornitza Stark Gene: nr0b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2023 | NR0B1 | Zornitza Stark Phenotypes for gene: NR0B1 were changed from 46XY sex reversal 2, dosage-sensitive, 300018 (3) to Adrenal hypoplasia, congenital, MIM#300200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2022 | NR0B1 | Zornitza Stark Publications for gene: NR0B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2021 | NDUFV2 | Zornitza Stark Marked gene: NDUFV2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2021 | NDUFV2 | Zornitza Stark Gene: ndufv2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2021 | NDUFV2 | Zornitza Stark Phenotypes for gene: NDUFV2 were changed from Mitochondrial complex I deficiency, 252010 (3) to Mitochondrial complex I deficiency, nuclear type 7, MIM#618229, MONDO:0044970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2020 | NDUFV2 | Zornitza Stark Publications for gene: NDUFV2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2019 | NDUFS4 | Zornitza Stark Marked gene: NDUFS4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2019 | NDUFS4 | Zornitza Stark Gene: ndufs4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2019 | NDUFS4 | Zornitza Stark Phenotypes for gene: NDUFS4 were changed from Leigh syndrome, 256000 (3) to Mitochondrial complex I deficiency, nuclear type 1, MIM#252010 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2018 | NCF1 | Lilian Rudd Tag for review tag was added to gene: NCF1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2018 | NDP | Zornitza Stark Marked gene: NDP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2018 | NDP | Zornitza Stark Gene: ndp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2018 | NDP | Zornitza Stark Phenotypes for gene: NDP were changed from Norrie disease, 310600 (3) to Norrie disease, MIM#310600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2017 | NDP | Zornitza Stark Publications for gene: NDP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2016 | NDE1 | Zornitza Stark Marked gene: NDE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2016 | NDE1 | Zornitza Stark Gene: nde1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2016 | NDE1 | Zornitza Stark Phenotypes for gene: NDE1 were changed from Lissencephaly 4 (with microcephaly), 614019 (3) to Lissencephaly 4 (with microcephaly), MIM#614019 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2015 | NDE1 | Zornitza Stark Publications for gene: NDE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2014 | NCF2 | Zornitza Stark Marked gene: NCF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2014 | NCF2 | Zornitza Stark Gene: ncf2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2014 | NCF2 | Zornitza Stark Phenotypes for gene: NCF2 were changed from Chronic granulomatous disease due to deficiency of NCF-2, 233710 (3) to Chronic granulomatous disease 2, autosomal recessive, MIM# 233710 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2013 | NCF2 | Zornitza Stark Publications for gene: NCF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2012 | NAGA | Zornitza Stark Marked gene: NAGA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2012 | NAGA | Zornitza Stark Gene: naga has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2012 | NAGA | Zornitza Stark Phenotypes for gene: NAGA were changed from Schindler disease, type I, 609241 (3) to Schindler disease, type I MIM#609241; Schindler disease, type III MIM#609241 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2011 | NAGA | Zornitza Stark Publications for gene: NAGA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2010 | PDE6B | Lilian Rudd Marked gene: PDE6B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2010 | PDE6B | Lilian Rudd Gene: pde6b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2010 | MYD88 | Zornitza Stark Marked gene: MYD88 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2010 | MYD88 | Zornitza Stark Gene: myd88 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2010 | PDE6B | Lilian Rudd Publications for gene: PDE6B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2009 | MYD88 | Zornitza Stark Phenotypes for gene: MYD88 were changed from Pyogenic bacterial infections, recurrent, due to MYD88 deficiency, 612260 (3) to Immunodeficiency 68, MIM# 612260 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2008 | MYD88 | Zornitza Stark Publications for gene: MYD88 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2007 | MUSK | Zornitza Stark Marked gene: MUSK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2007 | MUSK | Zornitza Stark Gene: musk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2007 | MUSK | Zornitza Stark Phenotypes for gene: MUSK were changed from Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 (3) to Fetal akinesia deformation sequence 1 MIM#208150; Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2006 | MUSK | Zornitza Stark Publications for gene: MUSK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | GBA | Lilian Rudd Marked gene: GBA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | GBA | Lilian Rudd Added comment: Comment when marking as ready: Consider upgrading to green as most common variant detectable and suitable disease for inclusion. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | GBA | Lilian Rudd Gene: gba has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | PIEZO1 |
Jasmine Chew gene: PIEZO1 was added gene: PIEZO1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PIEZO1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PIEZO1 were set to 33772059; 30244526; 26333996 Phenotypes for gene: PIEZO1 were set to Lymphatic malformation 6, MIM# 616843 Review for gene: PIEZO1 was set to GREEN Added comment: i) PMID: 33772059- Two unrelated Iranian families with RPL carrying different biallelic variants (i. Fam 82169 with fetal autopsy showing generalized lymphatic dysplasia of Fotiou with non-immune fetal hydrops carry homozygous LOF c.30_31delAC, ii) fam 95136 without fetal autopsy carrying compound heterozygous p.2195S>L and p.922G>W). ii) PMID: 30244526- Compound heterozygous variants p.Trp1069* and p.Lys2070Gln in a case of a woman with recurrent pregnancies affected by NIHF and had three fetal demises because of severe lymphatic dysplasia. iii) PMID: 26333996- In a recent review of 10 patients within 6 families, 7 of the probands were diagnosed with NIHF, including 2 died in utero, carrying biallelic variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | CHMP1A | Lilian Rudd Marked gene: CHMP1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | CHMP1A | Lilian Rudd Added comment: Comment when marking as ready: Inclusion, green on PanelApp and severe childhood disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | CHMP1A | Lilian Rudd Gene: chmp1a has been removed from the panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | BTG4 |
Jasmine Chew gene: BTG4 was added gene: BTG4 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: BTG4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: BTG4 were set to 32502391; 34647228 Phenotypes for gene: BTG4 were set to Oocyte/zygote/embryo maturation arrest 8, MIM# 619009 Review for gene: BTG4 was set to GREEN Added comment: Literature in OMIM- PMID: 32502391, 34647228- >3 unrelated infertile women due to failure of the fertilized ovum to undergo zygotic cleavage with different biallelic variants. Functional analysis demonstrated LOF, such as reduced mutant protein expression and disruption in the process of maternal mRNA decay, and loss of protein-protein interaction. New paper: i) PMID: 36471203- A novel homozygous truncating variant (p.V195Sfs) in a a female patient with primary infertility and recurrent failure of IVF with zygotic cleavage failure. Co-immunoprecipitation in 293 T cells showed that the mutation abolished the interaction between BTG4 and PABPN1L. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | NLRP2 |
Jasmine Chew gene: NLRP2 was added gene: NLRP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: NLRP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NLRP2 were set to 30877238; 39585517; 39905760 Phenotypes for gene: NLRP2 were set to Oocyte/zygote/embryo maturation arrest 18, MIM# 620332 Review for gene: NLRP2 was set to GREEN Added comment: Literature in OMIM- PMID: 30877238 (>3 unrelated infertile women due to early embryonic arrest with different biallelic variants) New papers (biallelic variants for EEA): i) PMID: 39585517- A novel homozygous protein-truncating (p.Tyr66Thrfs*32) in an infertile female with early embryonic arrest, which resulted in the down-regulation of NLRP2 mRNA expression, truncation of the protein structure, and altered protein localization in cells. ii) PMID: 39905760- Novel compound heterozygous protein-truncating variants ( p.Leu443Phefs*78 and p.Arg935Metfs*15) in a female with primary infertility, four early miscarriages, and one failed attempt of ICSI. The two variants mediate mRNA decay in EBV-transformed lymphoblastoid cells from the patient, lead to decreased NLRP2 protein levels, and alter NLRP2 interactions with other members of the SCMC in vitro. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | MOS |
Jasmine Chew gene: MOS was added gene: MOS was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MOS was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MOS were set to 34779126; 34997960; 35670744; 36403623 Phenotypes for gene: MOS were set to Oocyte/zygote/embryo maturation arrest 20, MIM# 620383 Review for gene: MOS was set to GREEN Added comment: Literature in OMIM- PMID: 34779126; 34997960; 35670744; 36403623- >3 unrelated women with infertility due to early/preimplantation embryonic arrest and fragmentation carrying different biallelic variants. All variants except I197M had functional evidence showing that mutant proteins showed reduced activation/phosphorylation of the MOS downstream targets compared to wildtype MOS. Note: couldn't find new case reports Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | KPNA7 |
Jasmine Chew gene: KPNA7 was added gene: KPNA7 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: KPNA7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KPNA7 were set to 36647821 Phenotypes for gene: KPNA7 were set to Oocyte/zygote/embryo maturation arrest 17, #MIM 620319 Review for gene: KPNA7 was set to GREEN Added comment: Literature in OMIM- PMID:36647821- 10 Chinese women from 10 independent families with infertility due to preimplantation embryo arrest carrying the following biallelic variants: x6 homozygous L203F missense, x3 compound heterozygous L203F/P212L, L203F/Q175K, L203F/C451X, and x1 homozygous V152M. Western blot of transfected HEK293T cells showed that all mutant protein levels were significantly lower than wildtype KPNA7. Mutant KPNA7 showed significantly reduced SV40TNLS protein transport activity compared to wildtype KPNA7. - There were no homozygotes for the recurrent L203F variant either in public databases or in-house control databases. Homozygosity mapping analysis suggested a low probability of founder effect for the recurrent variant L203F. Note: couldn't find new case reports Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | MTTP | Zornitza Stark Marked gene: MTTP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | MTTP | Zornitza Stark Gene: mttp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2005 | MTTP | Zornitza Stark Phenotypes for gene: MTTP were changed from Abetalipoproteinemia, 200100 (3) to Abetalipoproteinemia MIM#200100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2004 | MTTP | Zornitza Stark Publications for gene: MTTP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2003 | MTHFD1 | Zornitza Stark Marked gene: MTHFD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2003 | MTHFD1 | Zornitza Stark Gene: mthfd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2003 | MTHFD1 | Zornitza Stark Phenotypes for gene: MTHFD1 were changed from Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive to Combined immunodeficiency and megaloblastic anaemia with or without hyperhomocysteinemia, 617780 (3), Autosomal recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2002 | MTHFD1 | Zornitza Stark Publications for gene: MTHFD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2001 | MSTO1 | Zornitza Stark Marked gene: MSTO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2001 | MSTO1 | Zornitza Stark Gene: msto1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2001 | MSTO1 | Zornitza Stark Publications for gene: MSTO1 were set to 30684668; 31463572 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2000 | MMP2 | Zornitza Stark Marked gene: MMP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2000 | MMP2 | Zornitza Stark Gene: mmp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.2000 | MMP2 | Zornitza Stark Phenotypes for gene: MMP2 were changed from Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3) to Multicentric osteolysis, nodulosis, and arthropathy, MIM#259600 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1999 | MMP2 | Zornitza Stark Publications for gene: MMP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1998 | MLC1 | Zornitza Stark Marked gene: MLC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1998 | MLC1 | Zornitza Stark Gene: mlc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1998 | MLC1 | Zornitza Stark Phenotypes for gene: MLC1 were changed from Megalencephalic leukoencephalopathy with subcortical cysts, 604004 (3) to Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1997 | MLC1 | Zornitza Stark Publications for gene: MLC1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1996 | MKS1 | Zornitza Stark Marked gene: MKS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1996 | MKS1 | Zornitza Stark Gene: mks1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1996 | MKS1 | Zornitza Stark Phenotypes for gene: MKS1 were changed from Meckel syndrome 1, 249000 (3) to Bardet-Biedl syndrome 13 MIM#615990; Joubert syndrome 28 MIM#617121; Meckel syndrome 1 MIM#249000; Ciliopathy MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1995 | MKS1 | Zornitza Stark Publications for gene: MKS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1994 | MICU1 | Zornitza Stark Marked gene: MICU1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1994 | MICU1 | Zornitza Stark Gene: micu1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1994 | MICU1 | Zornitza Stark Phenotypes for gene: MICU1 were changed from Myopathy with extrapyramidal signs, 615673 (3) to Myopathy with extrapyramidal signs, MIM# 615673 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1993 | MICU1 | Zornitza Stark Publications for gene: MICU1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1992 | MFN2 | Zornitza Stark Marked gene: MFN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1992 | MFN2 | Zornitza Stark Gene: mfn2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1992 | MFN2 | Zornitza Stark Phenotypes for gene: MFN2 were changed from Charcot-Marie-Tooth disease, axonal, type 2A2B, 617087 (3), Autosomal recessive to Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087; Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1991 | MFN2 | Zornitza Stark reviewed gene: MFN2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1991 | MFN2 | Zornitza Stark Publications for gene: MFN2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1990 | METTL23 | Zornitza Stark Marked gene: METTL23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1990 | METTL23 | Zornitza Stark Gene: mettl23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1990 | METTL23 | Zornitza Stark Phenotypes for gene: METTL23 were changed from Mental retardation, autosomal recessive 44, 615942 (3) to Intellectual developmental disorder, autosomal recessive 44, MIM #615942 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1989 | METTL23 | Zornitza Stark Publications for gene: METTL23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CHEK1 | Jasmine Chew edited their review of gene: CHEK1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | CHEK1 |
Jasmine Chew gene: CHEK1 was added gene: CHEK1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CHEK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CHEK1 were set to 33953335; 33948904 Phenotypes for gene: CHEK1 were set to Oocyte/zygote/embryo maturation arrest 21, MIM# 620610 Added comment: Literature in OMIM- PMID: 33953335; 33948904 - >3 unrelated with infertility due to zygote/embryo cleavage arrest with three different missense variants and 1 1bp deletion. Functional studies using transfection studies showed that all mutant increased cytoplasmic localization significantly greater kinase activity. Injection of all mutant cRNA into mouse zygotes with 2 distinct pronuclei also resulted in significantly decreased cleavage rates compared to wildtype. Note: couldn't find new case reports Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1988 | MEGF10 | Zornitza Stark Marked gene: MEGF10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1988 | MEGF10 | Zornitza Stark Gene: megf10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1988 | MEGF10 | Zornitza Stark Phenotypes for gene: MEGF10 were changed from Myopathy, areflexia, respiratory distress, and dysphagia, early-onset, 614399 (3) to Congenital myopathy 10A, severe variant, MIM #614399; Congenital myopathy 10B, mild variant, MIM #620249 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1987 | MEGF10 | Zornitza Stark Publications for gene: MEGF10 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1986 | MED12 | Zornitza Stark Marked gene: MED12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1986 | MED12 | Zornitza Stark Gene: med12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1986 | MED12 | Zornitza Stark Phenotypes for gene: MED12 were changed from Lujan-Fryns syndrome, 309520 (3) to MED12-related intellectual disability syndrome, MONDO:0100000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1985 | MED12 | Zornitza Stark Publications for gene: MED12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1984 | MBTPS2 | Zornitza Stark Marked gene: MBTPS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1984 | MBTPS2 | Zornitza Stark Gene: mbtps2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1984 | MBTPS2 | Zornitza Stark Phenotypes for gene: MBTPS2 were changed from IFAP syndrome with or without BRESHECK syndrome, 308205 (3) to IFAP syndrome with or without BRESHECK syndrome MIM#308205; Osteogenesis imperfecta, type XIX MIM#301014 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1983 | MBTPS2 | Zornitza Stark Publications for gene: MBTPS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1982 | MAPKBP1 | Zornitza Stark Marked gene: MAPKBP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1982 | MAPKBP1 | Zornitza Stark Gene: mapkbp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1982 | MAPKBP1 | Zornitza Stark Phenotypes for gene: MAPKBP1 were changed from Nephronophthisis 20, 617271 (3), Autosomal recessive to Nephronophthisis 20, MIM# 617271; MONDO:0014997 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1981 | MAPKBP1 | Zornitza Stark Publications for gene: MAPKBP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1980 | LYST | Zornitza Stark Marked gene: LYST as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1980 | LYST | Zornitza Stark Gene: lyst has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1980 | LYST | Zornitza Stark Phenotypes for gene: LYST were changed from Chediak-Higashi syndrome, 214500 (3) to Chediak-Higashi syndrome MIM#214500 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1979 | LYST | Zornitza Stark Publications for gene: LYST were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1978 | LRMDA | Zornitza Stark Marked gene: LRMDA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1978 | LRMDA | Zornitza Stark Gene: lrmda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1978 | LRMDA | Zornitza Stark Phenotypes for gene: LRMDA were changed from Albinism, oculocutaneous, type VII, 615179 (3) to Albinism, oculocutaneous, type VII MIM#615179; MONDO:0014070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1977 | LRMDA | Zornitza Stark Publications for gene: LRMDA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1976 | LRAT | Zornitza Stark Marked gene: LRAT as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1976 | LRAT | Zornitza Stark Gene: lrat has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1976 | LRAT | Zornitza Stark Phenotypes for gene: LRAT were changed from Leber congenital amaurosis 14, 613341 (3) to Retinal dystrophy, early-onset severe; Leber congenital amaurosis 14; Retinitis pigmentosa, juvenile, all under MIM #613341 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1975 | LRAT | Zornitza Stark Publications for gene: LRAT were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1974 | LONP1 | Zornitza Stark Marked gene: LONP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1974 | LONP1 | Zornitza Stark Gene: lonp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1974 | LONP1 | Zornitza Stark Phenotypes for gene: LONP1 were changed from CODAS syndrome, 600373 (3) to CODAS syndrome, MIM#600373 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1973 | LONP1 | Zornitza Stark Publications for gene: LONP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1972 | LMOD3 | Zornitza Stark Marked gene: LMOD3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1972 | LMOD3 | Zornitza Stark Gene: lmod3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1972 | LMOD3 | Zornitza Stark Phenotypes for gene: LMOD3 were changed from Nemaline myopathy 10, 616165 (3) to Nemaline myopathy 10, MIM#616165 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1971 | LMOD3 | Zornitza Stark Publications for gene: LMOD3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1970 | LIPC | Zornitza Stark Tag for review tag was added to gene: LIPC. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1970 | LIPC | Zornitza Stark reviewed gene: LIPC: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Hepatic lipase deficiency, MIM# 614025; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1970 | LARS2 | Zornitza Stark Marked gene: LARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1970 | LARS2 | Zornitza Stark Gene: lars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1970 | LARS2 | Zornitza Stark Phenotypes for gene: LARS2 were changed from Perrault syndrome 4, 615300 (3) to Hydrops, lactic acidosis, and sideroblastic anaemia MIM#617021; Perrault syndrome 4 MIM#615300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1969 | LARS2 | Zornitza Stark Publications for gene: LARS2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1968 | LAMB2 | Zornitza Stark Marked gene: LAMB2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1968 | LAMB2 | Zornitza Stark Gene: lamb2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1968 | LAMB2 | Zornitza Stark Phenotypes for gene: LAMB2 were changed from Pierson syndrome, 609049 (3) to Pierson syndrome, MIM# 609049; Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1967 | LAMB2 | Zornitza Stark reviewed gene: LAMB2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pierson syndrome, MIM# 609049, Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1967 | SLC7A7 | Lilian Rudd Marked gene: SLC7A7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1967 | SLC7A7 | Lilian Rudd Gene: slc7a7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1967 | SLC7A7 | Lilian Rudd Publications for gene: SLC7A7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1966 | STIM1 | Lilian Rudd Marked gene: STIM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1966 | STIM1 | Lilian Rudd Gene: stim1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1966 | STIM1 | Lilian Rudd Publications for gene: STIM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1965 | TOE1 | Lilian Rudd Marked gene: TOE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1965 | TOE1 | Lilian Rudd Gene: toe1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1965 | TOE1 | Lilian Rudd Phenotypes for gene: TOE1 were changed from Pontocerebellar hypoplasia, type 7, 614969 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 7 MIM#614969 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1964 | TOE1 | Lilian Rudd Publications for gene: TOE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1963 | TPP1 | Lilian Rudd Marked gene: TPP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1963 | TPP1 | Lilian Rudd Gene: tpp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1963 | TPP1 | Lilian Rudd Phenotypes for gene: TPP1 were changed from Ceroid lipofuscinosis, neuronal, 2, 204500 (3) to Ceroid lipofuscinosis, neuronal, 2 MIM#204500; Spinocerebellar ataxia, autosomal recessive 7 MIM#609270 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1962 | TPP1 | Lilian Rudd Publications for gene: TPP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1961 | TRAPPC11 | Lilian Rudd Marked gene: TRAPPC11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1961 | TRAPPC11 | Lilian Rudd Gene: trappc11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1961 | TRAPPC11 | Lilian Rudd Publications for gene: TRAPPC11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1960 | TRMT10A | Lilian Rudd Marked gene: TRMT10A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1960 | TRMT10A | Lilian Rudd Gene: trmt10a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1960 | TRMT10A | Lilian Rudd Publications for gene: TRMT10A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1959 | UBE3B | Lilian Rudd Marked gene: UBE3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1959 | UBE3B | Lilian Rudd Gene: ube3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1959 | UBE3B | Lilian Rudd Publications for gene: UBE3B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1958 | USH1G | Lilian Rudd Marked gene: USH1G as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1958 | USH1G | Lilian Rudd Gene: ush1g has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1958 | USH1G | Lilian Rudd Publications for gene: USH1G were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1957 | VIPAS39 | Lilian Rudd Marked gene: VIPAS39 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1957 | VIPAS39 | Lilian Rudd Gene: vipas39 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1957 | VIPAS39 | Lilian Rudd Publications for gene: VIPAS39 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | VKORC1 | Lilian Rudd Marked gene: VKORC1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | VKORC1 | Lilian Rudd Added comment: Comment when marking as ready: Single homozygous missense variant, Arg98Trp reported to cause the AR phenotype (PMID: 12704386). (ClinGen 2023) This phenotype causes intracranial haemmorhage in the first weeks of life and ongoing bleeding predisposition but this is reversed with vit K administration so highly treatable. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | VKORC1 | Lilian Rudd Gene: vkorc1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | XRCC4 | Lilian Rudd Marked gene: XRCC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | XRCC4 | Lilian Rudd Gene: xrcc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1956 | XRCC4 | Lilian Rudd Phenotypes for gene: XRCC4 were changed from Short stature, microcephaly, and endocrine dysfunction, 616541 (3), Autosomal recessive to Short stature, microcephaly, and endocrine dysfunction MIM#616541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1955 | XRCC4 | Lilian Rudd Publications for gene: XRCC4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1954 | XYLT2 | Lilian Rudd Marked gene: XYLT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1954 | XYLT2 | Lilian Rudd Gene: xylt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1954 | XYLT2 | Lilian Rudd Phenotypes for gene: XYLT2 were changed from Spondyloocular syndrome, 605822 (3), Autosomal recessive to Spondyloocular syndrome MIM#605822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1953 | XYLT2 | Lilian Rudd Publications for gene: XYLT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ASTL |
Jasmine Chew gene: ASTL was added gene: ASTL was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ASTL was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASTL were set to 34704130; 37640117; 37133443 Phenotypes for gene: ASTL were set to Oocyte/zygote/embryo maturation arrest 11, MIM# 619643 Review for gene: ASTL was set to GREEN Added comment: Literature in OMIM- PMID: 34704130- One Saudi family with 2 sisters with reduced or absent fertility due to oocyte maturation defect carrying a homozygous splice variant. New papers (biallelic variants) i) PMID: 37640117 - Novel compound heterozygous missense variants (p.Arg117Cys and p.Arg274Trp) in a Chinese woman with primary infertility and polyspermy in IVF. Moreover, transfection studies using CHO-K1 cells indicated that mutant cells showed abnormal ovastacin zymogen activation or decreased enzyme stability. ii) PMID: 37133443- Biallelic variants in four independent affected individuals with primary infertility. The frameshift variants significantly decreased the quantity of ASTL protein in vitro. And all missense variants affected the enzymatic activity that cleaves ZP2 in mouse egg in vitro. Three knock-in female mice (corresponding to three missense variants in patients) all show subfertility due to low embryo developmental potential. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | FOXP3 |
Jasmine Chew gene: FOXP3 was added gene: FOXP3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FOXP3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: FOXP3 were set to 28833278; 25546394; 26395338; 26387632; 26009232 Phenotypes for gene: FOXP3 were set to X-linked immunodysregulation, polyendocrinopathy, and enteropathy, MIM# 304790 Review for gene: FOXP3 was set to GREEN Added comment: Multiple papers reported recurrent male miscarriages in different families: i) PMID: 28833278- hemizygous truncating variant (p.D303fs*87) in a most recent male IUFD fetus (hydrops fetalis and fetal death around 18 GA weeks) in a family with recurrent IUFD of 19 males in total occurred at ≤20 weeks of gestation, and the same variant was carried by all five healthy obligatory female carriers. Recent studies involving patients with unexplained recurrent spontaneous abortions have demonstrated that downregulation of Treg cells may be due to a significant decrease in the expression of the FOXP3 gene due to epigenetic suppression of FOXP3 through promoter methylation, thus increasing the risk for IUFD (PMID: 27785899) ii) PMID: 25546394- Two unrelated families with clear evidence of fetal-onset IPEX syndrome (Family 1 had a family history of five miscarriages of males in two generations, positive for hemizygous p.R397W, family 2 with first two males died prematurely after birth and miscarriage of two monochorionic male twins, positive for hemizygous truncating variant (p.S107Nfs*204). iii) PMID: 26395338- A family with the loss of two male fetuses as a result of fetal hydrops of unknown etiology due to novel nonsense variant (p.R337*). iv)PMID: 26387632- The same p.R337* in an unrelated family with multiple male miscarriages occurring around 18 to 20 weeks of EGA and associated with hydrops fetalis and fetal akinesia. v) PMID: 26009232- A family with two miscarriages and three early IUFDs of male fetuses with hemizygous missense variant (p.L345F). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | STAR |
Jasmine Chew changed review comment from: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients: i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro. ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, respectively, of the wild-type, proving the main negative effects of the mutant proteins. Sources: Literature; to: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients: i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro. ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, of the wild-type protein activity, respectively. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | STAR |
Jasmine Chew gene: STAR was added gene: STAR was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: STAR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: STAR were set to 38913505; 36733346 Phenotypes for gene: STAR were set to Lipoid adrenal hyperplasia, MIM# 201710 Review for gene: STAR was set to GREEN Added comment: Literature on variants associated with ovarian failure presented in unrelated classic lipoid adrenal hyperplasia (LAH) patients: i) PMID: 38913505- Homozygous p.W147X, p.Arg182Cys, p.W250X, p.Gln258X, p.Leu260Pro, p.Leu275Pro with low/loss of function when tested in vitro. ii) PMID: 36733346 - Novel compound heterozygous variants (p. Q258*/p. S186R)-p.Q258* generates a truncated protein while S186R disrupts STAR protein function. The residual STAR activities of p.S186R, p.Q258*, and p. S186R/p.Q258* were 13.9%, 7.3%, and 11.2%, respectively, of the wild-type, proving the main negative effects of the mutant proteins. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SYCE1 |
Jasmine Chew changed review comment from: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA) New papers (biallelic variants for POI/NOA): i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal). ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del). iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient. Sources: Literature; to: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA) New papers (biallelic variants for POI/NOA): i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal). ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del). iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient. Sources: Literature Mode of pathogenicity: Provide exceptions to loss-of-function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SYCE1 | Jasmine Chew edited their review of gene: SYCE1: Changed mode of pathogenicity: Other; Changed phenotypes: Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM# 616950 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SYCE1 | Jasmine Chew edited their review of gene: SYCE1: Changed phenotypes: Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM#616950 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SYCE1 |
Jasmine Chew changed review comment from: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA) New papers (biallelic variants for POI/NOA): i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal). ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del). iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient. Sources: Literature; to: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA) New papers (biallelic variants for POI/NOA): i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal). ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del). iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | SYCE1 |
Jasmine Chew gene: SYCE1 was added gene: SYCE1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SYCE1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SYCE1 were set to 25062452; 25899990; 26203179; 36373164; 35718780; 34718620 Phenotypes for gene: SYCE1 were set to Premature ovarian failure 12, MIM# 616947, Spermatogenic failure 15 ,MIM# 616950 Mode of pathogenicity for gene: SYCE1 was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: SYCE1 was set to GREEN Added comment: Literature in OMIM: PMIM: 25062452; 25899990; 26203179- biallelic variants reported for affected individuals with POI/spermatogenic failure (NOA) New papers (biallelic variants for POI/NOA): i) PMID: 36373164- Two POI/DOR patients with biallelic LOF variants (Patient II-1 in Family 3 with compound heterozygous variants c.154C > T (p.Arg52*) and c.675del (p.Asp226Metfs*29); Patient II-1 in Family 6 with a homozygous donor splicing variant c.271 + 1G > A which led to exon 4 skipping and indel mutant p.Ala66_Leu91delinsVal). ii) PMID: 35718780- Two NOA-affected patients with different biallelic CNVs (patient 1- novel heterozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135111754_135427143del) and heterozygous LOF (p.F230fs), patient 2- homozygous intragenic deletion (seq[GRCh37] del(10)(10q26.3)chr10:g.135340247_135379115del). iii) PMID: 34718620- Compound heterozygous variants (p.Glu159Lys and p.Phe230Serfs*21) in a POI patient and a homozygous variant (NM_001143764.3: c.271 + 2T > C) in a NOA patient. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | WT1 |
Jasmine Chew gene: WT1 was added gene: WT1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: WT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WT1 were set to 26358501; 34845858 Phenotypes for gene: WT1 were set to Primary ovarian failure, MONDO:0005387 Review for gene: WT1 was set to GREEN Added comment: New papers reported variants associated with POI: i) PMID: 26358501- Two novel heterozygous missense variants (p. Pro126Ser in exon1 and p. Arg370His in exon7) in two unrelated POI patients, and functional study on these two missense variants showed in impaired transcription of downstream genes, including AMH, FSHR, CYP19 and CDH. ii) PMID: 34845858- A de novo heterozygous nonsense variant p.R463* in a non-syndromic POI woman. Western blot analysis further demonstrated that the WT1 variant could produce a truncated WT1 isoform in vitro. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1952 | KIF7 | Zornitza Stark Marked gene: KIF7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1952 | KIF7 | Zornitza Stark Gene: kif7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1952 | KIF7 | Zornitza Stark Phenotypes for gene: KIF7 were changed from Hydrolethalus syndrome 2, 614120 (3) to Al-Gazali-Bakalinova syndrome MIM#607131; Hydrolethalus syndrome 2 MIM#614120; Acrocallosal syndrome MIM#200990; Joubert syndrome 12 MIM#200990 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1951 | KIF7 | Zornitza Stark Publications for gene: KIF7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1950 | KIAA1109 | Zornitza Stark Marked gene: KIAA1109 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1950 | KIAA1109 | Zornitza Stark Gene: kiaa1109 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1950 | KIAA1109 | Zornitza Stark Phenotypes for gene: KIAA1109 were changed from Alkuraya-Kucinskas syndrome, 617822 (3), Autosomal recessive to Alkuraya-Kucinskas syndrome MIM#617822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1949 | KIAA1109 | Zornitza Stark Publications for gene: KIAA1109 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1948 | KIAA1109 | Zornitza Stark Tag new gene name tag was added to gene: KIAA1109. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1948 | KCNV2 | Zornitza Stark Marked gene: KCNV2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1948 | KCNV2 | Zornitza Stark Gene: kcnv2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1948 | KCNV2 | Zornitza Stark Phenotypes for gene: KCNV2 were changed from Retinal cone dystrophy 3B, 610356 (3) to Retinal cone dystrophy 3B MIM#610356 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1947 | KCNV2 | Zornitza Stark Publications for gene: KCNV2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1946 | ITK | Zornitza Stark Marked gene: ITK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1946 | ITK | Zornitza Stark Gene: itk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1946 | ITK | Zornitza Stark Phenotypes for gene: ITK were changed from Lymphoproliferative syndrome 1, 613011 (3) to Lymphoproliferative syndrome 1 MIM# 613011 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1945 | ITK | Zornitza Stark Publications for gene: ITK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1944 | ITK | Zornitza Stark changed review comment from: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anemia or renal disease, may also occur.; to: Established gene-disease association characterized by onset in early childhood of Epstein-Barr virus (EBV)-associated immune dysregulation, manifest as lymphoma, lymphomatoid granulomatosis, haemophagocytic lymphohistiocytosis, Hodgkin disease, and/or hypogammaglobulinaemia. Autoimmune disorders, such as autoimmune haemolytic anaemia or renal disease, may also occur. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1944 | ITK | Zornitza Stark reviewed gene: ITK: Rating: GREEN; Mode of pathogenicity: None; Publications: 19425169, 22289921, 25061172, 26056787, 9311799, 10213685; Phenotypes: Lymphoproliferative syndrome 1 MIM# 613011; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1944 | INVS | Zornitza Stark Marked gene: INVS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1944 | INVS | Zornitza Stark Gene: invs has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1944 | INVS | Zornitza Stark Phenotypes for gene: INVS were changed from Nephronophthisis 2, infantile, 602088 (3) to Nephronophthisis 2, infantile, (MIM#602088) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1943 | INVS | Zornitza Stark reviewed gene: INVS: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Nephronophthisis 2, infantile, (MIM#602088); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1943 | INPP5K | Zornitza Stark Marked gene: INPP5K as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1943 | INPP5K | Zornitza Stark Gene: inpp5k has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1943 | INPP5K | Zornitza Stark Phenotypes for gene: INPP5K were changed from Muscular dystrophy, congenital, with cataracts and intellectual disability, 617404 (3), Autosomal recessive to Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1942 | INPP5K | Zornitza Stark Publications for gene: INPP5K were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1941 | INPP5K | Zornitza Stark Tag founder tag was added to gene: INPP5K. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1941 | IFT172 | Zornitza Stark Marked gene: IFT172 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1941 | IFT172 | Zornitza Stark Gene: ift172 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1941 | IFT172 | Zornitza Stark Phenotypes for gene: IFT172 were changed from Short-rib thoracic dysplasia 10 with or without polydactyly, 615630 (3) to Bardet-Biedl syndrome 20 MIM#619471; Retinitis pigmentosa 71 MIM#616394; Short-rib thoracic dysplasia 10 with or without polydactyly MIM#615630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1940 | IFT172 | Zornitza Stark Publications for gene: IFT172 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1939 | IDUA | Zornitza Stark Marked gene: IDUA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1939 | IDUA | Zornitza Stark Gene: idua has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1939 | IDUA | Zornitza Stark Phenotypes for gene: IDUA were changed from Mucopolysaccharidosis Ih, 607014 (3) to Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1938 | IDUA | Zornitza Stark reviewed gene: IDUA: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mucopolysaccharidosis Ih/s (Hurler syndrome) 607014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1938 | IBA57 | Zornitza Stark Marked gene: IBA57 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1938 | IBA57 | Zornitza Stark Gene: iba57 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1938 | IBA57 | Zornitza Stark Phenotypes for gene: IBA57 were changed from Multiple mitochondrial dysfunctions syndrome 3, 615330 (3), Autosomal recessive to Multiple mitochondrial dysfunctions syndrome 3 MIM#615330 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1937 | IBA57 | Zornitza Stark Publications for gene: IBA57 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1936 | HYLS1 | Zornitza Stark Marked gene: HYLS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1936 | HYLS1 | Zornitza Stark Gene: hyls1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1936 | HYLS1 | Zornitza Stark Phenotypes for gene: HYLS1 were changed from Hydrolethalus syndrome, 236680 (3) to Hydrolethalus syndrome (MIM#236680) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1935 | HYLS1 | Zornitza Stark Publications for gene: HYLS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1934 | HSPD1 | Zornitza Stark Marked gene: HSPD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1934 | HSPD1 | Zornitza Stark Gene: hspd1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1934 | HSPD1 | Zornitza Stark Phenotypes for gene: HSPD1 were changed from Leukodystrophy, hypomyelinating, 4, 612233 (3) to Leukodystrophy, hypomyelinating, 4 MIM#612233 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1933 | HSPD1 | Zornitza Stark Publications for gene: HSPD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1932 | HSD3B7 | Zornitza Stark edited their review of gene: HSD3B7: Changed publications: 27604308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1932 | HSD3B7 | Zornitza Stark Marked gene: HSD3B7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1932 | HSD3B7 | Zornitza Stark Gene: hsd3b7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1932 | HSD3B7 | Zornitza Stark Publications for gene: HSD3B7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1931 | HSD3B7 | Zornitza Stark Phenotypes for gene: HSD3B7 were changed from Bile acid synthesis defect, congenital, 1, 607765 (3) to Bile acid synthesis defect, congenital, 1 MIM#607765 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1930 | HSD3B7 | Zornitza Stark reviewed gene: HSD3B7: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Bile acid synthesis defect, congenital, 1 MIM#607765; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1930 | HPS3 | Zornitza Stark Marked gene: HPS3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1930 | HPS3 | Zornitza Stark Gene: hps3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1930 | HPS3 | Zornitza Stark Phenotypes for gene: HPS3 were changed from Hermansky-Pudlak syndrome 3, 614072 (3) to Hermansky-Pudlak syndrome 3 MIM#614072 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1929 | HPS3 | Zornitza Stark Publications for gene: HPS3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1928 | HAMP | Zornitza Stark Marked gene: HAMP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1928 | HAMP | Zornitza Stark Gene: hamp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1928 | HAMP | Zornitza Stark Phenotypes for gene: HAMP were changed from Hemochromatosis, type 2B, 613313 (3) to Haemochromatosis, type 2B MIM#613313 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1927 | HAMP | Zornitza Stark Publications for gene: HAMP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1926 | HADH | Zornitza Stark Marked gene: HADH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1926 | HADH | Zornitza Stark Gene: hadh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1926 | HADH | Zornitza Stark Phenotypes for gene: HADH were changed from 3-hydroxyacyl-CoA dehydrogenase deficiency, 231530 (3) to 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1925 | HADH | Zornitza Stark Publications for gene: HADH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1924 | GM2A | Zornitza Stark Marked gene: GM2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1924 | GM2A | Zornitza Stark Gene: gm2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1924 | GM2A | Zornitza Stark Phenotypes for gene: GM2A were changed from GM2-gangliosidosis, AB variant, 272750 (3) to GM2-gangliosidosis, AB variant MIM #272750 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1923 | GM2A | Zornitza Stark Publications for gene: GM2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1922 | GLDN | Zornitza Stark Marked gene: GLDN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1922 | GLDN | Zornitza Stark Gene: gldn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1922 | GLDN | Zornitza Stark Phenotypes for gene: GLDN were changed from Lethal congenital contracture syndrome 11, 617194 (3), Autosomal recessive to Lethal congenital contracture syndrome 11 MIM#617194 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1921 | GLDN | Zornitza Stark Publications for gene: GLDN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1920 | FYCO1 | Zornitza Stark Marked gene: FYCO1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1920 | FYCO1 | Zornitza Stark Gene: fyco1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1920 | FYCO1 | Zornitza Stark Phenotypes for gene: FYCO1 were changed from Cataract 18, autosomal recessive, 610019 (3) to Cataract 18, MIM#610019 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1919 | FYCO1 | Zornitza Stark reviewed gene: FYCO1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Cataract 18, MIM#610019; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1919 | FTSJ1 | Zornitza Stark Marked gene: FTSJ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1919 | FTSJ1 | Zornitza Stark Gene: ftsj1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1919 | FTSJ1 | Zornitza Stark Phenotypes for gene: FTSJ1 were changed from Mental retardation, X-linked 9, 309549 (3) to Intellectual developmental disorder, X-linked 9 MIM#309549 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1918 | FTSJ1 | Zornitza Stark Publications for gene: FTSJ1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1917 | FRAS1 | Zornitza Stark Marked gene: FRAS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1917 | FRAS1 | Zornitza Stark Gene: fras1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1917 | FRAS1 | Zornitza Stark Phenotypes for gene: FRAS1 were changed from Fraser syndrome, 219000 (3) to Fraser syndrome 1 MIM#219000 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1916 | FRAS1 | Zornitza Stark Publications for gene: FRAS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1915 | FLAD1 | Zornitza Stark Marked gene: FLAD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1915 | FLAD1 | Zornitza Stark Gene: flad1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1915 | FLAD1 | Zornitza Stark Phenotypes for gene: FLAD1 were changed from Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency, 255100 (3), Autosomal recessive to Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1914 | FLAD1 | Zornitza Stark Publications for gene: FLAD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1913 | FLAD1 | Zornitza Stark reviewed gene: FLAD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34454814, 34718578, 31392824, 30982706, 30311138, 30427553, 28433476, 27259049, 25058219; Phenotypes: Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1913 | FKBP14 | Zornitza Stark Marked gene: FKBP14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1913 | FKBP14 | Zornitza Stark Gene: fkbp14 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1913 | FKBP14 | Zornitza Stark Phenotypes for gene: FKBP14 were changed from Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss, 614557 (3) to Ehlers-Danlos syndrome, kyphoscoliotic type, 2 MIM#614557 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1912 | FKBP14 | Zornitza Stark Publications for gene: FKBP14 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1911 | FHL1 | Zornitza Stark Marked gene: FHL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1911 | FHL1 | Zornitza Stark Gene: fhl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1911 | FHL1 | Zornitza Stark Phenotypes for gene: FHL1 were changed from Emery-Dreifuss muscular dystrophy 6, X-linked, 300696 (3) to Reducing body myopathy MONDO:0019948; X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1910 | FHL1 | Zornitza Stark Publications for gene: FHL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1909 | FHL1 | Zornitza Stark Mode of inheritance for gene: FHL1 was changed from X-LINKED: hemizygous mutation in males, biallelic mutations in females to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1908 | FGD4 | Zornitza Stark Marked gene: FGD4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1908 | FGD4 | Zornitza Stark Gene: fgd4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1908 | FGD4 | Zornitza Stark Phenotypes for gene: FGD4 were changed from Charcot-Marie-Tooth disease, type 4H, 609311 (3) to Charcot-Marie-Tooth disease, type 4H MIM#609311; Charcot-Marie-Tooth disease MONDO:0015626 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1907 | FGD4 | Zornitza Stark Publications for gene: FGD4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1906 | FANCL | Zornitza Stark Marked gene: FANCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1906 | FANCL | Zornitza Stark Gene: fancl has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1906 | FANCL | Zornitza Stark Phenotypes for gene: FANCL were changed from Fanconi anemia, complementation group L, 614083 (3) to Fanconi anaemia, complementation group L MIM#614083 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1905 | FANCL | Zornitza Stark Publications for gene: FANCL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1904 | FANCD2 | Zornitza Stark Marked gene: FANCD2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1904 | FANCD2 | Zornitza Stark Gene: fancd2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1904 | FANCD2 | Zornitza Stark Phenotypes for gene: FANCD2 were changed from Fanconi anemia, complementation group D2, 227646 (3) to Fanconi anaemia, complementation group D2 MIM#227646 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1903 | FANCD2 | Zornitza Stark Publications for gene: FANCD2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1902 | ERCC4 | Zornitza Stark Marked gene: ERCC4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1902 | ERCC4 | Zornitza Stark Gene: ercc4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1902 | ERCC4 | Zornitza Stark Phenotypes for gene: ERCC4 were changed from Fanconi anemia, complementation group Q, 615272 (3) to Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108; Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215; XFE progeroid syndrome, MIM# 610965 MONDO:0012590 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1901 | ERCC4 | Zornitza Stark reviewed gene: ERCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Fanconi anemia, complementation group Q, MIM# 615272 MONDO:0014108, Xeroderma pigmentosum, group F, MIM# 278760 MONDO:0010215, XFE progeroid syndrome, MIM# 610965 MONDO:0012590; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1901 | DOLK | Zornitza Stark Marked gene: DOLK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1901 | DOLK | Zornitza Stark Gene: dolk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1901 | DOLK | Zornitza Stark Phenotypes for gene: DOLK were changed from Congenital disorder of glycosylation, type Im, 610768 (3) to Congenital disorder of glycosylation, type Im, MIM# 610768 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1900 | DOLK | Zornitza Stark Publications for gene: DOLK were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1899 | DOLK | Zornitza Stark reviewed gene: DOLK: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273964, 22242004, 23890587, 30653653, 28816422, 24144945; Phenotypes: Congenital disorder of glycosylation, type Im, MIM# 610768; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1899 | COL11A2 | Zornitza Stark Marked gene: COL11A2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1899 | COL11A2 | Zornitza Stark Added comment: Comment when marking as ready: Deafness currently out of scope for this panel. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1899 | COL11A2 | Zornitza Stark Gene: col11a2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1899 | COL11A2 | Zornitza Stark Phenotypes for gene: COL11A2 were changed from Fibrochondrogenesis 2, 614524 (3) to Fibrochondrogenesis 2 MIM#614524 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1898 | COL11A2 | Zornitza Stark Publications for gene: COL11A2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1897 | AGK | Zornitza Stark Marked gene: AGK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1897 | AGK | Zornitza Stark Gene: agk has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1897 | AGK | Zornitza Stark Phenotypes for gene: AGK were changed from Sengers syndrome, 212350 (3) to Sengers syndrome, MIM#212350 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1896 | AGK | Zornitza Stark reviewed gene: AGK: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Sengers syndrome, MIM#212350; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2481 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164; Cranioectodermal dysplasia 5, MIM# 621180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2480 | IFT140 | Zornitza Stark Publications for gene: IFT140 were set to 34890546; 22503633; 23418020; 28288023; 28724397; 26216056; 26968735 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | IFT140 | Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 32007091, 35873489, 37628605; Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164, Cranioectodermal dysplasia 5, MIM# 621180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.66 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.65 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant; Cranioectodermal dysplasia 5, MIM# 621180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.64 | IFT140 | Zornitza Stark Publications for gene: IFT140 were set to 22503633; 23418020; 28288023; 28724397; 26216056; 26968735; 34890546 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ciliopathies v1.63 | IFT140 | Zornitza Stark edited their review of gene: IFT140: Added comment: Four unrelated families reported with biallelic variants and a cranioectrodermal dysplasia phenotype, part of the ciliopathy spectrum.; Changed publications: 22503633, 23418020, 28288023, 28724397, 26216056, 26968735, 34890546, 32007091, 35873489, 37628605; Changed phenotypes: Cystic Kidney Disease, MONDO: 0002473, IFT140-associated, dominant, Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, Cranioectodermal dysplasia 5, MIM# 621180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.126 | USP25 | Sangavi Sivagnanasundram reviewed gene: USP25: Rating: AMBER; Mode of pathogenicity: Other; Publications: 38875478; Phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | USP25 |
Sangavi Sivagnanasundram edited their review of gene: USP25: Added comment: This gene-disease association has been DISPUTED by ClinGen Epilepsy GCEP on 01/04/2025 - https://search.clinicalgenome.org/CCID:008786 ClinGen's reason for disuputed classification - "Case-level data was not considered strong enough to score. Functional data was not consistent among the variants and was difficult to interpret in relationship to a seizure phenotype. The knock-out mouse model did not exhibit spontaneous seizures so was not scored." Downgrade to Amber due to the uncertainty was agreed within the user group.; Changed rating: AMBER; Changed phenotypes: USP25-related epilepsy (epilepsy MONDO:0005027) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | FOXM1 |
Achchuthan Shanmugasundram gene: FOXM1 was added gene: FOXM1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: FOXM1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: FOXM1 were set to 38969938 Phenotypes for gene: FOXM1 were set to Moyamoya disease, MONDO:0016820 Review for gene: FOXM1 was set to AMBER Added comment: PMID:38969938 reported a 60-year-old father and 31-year-old daughter with unilateral Moyamoya Disease and with c.1205 C > A variant in FOXM1 gene (p.(Ala402Glu). There is also functional evidence available for the identified variant from the publication. This gene should be rated amber with current evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1896 | SLC37A4 | Lilian Rudd Marked gene: SLC37A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1896 | SLC37A4 | Lilian Rudd Gene: slc37a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1896 | SLC37A4 | Lilian Rudd Phenotypes for gene: SLC37A4 were changed from Glycogen storage disease Ib, 232220 (3) to Glycogen storage disease Ib MIM#232220; Glycogen storage disease Ic MIM#232240; Glycogen Storage Disease I MONDO:0002413 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1895 | SP110 | Lilian Rudd Marked gene: SP110 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1895 | SP110 | Lilian Rudd Gene: sp110 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1895 | SP110 | Lilian Rudd Publications for gene: SP110 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1894 | SPR | Lilian Rudd Marked gene: SPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1894 | SPR | Lilian Rudd Gene: spr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1894 | SPR | Lilian Rudd Phenotypes for gene: SPR were changed from Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, 612716 (3) to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1893 | SPR | Lilian Rudd Publications for gene: SPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1892 | STRA6 | Lilian Rudd Marked gene: STRA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1892 | STRA6 | Lilian Rudd Gene: stra6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1892 | STRA6 | Lilian Rudd Phenotypes for gene: STRA6 were changed from Microphthalmia MIM#601186 to Microphthalmia, isolated, with coloboma 8 MIM#601186; Microphthalmia, syndromic 9 MIM#601186 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1891 | STRA6 | Lilian Rudd Phenotypes for gene: STRA6 were changed from Microphthalmia, isolated, with coloboma 8, 601186 (3) to Microphthalmia MIM#601186 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | B3GALT6 | Sangavi Sivagnanasundram reviewed gene: B3GALT6: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008674; Phenotypes: B3GALT6-congenital disorder of glycosylation MONDO:0100586; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1890 | STRA6 | Lilian Rudd Publications for gene: STRA6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1889 | TRIM32 | Lilian Rudd Marked gene: TRIM32 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1889 | TRIM32 | Lilian Rudd Gene: trim32 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1889 | TRIM32 | Lilian Rudd Phenotypes for gene: TRIM32 were changed from Muscular dystrophy, limb-girdle, type 2H, 254110 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1888 | TRIM32 | Lilian Rudd Publications for gene: TRIM32 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1887 | TRPM6 | Lilian Rudd Marked gene: TRPM6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1887 | TRPM6 | Lilian Rudd Gene: trpm6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1887 | TRPM6 | Lilian Rudd Publications for gene: TRPM6 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1886 | TTI2 | Lilian Rudd Marked gene: TTI2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1886 | TTI2 | Lilian Rudd Gene: tti2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1886 | TTI2 | Lilian Rudd Phenotypes for gene: TTI2 were changed from Mental retardation, autosomal recessive 39, 615541 (3) to Intellectual developmental disorder, autosomal recessive 39 MIM#615541 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | PIK3R5 | Sangavi Sivagnanasundram reviewed gene: PIK3R5: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008779; Phenotypes: ataxia with oculomotor apraxia type 3 MONDO:0014084; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1885 | TTI2 | Lilian Rudd Publications for gene: TTI2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1884 | TTPA | Lilian Rudd Marked gene: TTPA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1884 | TTPA | Lilian Rudd Gene: ttpa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1884 | TTPA | Lilian Rudd Publications for gene: TTPA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1883 | VARS | Lilian Rudd Marked gene: VARS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1883 | VARS | Lilian Rudd Gene: vars has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1883 | VARS | Lilian Rudd Phenotypes for gene: VARS were changed from Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy, 617802 (3), Autosomal recessive to Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1882 | VARS | Lilian Rudd Publications for gene: VARS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | PCNA |
Sangavi Sivagnanasundram gene: PCNA was added gene: PCNA was added to Mendeliome. Sources: ClinGen Mode of inheritance for gene: PCNA was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PCNA were set to 24911150, 33426167, 36990216 Phenotypes for gene: PCNA were set to hereditary ataxia MONDO:0100309 Review for gene: PCNA was set to AMBER Added comment: Classified as Limited by Cerebellar Ataxia GCEP on 09/04/2025 - https://search.clinicalgenome.org/CCID:008778 Two missense variants have been reported across 5 families. Both the missense variants are present in gnomAD (rare enough for AR gene). Method of pathogenicity is still unknown. Affected individuals reported with ataxia, photosensitivity, telangiectasias, and some degree of intellectual disability. Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1881 | WNT10B | Lilian Rudd Marked gene: WNT10B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1881 | WNT10B | Lilian Rudd Gene: wnt10b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1881 | WNT10B | Lilian Rudd Publications for gene: WNT10B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1880 | CSPP1 | Lilian Rudd Marked gene: CSPP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1880 | CSPP1 | Lilian Rudd Gene: cspp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1880 | CSPP1 | Lilian Rudd Phenotypes for gene: CSPP1 were changed from Joubert syndrome 21, 615636 (3) to Joubert syndrome 21 MIM#615636; MONDO:0014288 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1879 | CSPP1 | Lilian Rudd Publications for gene: CSPP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1878 | DNAH5 | Lilian Rudd Marked gene: DNAH5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1878 | DNAH5 | Lilian Rudd Gene: dnah5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1878 | DNAH5 | Lilian Rudd Publications for gene: DNAH5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1877 | PEX5 | Lilian Rudd Marked gene: PEX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1877 | PEX5 | Lilian Rudd Gene: pex5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1877 | PEX5 | Lilian Rudd Phenotypes for gene: PEX5 were changed from Peroxisome biogenesis disorder 2A (Zellweger), 214110 to Peroxisome Biogenesis Disorder, MONDO:0019234 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1876 | PEX5 | Lilian Rudd Publications for gene: PEX5 were set to 21031596; 7719337; 26220973; 20301621 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1875 | PEX5 | Lilian Rudd Publications for gene: PEX5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1874 | PIGN | Lilian Rudd Marked gene: PIGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1874 | PIGN | Lilian Rudd Gene: pign has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1874 | PIGN | Lilian Rudd Publications for gene: PIGN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1873 | PLAA | Lilian Rudd Marked gene: PLAA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1873 | PLAA | Lilian Rudd Gene: plaa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1873 | PLAA | Lilian Rudd Phenotypes for gene: PLAA were changed from Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, 617527 (3), Autosomal recessive to Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1872 | PLAA | Lilian Rudd Publications for gene: PLAA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1871 | PLCE1 | Lilian Rudd Marked gene: PLCE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1871 | PLCE1 | Lilian Rudd Gene: plce1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1871 | PLCE1 | Lilian Rudd Publications for gene: PLCE1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1870 | POLR3B | Lilian Rudd Marked gene: POLR3B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1870 | POLR3B | Lilian Rudd Gene: polr3b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1870 | POLR3B | Lilian Rudd Mode of pathogenicity for gene: POLR3B was changed from to None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1869 | POLR3B | Lilian Rudd Publications for gene: POLR3B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | ANKZF1 | Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: GREEN; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.124 | ANKZF1 | Sangavi Sivagnanasundram reviewed gene: ANKZF1: Rating: ; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008790; Phenotypes: inflammatory bowel disease MONDO:0005265; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Monogenic Diabetes v0.137 | SIRT1 |
Sangavi Sivagnanasundram gene: SIRT1 was added gene: SIRT1 was added to Monogenic Diabetes. Sources: ClinGen Mode of inheritance for gene: SIRT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SIRT1 were set to https://search.clinicalgenome.org/CCID:008794 Phenotypes for gene: SIRT1 were set to monogenic diabetes MONDO:0015967 Review for gene: SIRT1 was set to RED Added comment: Classified as LIMITED by Monogenic Diabetes GCEP on 18/04/2025 - https://search.clinicalgenome.org/CCID:008794 Sources: ClinGen |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | SIRT1 | Sangavi Sivagnanasundram reviewed gene: SIRT1: Rating: RED; Mode of pathogenicity: None; Publications: https://search.clinicalgenome.org/CCID:008794; Phenotypes: monogenic diabetes MONDO:0015967; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: ICoNS v0.0 | Zornitza Stark Added Panel Genomic newborn screening: ICoNS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic newborn screening: BabyScreen+ v1.117 | Zornitza Stark Panel name changed from BabyScreen+ newborn screening to Genomic newborn screening: BabyScreen+ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2479 | FGFR3 | Bryony Thompson Mode of inheritance for gene: FGFR3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2478 | FGFR1 | Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290; 16470795; 15625620; 29147600; 20339250 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2477 | FGFR1 | Bryony Thompson Publications for gene: FGFR1 were set to 18034870; 23812909; 26942290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | PANX1 |
Jasmine Chew gene: PANX1 was added gene: PANX1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PANX1 was set to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Publications for gene: PANX1 were set to 30918116; 39232764; 35834089; 36469255; 33495594 Phenotypes for gene: PANX1 were set to Oocyte/zygote/embryo maturation arrest 7, MIM# 618550 Review for gene: PANX1 was set to GREEN Added comment: Literature in OMIM- PMID: 30918116: 4 different monoallelic variants in 4 unrelated Chinese families with 8 women who were infertile due to oocyte death. Functional analysis demonstrated that the mutations alter the PANX1 glycosylation pattern, influence subcellular localization, and increase channel activity and ATP release. New papers- i) PMID: 39232764;35834089;36469255- 3 novel monoallelic variants (p.Ser137Leu,p. Arg29Gln, p.Asn326del) causing human oocyte death and female infertility. Western blot analysis confirmed that Arg29Gln and p.Asn326del changed the glycosylation pattern in HeLa cells. ii) PMID: 33495594- two novel homozygous missense variants associated with the oocyte death phenotype in two families. Both of the homozygous variants altered the PANX1 glycosylation pattern in cultured cells, led to aberrant PANX1 channel activation, and resulted in mouse oocyte death after fertilization in vitro. It is worth noting that the destructive effect of the two homozygous variants on PANX1 function was weaker than that caused by the recently reported heterozygous variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TRIP13 |
Jasmine Chew gene: TRIP13 was added gene: TRIP13 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TRIP13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TRIP13 were set to 32473092; 28553959; 35812326 Phenotypes for gene: TRIP13 were set to Oocyte/zygote/embryo maturation arrest 9, #MIM 619011; Mosaic variegated aneuploidy syndrome 3, #MIM 617598 Review for gene: TRIP13 was set to GREEN Added comment: Literature in OMIM- PMID: 32473092;28553959- different biallelic variants in >3 unrelated affected individuals New papers: i) PMID: 35812326- Two women with zygotic cleavage failure (ZCF) carrying homozygous p. Glu381Lys and compound heterozygous p. Lys420Glu and p. His26Arg. All three variants resulted in obvious changes in hydrogen bonding and consistent increase in DNA damage. Additionally, transcriptomic sequencing of oocytes and arrested embryos containing these variants suggested a greater number of differentially expressed transcripts in germinal vesicle (GV) oocytes than in 1-cell embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | FBXO43 |
Jasmine Chew gene: FBXO43 was added gene: FBXO43 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FBXO43 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FBXO43 were set to 34052850; 30878252; 34595750 Phenotypes for gene: FBXO43 were set to Oocyte/zygote/embryo maturation arrest 12, MIM# 619697; Spermatogenic failure 64, MIM# 619696 Review for gene: FBXO43 was set to GREEN Added comment: Literature in OMIM: PMID: 34052850 (three different homozygous variants in 3 unrelated women; 30878252, 34595750 (two different families with different homozygous variants) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | FGA |
Jasmine Chew gene: FGA was added gene: FGA was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FGA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FGA were set to 29016666; 34925444 Phenotypes for gene: FGA were set to Recurrent pregnancy loss Review for gene: FGA was set to GREEN Added comment: i) PMID: 29016666- A heterozygous missense p.Phe685Cys called pathogenic in a female with RPL (3 miscarriages, all embryonic loss) and fragment molecular orbital analysis showed that the p.F685C variant led to changes in total interaction energy, thus leading to protein instability ii) PMID: 34925444: Two heterozygous FGA variants were identified in two women, each with three consecutive miscarriages- one variant (NM_000508.5: c.1906_1908del; p.636del) leading to the deletion of an amino acid was not found in public databases. The other variant in FGA (p.A762V) causing an amino acid substitution was extremely rare in East Asian populations in the gnomAD database and was predicted to be deleterious by in silico prediction tools. - " Mutations of FGA have been linked to coagulation pathologies including afibrinogenemia (OMIM:202400) and dysfibrinogenemia/hypodysfibrinogenemia (OMIM:616004), which can result in miscarriage (PMID: 31368232). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | KHDC3L |
Jasmine Chew changed review comment from: Biallelic variants have been reported for several unrelated families with recurrent complete hydatidiform mole (CHM) pregnancy- predominantly biparental and RPL- PMID: 21885028, 19246479, 23232697. New evidence- i) PMID 31847873: homozygous LOF variant in a woman with multiple consanguineous marriages in her extended family and history of 2 biparental complete hydatidiform mole (BiCHM) and methylation study on her oocytes revealed a genome-wide deficit of DNA methylation compared with normal human oocytes. ii) PMID: 31609975- two deletions of KHDC3L (p.E150_V160del and p.E150_V172del) in female RPL patients, both of which harbor a common loss of Thr156 and are impaired in PARP1 activation and homologous recombination (HR) repair. Also provided functional evidence that KHDC3L dysfunction causes PARP1 inhibition and HR-mediated DNA repair deficiency, which is synthetically lethal. iii) PMID: 29606347- a novel homozygous frameshift p.Q15Rfs*25 variant in a female patient (II-1) from family 4 with a history of 2 spontaneous abortions and x2 partial hydatidiform moles, and her embryos formed after ICSI are fertilized normally but arrest at the morula stage. Sources: Literature; to: Biallelic variants have been reported for several unrelated families with recurrent complete hydatidiform mole (CHM) pregnancy- predominantly biparental and RPL- PMID: 21885028, 19246479, 23232697. New evidence (biallelic variants and CHM pregnancy)- i) PMID 31847873: homozygous LOF variant in a woman with multiple consanguineous marriages in her extended family and history of 2 biparental complete hydatidiform mole (BiCHM) and methylation study on her oocytes revealed a genome-wide deficit of DNA methylation compared with normal human oocytes. ii) PMID: 31609975- two deletions of KHDC3L (p.E150_V160del and p.E150_V172del) in female RPL patients, both of which harbor a common loss of Thr156 and are impaired in PARP1 activation and homologous recombination (HR) repair. Also provided functional evidence that KHDC3L dysfunction causes PARP1 inhibition and HR-mediated DNA repair deficiency, which is synthetically lethal. iii) PMID: 29606347- a novel homozygous frameshift p.Q15Rfs*25 variant in a female patient (II-1) from family 4 with a history of 2 spontaneous abortions and x2 partial hydatidiform moles, and her embryos formed after ICSI are fertilized normally but arrest at the morula stage. New evidence (monoallelic variants and RPL)- i) PMID: 34925444- a heterozygous in frame deletion in KHDC3L (p.146_156del) in a 31-year-old woman with a history of two miscarriages. ii) PMID: 31609975- heterozygous deletions (p.150_160del and p.150_172del) were found in patients experiencing RPL without forming an hydatidiform mole. Note: All of the deletions in patients with RPL affected the Thr156 residue, a critical phosphorylation site for normal KHDC3L protein function. Loss of Thr156 results in impaired PARP1 activation and HR repair. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | KHDC3L | Jasmine Chew edited their review of gene: KHDC3L: Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2476 | FGF8 | Bryony Thompson Publications for gene: FGF8 were set to 34433009; 32664970; 7768185; 32664970; 10603341; 19509466; 9462741; 10603341; 12223415 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2475 | FGF8 | Bryony Thompson Publications for gene: FGF8 were set to 34433009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2474 | FGA | Bryony Thompson Publications for gene: FGA were set to 31064749; 17295221; 19073821; 11739173 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2473 | FGA | Bryony Thompson Mode of inheritance for gene: FGA was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.55 | FGA | Bryony Thompson Mode of inheritance for gene: FGA was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.54 | FGB | Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396; 24560896 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.54 | FGB | Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.53 | FGB | Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | FGB | Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2472 | FGB | Bryony Thompson Publications for gene: FGB were set to 12393540; 16195396 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2471 | FGB | Bryony Thompson Mode of inheritance for gene: FGB was changed from BIALLELIC, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2470 | FGB | Bryony Thompson reviewed gene: FGB: Rating: GREEN; Mode of pathogenicity: None; Publications: 24560896; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2470 | FGA | Bryony Thompson reviewed gene: FGA: Rating: GREEN; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | FGA | Bryony Thompson edited their review of gene: FGA: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | FGA | Bryony Thompson reviewed gene: FGA: Rating: ; Mode of pathogenicity: None; Publications: 10602365, 11460510; Phenotypes: Congenital fibrinogen deficiency MONDO:0018060; Mode of inheritance: BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2470 | FAR1 | Bryony Thompson reviewed gene: FAR1: Rating: GREEN; Mode of pathogenicity: None; Publications: 33586168, 25439727; Phenotypes: Fatty acyl-CoA reductase 1 deficiency MONDO:0014510; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2470 | FANCM | Bryony Thompson edited their review of gene: FANCM: Added comment: Now 4 families with biallelic variants reported with spermatogenic failure; Changed publications: 29231814, 28837162, 33036707, 25010009, 38927643, 35413094, 30075111, 29895858; Changed phenotypes: Premature ovarian failure 15 MIM#618096, spermatogenic failure 28 MONDO:0054732; Set current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2470 | FANCI | Bryony Thompson Publications for gene: FANCI were set to 17452773 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | F9 | Bryony Thompson changed review comment from: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants, however 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for the thrombophilia.; to: Classified as LIMITED by the Hemostasis Thrombosis GCEP in 2023 with 2 families reported with missense variants; however, 3 additional families/cases have been reported with increased factor 9 activity and large duplications involving F9. Gain of function is the mechanism of disease for thrombophilia. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2469 | F9 | Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: Other; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2469 | F9 | Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538; 3001143; 9016521; 19815722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | F9 | Bryony Thompson edited their review of gene: F9: Changed mode of pathogenicity: Other | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Bleeding and Platelet Disorders v1.52 | F9 | Bryony Thompson reviewed gene: F9: Rating: GREEN; Mode of pathogenicity: None; Publications: 19846852, 32079698, 38886735, 38358900, 37414287, 33656538; Phenotypes: thrombophilia, X-linked, due to factor 9 defect MONDO:0010432; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2468 | F9 | Bryony Thompson Publications for gene: F9 were set to 19846852; 34015304; 33656538 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2467 | F5 | Bryony Thompson Publications for gene: F5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2466 | F2 | Bryony Thompson Classified gene: F2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2466 | F2 | Bryony Thompson Added comment: Comment on list classification: Gain of function is the mechanism of disease for dominant thrombophilia, and biallelic loss of function is the mechanism for congenital prothrombin deficiency. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2466 | F2 | Bryony Thompson Gene: f2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2465 | F2 |
Bryony Thompson Tag 5'UTR was removed from gene: F2. Tag UTR tag was added to gene: F2. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2465 | F2 | Bryony Thompson Publications for gene: F2 were set to 30297698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ZFP36L2 |
Jasmine Chew gene: ZFP36L2 was added gene: ZFP36L2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ZFP36L2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZFP36L2 were set to 34611029; 38829516; 37211617 Phenotypes for gene: ZFP36L2 were set to Oocyte/zygote/embryo maturation arrest 13, MIM# 620154 Review for gene: ZFP36L2 was set to GREEN Added comment: i) Literature in OMIM- PMID:34611029- x2 unrelated infertile Chinese women with defective oocyte maturation carrying different biallelic variants and functional analysis suggested that the variants cause maternal mRNA decay defects that result in female infertility. ii) New papers reporting biallelic variants in conjunction with female infertility due to oocyte maturation defect+/- embryonic development arrest - PMID: 38829516: Novel compound heterozygous variant (p.His62Gln and p.Pro290Leu) in a patient with oocyte maturation defect. These variants lead to compromised binding capacity of the ZFP36L2-CONT6L complex and impaired mRNA degradation in HeLa cells and mouse oocytes. - PMID: 37211617: Novel homozygous variant c.853_861del (p.285_287del) in the affected individual with oocyte maturation defect from a consanguineous family. In vitro studies showed that the variant caused decreased protein levels of ZFP36L2 in oocytes due to mRNA instability and might lead to the loss of its function to degrade maternal mRNAs Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | REC114 |
Jasmine Chew gene: REC114 was added gene: REC114 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: REC114 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: REC114 were set to 31704776; 30388401; 38148155 Phenotypes for gene: REC114 were set to Oocyte/zygote/embryo maturation arrest 10, #MIM 619176 Review for gene: REC114 was set to GREEN Added comment: i) Literature in OMIM (PMID: 31704776;30388401)- x3 unrelated females with different biallelic variants presented with infertility due to oocyte maturation defects/multiple pronuclei zygotes, early embryonic arrest, and failed implantation of surviving embryos/miscarriages/recurrent hydatidiform moles. ii) New paper on male infertility: - PMID: 38148155- First report that identifies REC114 as the causative gene for male infertility- homozygous p.Gln190* variant in a Chinese NOA patient. Co-immunoprecipitation (Co-IP) and Western blot (WB) revealed that the variant resulted in truncated REC114 protein and impaired interaction with MEI4, which was essential for meiotic DNA double-strand break (DSB) formation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | WEE2 |
Jasmine Chew gene: WEE2 was added gene: WEE2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: WEE2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: WEE2 were set to 29606300; 30628060; 39476306; 37772619; 36568932; 34476630 Phenotypes for gene: WEE2 were set to Oocyte/zygote/embryo maturation arrest 5, MIM# 617996 Review for gene: WEE2 was set to GREEN Added comment: i) Literature in OMIM- PMID: 29606300;30628060- >3 unrelated infertile women (e.g., oocyte maturation defect, recurrent fertilization failure) with different biallelic variants ii) Many other new papers reporting biallelic variants in conjunction with oocyte degradation +/- unexplained fertilization failure - PMID: 39476306;37772619;36568932;34476630 iii) definitive evidence for OZEMA in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TLE6 |
Jasmine Chew changed review comment from: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y. ). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC. ii) New papers: - PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure. - PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells. - PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014) iii) Classified as definitive for OZEMA in FeRGI database Sources: Literature; to: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC. ii) New papers: - PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure. - PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells. - PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014). iii) Classified as definitive for OZEMA in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | TLE6 |
Jasmine Chew gene: TLE6 was added gene: TLE6 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TLE6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TLE6 were set to 26537248; 31897846; 40225929; 32172300 Phenotypes for gene: TLE6 were set to Oocyte/zygote/embryo maturation arrest 15, #MIM 616814 Review for gene: TLE6 was set to GREEN Added comment: i) Literature in OMIM (PMID:26537248)- 3 women from 2 consanguineous Saudi families with primary infertility due to preimplantation embryonic lethality carrying homozygous missense variant, S510Y. ). Functional analysis demonstrated that the variant abrogates TLE6 phosphorylation by PKA and also impairs TLE6 binding to components of the SCMC. ii) New papers: - PMID: 31897846- novel biallelic variants (2 homozygous, 1 compound heterozygous) in 3 patients with recurrent IVF/ICSI failure. - PMID: 40225929- novel compound heterozygous (c.541+2dupT in intron 7 and c.1075G>A) in a female with embryonic developmental arrest (EDA). The splice variant resulted in aberrant RNA splicing, leading to abnormal truncations of the corresponding proteins. In vitro experiments further validated that the missense variant in NLRP5 led to increased mRNA and protein expression levels compared to wild type, when transfected into HEK293T cells. - PMID: 32172300- A homozygous truncating variant p.(Lys146Glufs*51) in a patient with recurrent pregnancy loss, and demonstrates that oocytes depleted for TLE6 have the capacity to undergo several postfertilization divisions prior to arrest, consistent with what was observed in Tle6-/- mice (Yu et al. 2014) iii) Classified as definitive for OZEMA in FeRGI database Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | PABPC1L |
Jasmine Chew gene: PABPC1L was added gene: PABPC1L was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PABPC1L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PABPC1L were set to 37052235; 37723834; 38177974; 32172300 Phenotypes for gene: PABPC1L were set to Oocyte/zygote/embryo maturation arrest 22, #MIM 621093 Review for gene: PABPC1L was set to GREEN Added comment: i) Literature in OMIM (PMID: 37052235;37723834;38177974)- >3 unrelated infertile women (due to a mixed phenotype including oocyte maturation abnormalities, fertilization failure, and embryonic development arrest) with different biallelic variants ii) Additional paper (PMID: 32172300)- Homozygous likely deleterious variant in PABPC1L p.(Met26Lys) in a woman whose infertility phenotype resembles that of Pabpc1l−/− mouse. During her IVF cycles, 18 oocytes were retrieved and subjected to IVF and ICSI. Nine oocytes were assigned to ICSI, but eight were at germinal vesicle stage and only one showed polar body and failed to fertilize following ICSI. Similarly, nine oocytes were assigned to IVF, and only two showed polar body on the next day without any sign of fertilization. The remaining oocytes were at germinal vesicle stage. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | NLRP7 |
Jasmine Chew gene: NLRP7 was added gene: NLRP7 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: NLRP7 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: NLRP7 were set to 17579354; 19650864; 25097207; 23201303; 23722513; 32172300; 37148315 Phenotypes for gene: NLRP7 were set to Recurrent hydatidiform mole 1, # MIM 231090 Review for gene: NLRP7 was set to GREEN Added comment: i) The association between diploid biparental hydatidiform mole (HM), miscarriages, and infertility has been observed in many patients with biallelic functional variants in NLRP7 and some of their HM were diagnosed by morphology as non-molar miscarriages, partial HM (because of their mild trophoblastic proliferation), non-classical HM [PMID: 23201303], or not easy to classify HM [PMID: 23722513]. ii) classified as strong evidence for HM on the FeRGI database iii) New paper- PMID: 32172300- homozygous truncating variant p.(Lys619Asnfs*18) in an individual with recurrent molar pregnancy and no pregnancy observed following three intra-uterine insemination attempts. iv) New phenotype (AD): - PMID: 37148315- five heterozygous variants (c.251G > A, c.1258G > A, c.1441G > A, c. 2227G > A, c.2323C > T) of NLRP7 were identified in five infertile patients who experienced early embryo arrest. Injecting complementary RNAs in mouse oocytes and early embryos showed that NLRP7 variants influenced the oocyte quality and some of the variants significantly affected early embryo development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | DNAH11 |
Jasmine Chew gene: DNAH11 was added gene: DNAH11 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAH11 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH11 were set to 39256880; 32172300 Phenotypes for gene: DNAH11 were set to Ciliary dyskinesia, primary, 7, with or without situs inversus, # MIM 611884 Added comment: i) PMID: 39256880- Four unrelated asthenoteratozoospermia Chinese males with biallelic deleterious variants in the DNAH11 gene, and 7 of those variants are novel. These variants led the absence of DNAH11 proteins and ultrastructure defects in sperm flagella, particularly affecting the outer dynein arms (ODAs) and adjacent structures. The levels of ODA protein DNAI2 and axoneme related proteins were down regulated. ii) PMID: 32172300- One infertile woman with a homozygous truncating variant, p.(Arg3229Trp), presented with primary infertility only. She had three cycles of IVF and had one clinical pregnancy that, unfortunately, ended in a spontaneous loss during first trimester. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.83 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Cystic Kidney Disease, MONDO# 0002473 to {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.82 | IFT140 | Zornitza Stark reviewed gene: IFT140: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: {Polycystic kidney disease 9, susceptibility to} MIM#621164; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.27 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Cystic Kidney Disease, MONDO# 0002473, IFT140-related, dominant to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Ciliopathies and Nephronophthisis v1.26 | IFT140 | Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, MONDO:0009964, {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2464 | IFT140 | Zornitza Stark Phenotypes for gene: IFT140 were changed from Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; MONDO:0009964; Retinitis pigmentosa 80, MIM# 617781; Cystic Kidney Disease, MONDO: 0002473 to Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920; Retinitis pigmentosa 80, MIM# 617781; {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2463 | IFT140 | Zornitza Stark edited their review of gene: IFT140: Changed phenotypes: Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920, Retinitis pigmentosa 80, MIM# 617781, {Polycystic kidney disease 9, susceptibility to} MIM#621164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | POLR3B | Karina Sandoval reviewed gene: POLR3B: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 27512013, 23355746, 22036171, 22036172, 25339210, 33005949, 22855961, 33417887; Phenotypes: Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism,MIM#614381; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PLCE1 | Karina Sandoval reviewed gene: PLCE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17086182, 18065803, 20591883; Phenotypes: Nephrotic syndrome, type 3,MIM#610725; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PLAA | Karina Sandoval reviewed gene: PLAA: Rating: GREEN; Mode of pathogenicity: None; Publications: 28007986, 28413018, 31322726; Phenotypes: Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies,MIM#617527; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PIGN | Karina Sandoval reviewed gene: PIGN: Rating: GREEN; Mode of pathogenicity: None; Publications: 21493957, 24253414, 26364997, 26394714, 33193741, 32585529, 33528536, 38693247, 36322149; Phenotypes: Multiple congenital anomalies-hypotonia-seizures syndrome 1,MIM#614080; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PEX5 | Karina Sandoval reviewed gene: PEX5: Rating: GREEN; Mode of pathogenicity: None; Publications: 21031596, 7719337, 26220973, 20301621; Phenotypes: Peroxisome Biogenesis Disorder, MONDO:0019234; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2463 | EYA4 | Bryony Thompson reviewed gene: EYA4: Rating: AMBER; Mode of pathogenicity: None; Publications: 10769282, 30155266, 33745059; Phenotypes: dilated cardiomyopathy 1J MONDO:0011541; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | DNAH5 | Andrew Coventry reviewed gene: DNAH5: Rating: GREEN; Mode of pathogenicity: None; Publications: 16627867, 11788826, 40033371; Phenotypes: Ciliary dyskinesia, primary, 3, with or without situs inversus MIM#608644; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | CSPP1 | Andrew Coventry reviewed gene: CSPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24360808, 24360803, 24360807, 25997910; Phenotypes: Joubert syndrome 21 MIM#615636, MONDO:0014288; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | WNT10B | Andrew Coventry reviewed gene: WNT10B: Rating: GREEN; Mode of pathogenicity: None; Publications: 20635353, 16688749, 29427788, 24211389, 38058757, 39310870; Phenotypes: Split-hand/foot malformation 6 MIM#225300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | VARS | Andrew Coventry reviewed gene: VARS: Rating: GREEN; Mode of pathogenicity: None; Publications: 30755616, 30755602, 26539891, 29691655, 30275004, 30755616; Phenotypes: Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy MIM#617802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TTPA | Andrew Coventry reviewed gene: TTPA: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 7719340; Phenotypes: Ataxia with isolated vitamin E deficiency MIM#277460; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TTI2 | Andrew Coventry reviewed gene: TTI2: Rating: GREEN; Mode of pathogenicity: None; Publications: 32061250, 23956177, 31737043; Phenotypes: Intellectual developmental disorder, autosomal recessive 39 MIM#615541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TRPM6 | Andrew Coventry reviewed gene: TRPM6: Rating: GREEN; Mode of pathogenicity: None; Publications: 35903165, 18818955; Phenotypes: Hypomagnesemia 1, intestinal MIM#602014; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TRIM32 | Andrew Coventry reviewed gene: TRIM32: Rating: GREEN; Mode of pathogenicity: None; Publications: 9634523, 10399877, 17994549, 25351777, 19492423, 19303295, 31309175; Phenotypes: Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2463 | ERLIN2 | Bryony Thompson Mode of inheritance for gene: ERLIN2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | STRA6 | Andrew Coventry reviewed gene: STRA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 17273977, 17503335, 19213032, 26373900, 30880327, 26373900, 25457163; Phenotypes: Microphthalmia, isolated, with coloboma 8 MIM#601186, Microphthalmia, syndromic 9 MIM#601186; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.29 | ERLIN2 | Bryony Thompson Marked gene: ERLIN2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.29 | ERLIN2 | Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SPR | Andrew Coventry reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522443, 26131547, 33903016, 31777525, 16650784, 21431957, 28189489; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency MIM#612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.29 | ERLIN2 | Bryony Thompson Classified gene: ERLIN2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.29 | ERLIN2 | Bryony Thompson Gene: erlin2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v1.28 | ERLIN2 |
Bryony Thompson gene: ERLIN2 was added gene: ERLIN2 was added to Motor Neurone Disease. Sources: Literature Mode of inheritance for gene: ERLIN2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ERLIN2 were set to 38607533; 38427163; 34734492; 32042907 Phenotypes for gene: ERLIN2 were set to hereditary spastic paraplegia 18 MONDO:0012639 Review for gene: ERLIN2 was set to GREEN gene: ERLIN2 was marked as current diagnostic Added comment: HSP phenoconversion to ALS has been reported in AD and AR families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SP110 | Andrew Coventry reviewed gene: SP110: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301448, 16648851, 23448538, 22621957, 32395362; Phenotypes: Hepatic venoocclusive disease with immunodeficiency MIM#235550; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SLC37A4 | Andrew Coventry reviewed gene: SLC37A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 33964207, 9675154, 9758626; Phenotypes: Glycogen storage disease Ib MIM#232220, Glycogen storage disease Ic MIM#232240, Glycogen Storage Disease I MONDO:0002413; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2462 | ERLIN2 | Bryony Thompson edited their review of gene: ERLIN2: Added comment: AR and AD variants appear to have a different mechanism of disease. AR is presumably loss of function. The mechanism of disease for AD HSP is expected to be dominant negative but has not been confirmed; Changed mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SLC12A5 | Andrew Coventry reviewed gene: SLC12A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 26333769, 27436767, 24928908, 30763027, 24668262; Phenotypes: Developmental and epileptic encephalopathy 34 MIM#616645; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SEC23B | Andrew Coventry reviewed gene: SEC23B: Rating: GREEN; Mode of pathogenicity: None; Publications: 19561605, 19621418, 26522472, 27471141, 37373084; Phenotypes: Dyserythropoietic anemia, congenital, type II MIM#224100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | RNASET2 | Andrew Coventry reviewed gene: RNASET2: Rating: GREEN; Mode of pathogenicity: None; Publications: 31349848, 19525954, 27091087, 29336640, 18545798, 15851732; Phenotypes: Leukoencephalopathy, cystic, without megalencephaly MIM#612951; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | RNASEH2A | Andrew Coventry reviewed gene: RNASEH2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 15870678, 25604658, 23592335, 20301648, 29239743, 16845400, 24183309, 35551623; Phenotypes: Aicardi-Goutieres syndrome 4 MIM#610333, RNASEH2A-related type 1 interferonopathy MONDO:0700259; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | RARB | Andrew Coventry reviewed gene: RARB: Rating: AMBER; Mode of pathogenicity: None; Publications: 30880327, 30281527, 24075189, 27120018, 25457163, 17506106; Phenotypes: Microphthalmia, syndromic 12 MIM#615524; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | RAB23 | Andrew Coventry reviewed gene: RAB23: Rating: GREEN; Mode of pathogenicity: None; Publications: 17503333, 21412941, 23599695, 25168863; Phenotypes: Carpenter syndrome MIM#201000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PUS7 | Andrew Coventry reviewed gene: PUS7: Rating: GREEN; Mode of pathogenicity: None; Publications: 30526862, 30778726, 31583274, 35144859; Phenotypes: Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature MIM#618342; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PPIB | Andrew Coventry reviewed gene: PPIB: Rating: GREEN; Mode of pathogenicity: None; Publications: 19781681, 32392875; Phenotypes: Osteogenesis imperfecta, type IX MIM#259440; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2462 | SIRT6 |
Achchuthan Shanmugasundram gene: SIRT6 was added gene: SIRT6 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SIRT6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SIRT6 were set to 29555651; 30135584 Review for gene: SIRT6 was set to GREEN Added comment: PMID:29555651 reported a family with four consecutive cases of late foetal loss with gestational ages between 17 and 35 weeks. The foetuses showed prenatal abnormalities including intrauterine growth restriction (IUGR), microcephaly, craniofacial anomalies, sex reversal in male foetuses, and congenital heart defects. A homozygous inactivating variant in SIRT6 gene (c.187G > C; p.(Asp63His)) was identified by WES in the four foetuses. There is also functional data available from in vitro studies, SIRT6 D63H mouse embryonic stem cells and human induced pluripotent stem cells (iPSCs) derived from D63H homozygous foetuses. There is also functional evidence available from several other studies including PMID:30135584, where CRISPR-Cas9-based approach was used to generate a SIRT6-null cynomolgus monkey (Macaca fascicularis) model. SIRT6-deficient monkeys died hours after birth and exhibited severe prenatal developmental retardation. This gene has not been associated with any phenotypes either in OMIM or in Gene2Phenotype. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | OPA1 | Cassandra Muller reviewed gene: OPA1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25012220; Phenotypes: Behr syndrome, 210000 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PDP1 | Karina Sandoval reviewed gene: PDP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15855260, 31392110, 19184109; Phenotypes: Pyruvate dehydrogenase phosphatase deficiency,MIM#608782; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NUBPL | Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression.; to: Well established gene-disease association. Severe, multi system, mitochondrial condition with variable severity and progression. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NUBPL | Cassandra Muller changed review comment from: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression. Onset in infancy or childhood.; to: Well established gene-disease association. Severe, mitochondrial condition with variable severity and progression. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NUBPL | Cassandra Muller reviewed gene: NUBPL: Rating: GREEN; Mode of pathogenicity: None; Publications: 20818383, 32518176, 23553477, 31917109, 32518176, 31787496, 30897263, 22826544; Phenotypes: Mitochondrial complex I deficiency, nuclear type 21, 618242 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NR2E3 | Cassandra Muller Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NR2E3 | Cassandra Muller reviewed gene: NR2E3: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PCSK1 | Karina Sandoval reviewed gene: PCSK1: Rating: GREEN; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825, 23562752; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NDUFS4 | Cassandra Muller reviewed gene: NDUFS4: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mitochondrial complex I deficiency, nuclear type 1, 252010 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PCSK1 | Karina Sandoval Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PCSK1 |
Karina Sandoval changed review comment from: Unsure if severe enough to include in panel. MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood. PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue parenteral feeding. PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support that may be tapered off as the child ages.; to: Unsure if severe enough to include in panel. MM- Tricky - Hyperphagia & obesity but associated metabolic problems can be severe includeing cases of death in childhood. PMID:27187081 - some patients displayed morbid obesity and severe hyperphagia, other subjects were only moderately obese. BMI rises from 2 years and patients became obese from early childhood. However, the extreme obesity of the index case at 3 years of age has not been reported in any subsequent patients. Presentation is severe malabsorptive diarrhea, becoming clinically evident within the first 3 months of life. This can be so severe as to lead to a metabolic acidosis. After the age of 2 years, the severity of the malabsorption appears to spontaneously improve, and many children can discontinue parenteral feeding. PMID: 27288825 - Nutrition significantly diminshed beyond 2 years and patients can thrive despite the presence of persistent diarrhea that is lifelong and malabsorption throughout life, and early in life will require intravenous support that may be tapered off as the child ages. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NDE1 | Cassandra Muller reviewed gene: NDE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 30637988, 21529751, 34562061; Phenotypes: Lissencephaly 4 (with microcephaly), 614019 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Adult Cardiac SuperPanel v2.9 | Bryony Thompson Changed child panels to: Dilated Cardiomyopathy; Short QT syndrome; Atrial Fibrillation; Cardiac conduction disease; Hypertrophic cardiomyopathy_HCM; Arrhythmogenic Cardiomyopathy; Long QT Syndrome; Catecholaminergic Polymorphic Ventricular Tachycardia; Brugada syndrome; Ventricular Fibrillation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MMP2 | Cassandra Muller reviewed gene: MMP2: Rating: GREEN; Mode of pathogenicity: None; Publications: 11431697, 15691365, 17059372, 17400654; Phenotypes: Multicentric osteolysis, nodulosis, and arthropathy, 259600 (3); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2462 | RNU2-2P | Achchuthan Shanmugasundram reviewed gene: RNU2-2P: Rating: GREEN; Mode of pathogenicity: None; Publications: 40210679; Phenotypes: ; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PCSK1 | Karina Sandoval reviewed gene: PCSK1: Rating: AMBER; Mode of pathogenicity: None; Publications: 14617756, 17595246, 27187081, 27288825; Phenotypes: Endocrinopathy due to proprotein convertase 1/3 deficiency,MIM#600955; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PAH | Karina Sandoval reviewed gene: PAH: Rating: GREEN; Mode of pathogenicity: None; Publications: 27604308, 3008810, 31636599, 32141105; Phenotypes: Phenylketonuria,MIM#261600; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | OTUD6B | Karina Sandoval reviewed gene: OTUD6B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28343629, 32924626, 31147255; Phenotypes: Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies,MIM#617452; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | OPN1LW | Karina Sandoval reviewed gene: OPN1LW: Rating: RED; Mode of pathogenicity: None; Publications: 25168334, 32860923, 8213841; Phenotypes: Blue cone monochromacy,MIM#303700, Colorblindness, protan,MIM#303900; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MED12 | Melanie Marty reviewed gene: MED12: Rating: GREEN; Mode of pathogenicity: None; Publications: 33244166, 32174975, 30006928, 27312080; Phenotypes: MED12-related intellectual disability syndrome, MONDO:0100000; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | HYLS1 | Melanie Marty reviewed gene: HYLS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15843405, 18648327, 19400947, 19656802, 32509774, 39626953, 26830932; Phenotypes: Hydrolethalus syndrome (MIM#236680), Ciliopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FHL1 |
Melanie Marty changed review comment from: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287). Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease. Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy. XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function.; to: The FHL1 gene is associated with a diverse spectrum of X-linked diseases affecting skeletal and cardiac muscle (PMID: 21310615, 40017287). Well-established gene-disease association. FHL1 encodes 3 alternatively spliced isoforms - FHL1A, FHL1B, FHL1C composed of different LIM domains. FHL1A is predominant in muscle. Pathogenic variants affected isoform expression differently depending on location in alternatively spliced exons. Location of the variant appears to be related to severity of phenotype. Loss of function is the mechanism of disease. Reducing body myopathy (RBM) PMID: 18179901, 19716112, 18274675, 19181672, 25274776, 34366191 - XLD inheritance with clinical spectrum that includes severe early-onset to later-onset less progressive conditions including X-linked scapuloperoneal muscular dystrophy & X-linked myopathy with postural muscle atrophy. Pathogenic variants mainly located in more proximal exons (3-6). Fhl1 W122S knock-in mouse model has late-onset mild myopathy. Female carriers may experience mild proximal muscle weakness or be asymptomatic. XL-EDMD PMID: 19716112, 20186852, 20301609 - at least 7 families reported with XLD inheritance (female heterozygous carriers were asymptomatic or had mild myopathy and/or cardiomyopathy). EDMD-associated variants are localized in the distal exons (5-8) and associated with reduced function. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FHL1 | Melanie Marty reviewed gene: FHL1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19716112, 20186852, 20301609, 18179901, 25274776, 34366191, 18274675, 19181672, 21310615, 40017287; Phenotypes: Reducing body myopathy MONDO:0019948, X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2462 | ENAM | Bryony Thompson Added comment: Comment on mode of inheritance: Same mechanism of disease for monoallelic vs biallelic. Biallelic phenotype is more severe | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2462 | ENAM | Bryony Thompson Mode of inheritance for gene: ENAM was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.3 | EMILIN1 | Bryony Thompson Marked gene: EMILIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.3 | EMILIN1 | Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.3 | EMILIN1 | Bryony Thompson Phenotypes for gene: EMILIN1 were changed from arterial tortuosity-bone fragility syndrome to arterial tortuosity-bone fragility syndrome MONDO:0971179 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.2 | EMILIN1 | Bryony Thompson Classified gene: EMILIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.2 | EMILIN1 | Bryony Thompson Gene: emilin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Osteogenesis Imperfecta and Osteoporosis v1.1 | EMILIN1 |
Bryony Thompson gene: EMILIN1 was added gene: EMILIN1 was added to Osteogenesis Imperfecta and Osteoporosis. Sources: Literature Mode of inheritance for gene: EMILIN1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: EMILIN1 were set to 36351433 Phenotypes for gene: EMILIN1 were set to arterial tortuosity-bone fragility syndrome Review for gene: EMILIN1 was set to GREEN gene: EMILIN1 was marked as current diagnostic Added comment: Prenatal and neonatal fractures are a feature of the condition. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.54 | ELOVL4 | Bryony Thompson Mode of inheritance for gene: ELOVL4 was changed from MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.53 | ELOVL4 | Bryony Thompson reviewed gene: ELOVL4: Rating: GREEN; Mode of pathogenicity: Other; Publications: 11138005, 15028284, 11726641, 17208947; Phenotypes: Stargardt disease MONDO:0019353; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.222 | ELOVL4 | Bryony Thompson Marked gene: ELOVL4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.222 | ELOVL4 | Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.222 | ELOVL4 | Bryony Thompson Classified gene: ELOVL4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.222 | ELOVL4 | Bryony Thompson Gene: elovl4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.221 | ELOVL4 | Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: The macular dystrophy/Stargardt disease phenotype is nonsyndromic and the biallelic congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome doesn't include any retinal findings. Parents who were heterozygous for the variants did not have macular dystrophy. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Syndromic Retinopathy v0.221 | ELOVL4 | Bryony Thompson edited their review of gene: ELOVL4: Changed rating: RED; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2461 | ELOVL4 | Bryony Thompson changed review comment from: Well-established gene-disease associations. Monoallelic loss-of-function variants are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia.; to: Well-established gene-disease associations. Monoallelic truncating variants in the last exon with an expected dominant effect are associated with macular dystrophy/Stargardt disease. Biallelic loss-of-function variants cause congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome. Monoallelic missense variants cause spinocerebellar ataxia. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2461 | ELOVL1 | Bryony Thompson Publications for gene: ELOVL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2460 | ELOVL1 | Bryony Thompson Mode of inheritance for gene: ELOVL1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2459 | ELOVL1 | Bryony Thompson reviewed gene: ELOVL1: Rating: RED; Mode of pathogenicity: None; Publications: 35379526; Phenotypes: ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facial features MONDO:0032798; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2459 | ELOVL1 | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2459 | EIF2AK4 | Bryony Thompson Publications for gene: EIF2AK4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2458 | EIF2AK2 | Bryony Thompson Phenotypes for gene: EIF2AK2 were changed from Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia to Intellectual disability; white matter abnormalities; ataxia; regression with febrile illness; Dystonia; complex neurodevelopmental disorder MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2457 | EIF2A | Bryony Thompson Phenotypes for gene: EIF2A were changed from Intellectual disability, epilepsy to Intellectual disability, epilepsy; MONDO:0700092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2456 | EIF2AK1 | Bryony Thompson Phenotypes for gene: EIF2AK1 were changed from Intellectual disability; white matter abnormalities to Intellectual disability; white matter abnormalities; MONDO:0100038 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2455 | EGR2 | Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2454 | EGR2 | Bryony Thompson Mode of inheritance for gene: EGR2 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.321 | EFNA4 | Bryony Thompson Publications for gene: EFNA4 were set to 29215649; 29168297; 16540516 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.320 | EFNA4 | Bryony Thompson Classified gene: EFNA4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.320 | EFNA4 | Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.319 | EFNA4 | Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.69 | EFNA4 | Bryony Thompson Classified gene: EFNA4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.69 | EFNA4 | Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Craniosynostosis v1.68 | EFNA4 | Bryony Thompson reviewed gene: EFNA4: Rating: RED; Mode of pathogenicity: None; Publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816; Phenotypes: craniosynostosis MONDO:0015469; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2453 | EFNA4 | Bryony Thompson Classified gene: EFNA4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2453 | EFNA4 | Bryony Thompson Gene: efna4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2452 | EFNA4 |
Bryony Thompson changed review comment from: Supporting animal models, but no compelling evidence in human cases. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease. PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent. PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly. PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls. PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4.; to: Supporting animal models, but no compelling evidence in human cases has been reported since 2006. There’s no supporting segregation evidence and most of the variants reports to date are more common than expected for a dominant disease. PMID: 34586326 - 3 missense variants identified in a cohort of 101 children with non-syndromic craniosynostosis (EFNA4, c.178C>T: p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1, c.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr - 337 hets in gnomAD v2.1). All 3 variants were present in at least one non-affected family member PMID: 23983218, 33065355 - Efna4 KO mouse line demonstrates skeletal variance. Homozygous Epha4 null mice had substantially less trabecular bone in femur and vertebra compared to wild-type controls PMID: 29215649 - 1 missense variant (c.211G>A, p.(Glu71Lys) - 7 hets in gnomAD v2.1) identified in a unicoronal craniosynostosis case in a cohort of 309 craniosynostosis cases PMID: 29168297 - 1 missense variant (c.550C>T; p.(Leu184Phe) - 1 het in gnomAD v2.1) in a metopic craniosynostosis case from a cohort of 391 single suture craniosynostosis cases. The variant was inherited from an unaffected parent. PMID: 19772933 - a de novo 1.4 Mb microdeletion of chromosome 1q21.3, including EFNA1, EFNA3 and EFNA4, was identified in a child with moderate mental retardation, microcephaly, arching eyebrows, low set ears, long eyelashes, persistent fetal pads and clinodactyly. PMID: 19201948 - EphA4 -/- mutant mice exhibit defects in the coronal suture and neural crest-mesoderm boundary that phenocopy those of Twist1+/- mice. The EphA4 +/- mice were similar to the wild-type controls. PMID: 16540516 - 3 variants (178C>T p.His60Tyr - 361 hets & 2 homs in gnomAD v2.1; c.349C>A p.Pro117Thr - 337 hets in gnomAD v2.1; frameshift 471_472delCCinsA) in cohort of 81 non-syndromic coronal synostosis cases. 2 of the variants were inherited from unaffected parents and Pro117Thr was de novo (confirmed). In vitro functional assays demonstrated partial or complete loss of function for the missense variants. Fibroblasts from the patient with the frameshift expressed in an alternatively spliced minor isoform of EFNA4. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2452 | EFNA4 | Bryony Thompson edited their review of gene: EFNA4: Changed rating: RED; Changed publications: 16540516, 19201948, 19772933, 23983218, 29168297, 29215649, 33065355, 34586326, 36140816 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.53 | EFEMP1 | Bryony Thompson Marked gene: EFEMP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.53 | EFEMP1 | Bryony Thompson Gene: efemp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.53 | EFEMP1 | Bryony Thompson Added comment: Comment on phenotypes: Singe missense variant (p.Arg345Trp) associated with disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.53 | EFEMP1 | Bryony Thompson Phenotypes for gene: EFEMP1 were changed from Inherited macular dystrophy (Doyne/dominant drusen) to Doyne honeycomb retinal dystrophy MONDO:0007471 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.52 | EFEMP1 | Bryony Thompson Publications for gene: EFEMP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2452 | EFEMP1 | Bryony Thompson Publications for gene: EFEMP1 were set to 32006683; 31792352; 33807164 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.102 | EEF1D | Bryony Thompson Classified gene: EEF1D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.102 | EEF1D | Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.101 | EEF1D | Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2451 | EEF1D | Bryony Thompson Publications for gene: EEF1D were set to 30787422; 28097321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.100 | EEF1D | Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2450 | EEF1D | Bryony Thompson Classified gene: EEF1D as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2450 | EEF1D | Bryony Thompson Gene: eef1d has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2449 | EEF1D | Bryony Thompson reviewed gene: EEF1D: Rating: GREEN; Mode of pathogenicity: None; Publications: 38083972, 36576126, 30787422, 28097321; Phenotypes: Neurodevelopmental disorder MONDO:0700092, EEF1D-related; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.214 | EDN3 | Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deafness_IsolatedAndComplex v1.214 | EDN3 | Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hirschsprung disease v0.26 | EDN3 | Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hirschsprung disease v0.26 | EDN3 | Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gastrointestinal neuromuscular disease v1.25 | EDN3 | Bryony Thompson Added comment: Comment on mode of inheritance: AD association is limited/disputed | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gastrointestinal neuromuscular disease v1.25 | EDN3 | Bryony Thompson Mode of inheritance for gene: EDN3 was changed from BOTH monoallelic and biallelic, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2449 | EDARADD | Bryony Thompson Publications for gene: EDARADD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MFN2 | Melanie Marty reviewed gene: MFN2: Rating: GREEN; Mode of pathogenicity: None; Publications: 15064763, 15549395, 16437557, 20008656; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087, Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PDE6B | Melanie Marty reviewed gene: PDE6B: Rating: RED; Mode of pathogenicity: None; Publications: 8394174, 8075643, 17044014, 7599633, 18854872, 33673512; Phenotypes: Retinitis pigmentosa-40, MIM#613801; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SCN9A | Melanie Marty reviewed gene: SCN9A: Rating: GREEN; Mode of pathogenicity: None; Publications: 18060017; Phenotypes: Insensitivity to pain, congenital, MIM# 243000, Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Predominantly Antibody Deficiency v1.1 | BLK | Bryony Thompson Marked gene: BLK as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Predominantly Antibody Deficiency v1.1 | BLK | Bryony Thompson Gene: blk has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Predominantly Antibody Deficiency v1.1 | BLK |
Bryony Thompson gene: BLK was added gene: BLK was added to Predominantly Antibody Deficiency. Sources: Literature Mode of inheritance for gene: BLK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: BLK were set to 25926555 Phenotypes for gene: BLK were set to Common variable immunodeficiency, MONDO:0015517 Review for gene: BLK was set to RED Added comment: Two individuals in a single family heterozygous for a missense variant p.L3P (46 hets in gnomAD v4) reported with CVID. There have been no other reports in the last 10 years. In vitro functional assays of the variant. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2448 | BLK | Bryony Thompson Classified gene: BLK as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2448 | BLK | Bryony Thompson Added comment: Comment on list classification: Two individuals in a single family heterozygous for a missense variant p.L3P (46 hets in gnomAD v4) reported with CVID. There have been no other reports in the last 10 years. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2448 | BLK | Bryony Thompson Gene: blk has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PNPLA6 | Andrew Coventry reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 38735647, 25480986, 33818269, 32758583, 30097146; Phenotypes: Boucher-Neuhauser syndrome MIM#215470, Oliver-McFarlane syndrome MIM#275400, Spastic paraplegia 39, autosomal recessive MIM#612020; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | PAK3 | Andrew Coventry reviewed gene: PAK3: Rating: GREEN; Mode of pathogenicity: None; Publications: 9731525, 10946356, 12884430, 17853471, 18523455, 24556213, 25666757, 27753653, 28481730, 28126652; Phenotypes: Intellectual developmental disorder, X-linked 30 MIM#300558; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NAGA | Andrew Coventry reviewed gene: NAGA: Rating: GREEN; Mode of pathogenicity: None; Publications: 11313741, 31468281, 15619430, 8782044; Phenotypes: Schindler disease, type I MIM#609241, Schindler disease, type III MIM#609241; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SEC23A |
Melanie Marty changed review comment from: SEC23A is an essential component of coat protein complex II (COPII)-coated vesicles that transport secretory proteins from the endoplasmic reticulum (ER) to the Golgi complex. Boyadjiev et al 2006 (PMID:16980979): One family was reported with a homozygous missense variant and craniolenticulosutural dysplasia (CLSD), with some functional studies supporting pathogenicity. Boyadjiev et al 2011 (PMID: 21039434): The same authors as above later reported another individual with similar phenotype with a paternally inherited heterozygous missense variant, this variant has 91 hets in gnomAD and the father was unaffected. They suggest digenic inheritance but found no other variants in 3 candidate genes. Wang et al 2023 (PMID: 37828500): 2 x compound heterozygous missense variants were identified in a patient with CLSD. Cisarova et al 2022 (PMID: 34580982) 1 x patient with het missense variant inherited from his affected father. Shown to be de novo in the father. Minale et al 2024 (PMID: 38275611): 1 x patient with de novo het missense variant Zebrafish models lend some support to the gene-disease association (PMID:16980979, 16980978) Summary: 2 reports of AR inheritance, 2 reports of AD inheritance, 1 uncertain; to: SEC23A is an essential component of coat protein complex II (COPII)-coated vesicles that transport secretory proteins from the endoplasmic reticulum (ER) to the Golgi complex. Boyadjiev et al 2006 (PMID:16980979): One family was reported with a homozygous missense variant and craniolenticulosutural dysplasia (CLSD), with some functional studies supporting pathogenicity. Boyadjiev et al 2011 (PMID: 21039434): The same authors as above later reported another individual with similar phenotype with a paternally inherited heterozygous missense variant, this variant has 91 hets in gnomAD and the father was unaffected. They suggest digenic inheritance but found no other variants in 3 candidate genes. Wang et al 2023 (PMID: 37828500): 2 x compound heterozygous missense variants were identified in a patient with CLSD. Cisarova et al 2022 (PMID: 34580982) 1 x patient with CLSD and a het missense variant inherited from his affected father. Shown to be de novo in the father. Minale et al 2024 (PMID: 38275611): 1 x patient with CLSD and a de novo het missense variant Zebrafish models lend some support to the gene-disease association (PMID:16980979, 16980978) Summary: 2 reports of AR inheritance, 2 reports of AD inheritance, 1 uncertain |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SEC23A | Melanie Marty edited their review of gene: SEC23A: Changed rating: RED; Changed publications: 16980979, 21039434, 16980978, 27148587, 37828500, 34580982, 38275611 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | SEC23A | Melanie Marty reviewed gene: SEC23A: Rating: AMBER; Mode of pathogenicity: None; Publications: 16980979, 21039434, 16980978, 27148587, 37828500, 34580982, PMID: 38275611; Phenotypes: Craniolenticulosutural dysplasia, MIM#607812; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MUSK | Andrew Coventry reviewed gene: MUSK: Rating: GREEN; Mode of pathogenicity: None; Publications: 25537362, 25612909, 8653786, 31750350, 15496425, 19949040, 20371544, 32253145; Phenotypes: Fetal akinesia deformation sequence 1 MIM#208150, Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency MIM#616325; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MTTP | Andrew Coventry reviewed gene: MTTP: Rating: GREEN; Mode of pathogenicity: None; Publications: 17275380, 34078172, 34052173, 33258201; Phenotypes: Abetalipoproteinemia MIM#200100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MTHFD1 | Andrew Coventry reviewed gene: MTHFD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 32414565, 19033438; Phenotypes: Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia MIM#617780; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MKS1 | Andrew Coventry reviewed gene: MKS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 17377820, 24886560, 19776033, 33193692, 27570071, 27377014, 18327255, 24608809; Phenotypes: Bardet-Biedl syndrome 13 MIM#615990, Joubert syndrome 28 MIM#617121, Meckel syndrome 1 MIM#249000, Ciliopathy MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MBTPS2 | Andrew Coventry reviewed gene: MBTPS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 19361614, 27380894, 34902613, 14708109, 22105905, 24313295, 19689518, 24090718, 21600032; Phenotypes: IFAP syndrome with or without BRESHECK syndrome MIM#308205, Osteogenesis imperfecta, type XIX MIM#301014; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | LYST | Andrew Coventry reviewed gene: LYST: Rating: GREEN; Mode of pathogenicity: None; Publications: 8896560, 9215680, 31906877, 9215679, 26499269, 24112114, 28145517; Phenotypes: Chediak-Higashi syndrome MIM#214500; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | LRMDA | Andrew Coventry reviewed gene: LRMDA: Rating: GREEN; Mode of pathogenicity: None; Publications: 37053367, 23395477, 38555393; Phenotypes: Albinism, oculocutaneous, type VII MIM#615179, MONDO:0014070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | LARS2 | Andrew Coventry reviewed gene: LARS2: Rating: GREEN; Mode of pathogenicity: None; Publications: 29205794, 32423379, 30737337, 26537577, 23541342; Phenotypes: Hydrops, lactic acidosis, and sideroblastic anemia MIM#617021, Perrault syndrome 4 MIM#615300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | KIF7 | Andrew Coventry reviewed gene: KIF7: Rating: GREEN; Mode of pathogenicity: None; Publications: 21552264, 36580738, 21633164, 19666503, 30445565, 26648833, 26349186, 26174511, 25714560; Phenotypes: Al-Gazali-Bakalinova syndrome MIM#607131, Hydrolethalus syndrome 2 MIM#614120, Acrocallosal syndrome MIM#200990, Joubert syndrome 12 MIM#200990; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | KIAA1109 | Andrew Coventry reviewed gene: KIAA1109: Rating: GREEN; Mode of pathogenicity: None; Publications: 29290337, 30906834, 25558065; Phenotypes: Alkuraya-Kucinskas syndrome MIM#617822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | KCNV2 | Andrew Coventry reviewed gene: KCNV2: Rating: GREEN; Mode of pathogenicity: None; Publications: 16909397, 18235024, 21882291, 15722315, 30820446, 21882291, 23115240; Phenotypes: Inherited retinal dystrophy MONDO:0019118, Retinal cone dystrophy 3B MIM#610356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | INPP5K | Andrew Coventry reviewed gene: INPP5K: Rating: GREEN; Mode of pathogenicity: None; Publications: 28190456, 28190459, 28940338, 31630891, 33193651, 33792664; Phenotypes: Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | IFT172 | Andrew Coventry reviewed gene: IFT172: Rating: GREEN; Mode of pathogenicity: None; Publications: 30761183, 26763875, 25168386, 24140113, 25168386; Phenotypes: Bardet-Biedl syndrome 20 MIM#619471, Retinitis pigmentosa 71 MIM#616394, Short-rib thoracic dysplasia 10 with or without polydactyly MIM#615630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | IBA57 | Andrew Coventry reviewed gene: IBA57: Rating: GREEN; Mode of pathogenicity: None; Publications: 23462291, 25971455, 25609768, 28913435, 28671726, 30258207; Phenotypes: Mitochondrial disease MONDO:0044970, Multiple mitochondrial dysfunctions syndrome 3 MIM#615330; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | HSPD1 | Andrew Coventry reviewed gene: HSPD1: Rating: GREEN; Mode of pathogenicity: None; Publications: 18571143, 27405012, 32532876, 28377887, 27405012; Phenotypes: Leukodystrophy, hypomyelinating, 4 MIM#612233; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | HPS3 | Andrew Coventry reviewed gene: HPS3: Rating: GREEN; Mode of pathogenicity: None; Publications: 11455388, 31880485, 31621111, 30990103; Phenotypes: Hermansky-Pudlak syndrome 3 MIM#614072; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | HAMP | Andrew Coventry reviewed gene: HAMP: Rating: GREEN; Mode of pathogenicity: None; Publications: 12469120, 12490283, 34828384, 15198949; Phenotypes: Hemochromatosis, type 2B MIM#613313; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | HADH | Andrew Coventry reviewed gene: HADH: Rating: GREEN; Mode of pathogenicity: None; Publications: 1835339, 10347277, 10931422; Phenotypes: 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | GLDN | Andrew Coventry reviewed gene: GLDN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27616481, 32812332, 28726266, 35806855; Phenotypes: Lethal congenital contracture syndrome 11 MIM#617194; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | GBA | Andrew Coventry reviewed gene: GBA: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Gaucher disease, perinatal lethal MIM#608013; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FTSJ1 | Andrew Coventry reviewed gene: FTSJ1: Rating: GREEN; Mode of pathogenicity: None; Publications: 15342698, 18081026, 15162322, 26310293; Phenotypes: Intellectual developmental disorder, X-linked 9 MIM#309549, X-linked complex neurodevelopmental disorder MONDO:0100148; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FRAS1 | Andrew Coventry reviewed gene: FRAS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 12766769, 18671281, 16894541, 17163535; Phenotypes: Fraser syndrome 1 MIM#219000; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FKBP14 | Andrew Coventry reviewed gene: FKBP14: Rating: GREEN; Mode of pathogenicity: None; Publications: 22265013, 24773188, 27149304, 31132235, 30561154, 28617417; Phenotypes: Ehlers-Danlos syndrome, kyphoscoliotic type, 2 MIM#614557; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FGD4 | Andrew Coventry reviewed gene: FGD4: Rating: GREEN; Mode of pathogenicity: None; Publications: 17564959, 31152969, 28847448, 28543957, 17564972; Phenotypes: Charcot-Marie-Tooth disease, type 4H MIM#609311, Charcot-Marie-Tooth disease MONDO:0015626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FANCL | Andrew Coventry reviewed gene: FANCL: Rating: GREEN; Mode of pathogenicity: None; Publications: 19405097, 25754594, 33394227, 33224012, 12973351, 31513304; Phenotypes: Fanconi anemia, complementation group L MIM#614083; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FANCD2 | Andrew Coventry reviewed gene: FANCD2: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301575, 17436244, 25703294, 23613520; Phenotypes: Fanconi anemia, complementation group D2 MIM#227646; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | FAM20C | Andrew Coventry reviewed gene: FAM20C: Rating: GREEN; Mode of pathogenicity: None; Publications: 19250384, 32299476, 20825432, 33676444, 32833257; Phenotypes: Raine syndrome MIM#259775; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | EIF2B3 | Andrew Coventry reviewed gene: EIF2B3: Rating: GREEN; Mode of pathogenicity: None; Publications: 11835386, 19158808, 21484434, 18263758, 25843247, 25761052, 28904586, 28597716; Phenotypes: Leukoencephalopathy with vanishing white matter 3, with or without ovarian failure MIM#620313; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | POLE |
Andrew Coventry gene: POLE was added gene: POLE was added to Prepair 1000+. Sources: Literature Mode of inheritance for gene: POLE was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: POLE were set to 30503519; 23230001; 25948378; 36071887 Phenotypes for gene: POLE were set to IMAGE-I syndrome MIM#618336; FILS syndrome MIM#615139 Review for gene: POLE was set to GREEN Added comment: IMAGE-I Syndrome Autosomal recessive disorder characterised by intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency. Patients exhibit distinctive facial features and variable immune dysfunction with evidence of lymphocyte deficiency. Well established gene-disease association. Reported in greater than 10 families. Note recurrent intronic variant, c.1686+32C-G (intron 15) in IMAGE-I, found in combination with multiple other variants. FILS syndrome FILS syndrome is characterised by mild facial dysmorphism, mainly malar hypoplasia, livedo on the skin since birth, immunodeficiency resulting in recurrent infections, and short stature. PMID: 23230001 - French consanguineoius kindred: 11 affected individuals displayed mild facial dysmorphism, immunodeficiency, livedo, and short stature. 3 additional members displayed two or three of these four features. Homozygous for splicing site variant: c.4444+3A>G. PMID: 25948378 - Palestinian girl, with same homozygous variant as reported in French family. PMID: 36071887 - 4y.o. Chinese boy with c.5811 + 2T > C and c.2006G > A variants. PMID: 32705701 - 6y.o. hispanic boy reported with homozygous c.100C>T(p.Arg34Cys Total of 14 affected individuals across 4 families. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | CHMP1A |
Andrew Coventry gene: CHMP1A was added gene: CHMP1A was added to Prepair 1000+. Sources: Literature Mode of inheritance for gene: CHMP1A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHMP1A were set to 23023333; 37789895 Phenotypes for gene: CHMP1A were set to Pontocerebellar hypoplasia, type 8 MIM#614961 Review for gene: CHMP1A was set to AMBER Added comment: Pontocerebellar hypoplasia type 8 is an autosomal recessive neurodevelopmental disorder characterised by severe psychomotor impediment, abnormal movements, hypotonia, spasticity, and variable visual defects. Brain MRI shows pontocerebellar hypoplasia, decreased cerebral white matter, and a thin corpus callosum. Zebrafish model present. PMID: 23023333 - Three families reported, 2 variants; two families likely with founder effect. PMID: 37789895 - describe novel variants in an affected individual, one is deletion of exon 1, other is c.53 T > C (p.Leu18Pro). Total 4 families now reported with 4 variants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | POLR1D |
Andrew Coventry gene: POLR1D was added gene: POLR1D was added to Prepair 1000+. Sources: Literature Mode of inheritance for gene: POLR1D was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: POLR1D were set to 21131976; 24603435; 27448281; 25790162 Phenotypes for gene: POLR1D were set to Treacher Collins syndrome 2 MIM#613717 Review for gene: POLR1D was set to AMBER Added comment: Treacher Collins syndrome is a disorder of craniofacial development characterised by a combination of bilateral downward slanting of the palpebral fissures, colobomas of the lower eyelids with a paucity of eyelashes medial to the defect, hypoplasia of the facial bones, cleft palate, malformation of the external ears, atresia of the external auditory canals, and bilateral conductive hearing loss. Currently, only one study reporting AR TCS, 1 pathogenic variant in 4 affected individuals, across 2 unrelated consanguineous families. PMID: 24603435. Adding gene, requiring further evidence in humans for consideration for inclusion in screening of AR TCS. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.100 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.99 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.126 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.125 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.303 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v1.302 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2447 | SPOUT1 | Zornitza Stark reviewed gene: SPOUT1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2447 | SPOUT1 | Zornitza Stark Phenotypes for gene: SPOUT1 were changed from complex neurodevelopmental disorder MONDO:0100038, SPOUT1-related to Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.319 | DISP1 | Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Fetal anomalies v1.318 | DISP1 | Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.99 | DISP1 | Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly (MONDO:0016296), DISP1-related to Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.98 | DISP1 | Zornitza Stark edited their review of gene: DISP1: Changed phenotypes: Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2446 | DISP1 | Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly, MONDO:0016296 to Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v1.18 | DISP1 | Zornitza Stark Phenotypes for gene: DISP1 were changed from Holoprosencephaly, MONDO:0016296 to Holoprosencephaly 10, MIM# 621143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hair disorders v0.73 | KRT83 | Zornitza Stark Phenotypes for gene: KRT83 were changed from Monilethrix, 158000 to Monilethrix, MIM#621170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hair disorders v0.72 | KRT83 | Zornitza Stark edited their review of gene: KRT83: Changed phenotypes: Monilethrix , MIM#621170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2445 | KRT83 | Zornitza Stark Phenotypes for gene: KRT83 were changed from Erythrokeratodermia variabilis et progressiva 5, MIM# 617756; Monilethrix , MIM#158000 to Erythrokeratodermia variabilis et progressiva 5, MIM# 617756; Monilethrix , MIM#621170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2444 | KRT83 | Zornitza Stark edited their review of gene: KRT83: Changed phenotypes: Erythrokeratodermia variabilis et progressiva 5, MIM# 617756, Monilethrix , MIM#621170 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hair disorders v0.72 | KRT81 | Zornitza Stark Phenotypes for gene: KRT81 were changed from Monilethrix, MIM# 158000 to Monilethrix, MIM# 621169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hair disorders v0.71 | KRT81 | Zornitza Stark edited their review of gene: KRT81: Changed phenotypes: Monilethrix, MIM# 621169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2444 | KRT81 | Zornitza Stark Phenotypes for gene: KRT81 were changed from Monilethrix, MIM# 158000 to Monilethrix, MIM# 621169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | KRT81 | Zornitza Stark edited their review of gene: KRT81: Changed phenotypes: Monilethrix, MIM# 621169 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ZP3 | Zornitza Stark Marked gene: ZP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ZP3 | Zornitza Stark Gene: zp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ZP3 | Zornitza Stark Classified gene: ZP3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.63 | ZP3 | Zornitza Stark Gene: zp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.62 | ZP2 | Zornitza Stark Marked gene: ZP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.62 | ZP2 | Zornitza Stark Gene: zp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.62 | ZP2 | Zornitza Stark Classified gene: ZP2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.62 | ZP2 | Zornitza Stark Gene: zp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.61 | ZP1 | Zornitza Stark Marked gene: ZP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.61 | ZP1 | Zornitza Stark Gene: zp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.61 | ZP1 | Zornitza Stark Classified gene: ZP1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.61 | ZP1 | Zornitza Stark Gene: zp1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.60 | WNT6 | Zornitza Stark Marked gene: WNT6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.60 | WNT6 | Zornitza Stark Gene: wnt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.60 | WNT6 | Zornitza Stark Classified gene: WNT6 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.60 | WNT6 | Zornitza Stark Gene: wnt6 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.59 | WNT6 | Zornitza Stark reviewed gene: WNT6: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: recurrent pregnancy loss susceptibility, MONDO:0000144; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.59 | USP26 | Zornitza Stark Marked gene: USP26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.59 | USP26 | Zornitza Stark Gene: usp26 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.59 | USP26 | Zornitza Stark Classified gene: USP26 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.59 | USP26 | Zornitza Stark Gene: usp26 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.58 | USP26 | Zornitza Stark reviewed gene: USP26: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure, X-linked 6, MIM# 301101; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.58 | USP26 | Zornitza Stark Classified gene: USP26 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.58 | USP26 | Zornitza Stark Gene: usp26 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.57 | UBE2B | Zornitza Stark Marked gene: UBE2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.57 | UBE2B | Zornitza Stark Gene: ube2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.57 | UBE2B | Zornitza Stark Classified gene: UBE2B as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.57 | UBE2B | Zornitza Stark Gene: ube2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.56 | TUBB8 | Zornitza Stark Marked gene: TUBB8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.56 | TUBB8 | Zornitza Stark Gene: tubb8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.56 | TUBB8 | Zornitza Stark Classified gene: TUBB8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.56 | TUBB8 | Zornitza Stark Gene: tubb8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.55 | TACC3 | Zornitza Stark Phenotypes for gene: TACC3 were changed from to Female infertility due to oocyte meiotic arrest, MONDO:0044626 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.54 | TACC3 | Zornitza Stark Marked gene: TACC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.54 | TACC3 | Zornitza Stark Gene: tacc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.54 | TACC3 | Zornitza Stark Classified gene: TACC3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.54 | TACC3 | Zornitza Stark Gene: tacc3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.53 | TACC3 | Zornitza Stark reviewed gene: TACC3: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Female infertility due to oocyte meiotic arrest, MONDO:0044626; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.53 | STAG3 | Zornitza Stark Marked gene: STAG3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.53 | STAG3 | Zornitza Stark Gene: stag3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.53 | STAG3 | Zornitza Stark Classified gene: STAG3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.53 | STAG3 | Zornitza Stark Gene: stag3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.52 | STAG3 | Zornitza Stark reviewed gene: STAG3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Premature ovarian failure 8, MIM# 615723, Spermatogenic failure 61, MIM# 619672; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.52 | SOHLH1 | Zornitza Stark Marked gene: SOHLH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.52 | SOHLH1 | Zornitza Stark Gene: sohlh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.52 | SOHLH1 | Zornitza Stark Classified gene: SOHLH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.52 | SOHLH1 | Zornitza Stark Gene: sohlh1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.51 | SLC26A8 | Zornitza Stark Marked gene: SLC26A8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.51 | SLC26A8 | Zornitza Stark Gene: slc26a8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.51 | SLC26A8 | Zornitza Stark Classified gene: SLC26A8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.51 | SLC26A8 | Zornitza Stark Gene: slc26a8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.50 | PSMC3IP | Zornitza Stark Marked gene: PSMC3IP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.50 | PSMC3IP | Zornitza Stark Gene: psmc3ip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.50 | PSMC3IP | Zornitza Stark Classified gene: PSMC3IP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.50 | PSMC3IP | Zornitza Stark Gene: psmc3ip has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.49 | PRDM9 | Zornitza Stark Marked gene: PRDM9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.49 | PRDM9 | Zornitza Stark Gene: prdm9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.49 | PRDM9 | Zornitza Stark Classified gene: PRDM9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.49 | PRDM9 | Zornitza Stark Gene: prdm9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.48 | POF1B | Zornitza Stark Marked gene: POF1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.48 | POF1B | Zornitza Stark Gene: pof1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.48 | POF1B | Zornitza Stark edited their review of gene: POF1B: Changed mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.48 | POF1B | Zornitza Stark Classified gene: POF1B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.48 | POF1B | Zornitza Stark Gene: pof1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.47 | POF1B | Zornitza Stark reviewed gene: POF1B: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Premature ovarian failure 2B, MIM# 300604; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.47 | PDHA2 | Zornitza Stark Marked gene: PDHA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.47 | PDHA2 | Zornitza Stark Gene: pdha2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.47 | PDHA2 | Zornitza Stark Classified gene: PDHA2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.47 | PDHA2 | Zornitza Stark Gene: pdha2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.46 | PDHA2 | Zornitza Stark reviewed gene: PDHA2: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 70, MIM# 619828; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.46 | PATL2 | Zornitza Stark Marked gene: PATL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.46 | PATL2 | Zornitza Stark Gene: patl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.46 | PATL2 | Zornitza Stark Classified gene: PATL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.46 | PATL2 | Zornitza Stark Gene: patl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.45 | PADI6 | Zornitza Stark Marked gene: PADI6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.45 | PADI6 | Zornitza Stark Gene: padi6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.45 | PADI6 | Zornitza Stark Classified gene: PADI6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.45 | PADI6 | Zornitza Stark Gene: padi6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.44 | NOBOX | Zornitza Stark Marked gene: NOBOX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.44 | NOBOX | Zornitza Stark Gene: nobox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.44 | NOBOX | Zornitza Stark Classified gene: NOBOX as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.44 | NOBOX | Zornitza Stark Gene: nobox has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.43 | MSH4 | Zornitza Stark Marked gene: MSH4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.43 | MSH4 | Zornitza Stark Gene: msh4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.43 | MSH4 | Zornitza Stark Classified gene: MSH4 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.43 | MSH4 | Zornitza Stark Gene: msh4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.42 | FSHR | Zornitza Stark Marked gene: FSHR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.42 | FSHR | Zornitza Stark Gene: fshr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.42 | FSHR | Zornitza Stark Classified gene: FSHR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.42 | FSHR | Zornitza Stark Gene: fshr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.41 | FSHR | Zornitza Stark reviewed gene: FSHR: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ovarian dysgenesis 1 MONDO:0024463, Ovarian hyperstimulation syndrome MONDO:0011972; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.41 | FSHB | Zornitza Stark Marked gene: FSHB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.41 | FSHB | Zornitza Stark Gene: fshb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.41 | FSHB | Zornitza Stark Classified gene: FSHB as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.41 | FSHB | Zornitza Stark Gene: fshb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.40 | ELL3 | Zornitza Stark Marked gene: ELL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.40 | ELL3 | Zornitza Stark Gene: ell3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.40 | ELL3 | Zornitza Stark Phenotypes for gene: ELL3 were changed from to Pregnancy loss, recurrent, susceptibility to, MONDO:0000144, ELL3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.39 | ELL3 | Zornitza Stark Classified gene: ELL3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.39 | ELL3 | Zornitza Stark Gene: ell3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.38 | DNAH8 | Zornitza Stark Marked gene: DNAH8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.38 | DNAH8 | Zornitza Stark Gene: dnah8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.38 | DNAH8 | Zornitza Stark Classified gene: DNAH8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.38 | DNAH8 | Zornitza Stark Gene: dnah8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.37 | DNAH1 | Zornitza Stark Marked gene: DNAH1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.37 | DNAH1 | Zornitza Stark Gene: dnah1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.37 | DNAH1 | Zornitza Stark Classified gene: DNAH1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.37 | DNAH1 | Zornitza Stark Gene: dnah1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.36 | DHH | Zornitza Stark Marked gene: DHH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.36 | DHH | Zornitza Stark Gene: dhh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.36 | DHH | Zornitza Stark Classified gene: DHH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.36 | DHH | Zornitza Stark Gene: dhh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.35 | CPEB1 | Zornitza Stark Marked gene: CPEB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.35 | CPEB1 | Zornitza Stark Gene: cpeb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.35 | CPEB1 | Zornitza Stark Phenotypes for gene: CPEB1 were changed from Primary ovarian insufficiency, MONDO:0005387 to Primary ovarian insufficiency, MONDO:0005387, CPEB1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.34 | CPEB1 | Zornitza Stark Classified gene: CPEB1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.34 | CPEB1 | Zornitza Stark Gene: cpeb1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CPEB1 | Zornitza Stark reviewed gene: CPEB1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Primary ovarian insufficiency, MONDO:0005387, CPEB1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CPEB1 | Zornitza Stark Tag SV/CNV tag was added to gene: CPEB1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CFTR | Zornitza Stark Marked gene: CFTR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CFTR | Zornitza Stark Gene: cftr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CFTR | Zornitza Stark Classified gene: CFTR as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.33 | CFTR | Zornitza Stark Gene: cftr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.32 | AMHR2 | Zornitza Stark Marked gene: AMHR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.32 | AMHR2 | Zornitza Stark Gene: amhr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.32 | AMHR2 | Zornitza Stark Classified gene: AMHR2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.32 | AMHR2 | Zornitza Stark Gene: amhr2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.31 | AMH | Zornitza Stark Marked gene: AMH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.31 | AMH | Zornitza Stark Gene: amh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.31 | AMH | Zornitza Stark Classified gene: AMH as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.31 | AMH | Zornitza Stark Gene: amh has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.30 | AARS2 | Zornitza Stark Marked gene: AARS2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.30 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.30 | AARS2 | Zornitza Stark Classified gene: AARS2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.30 | AARS2 | Zornitza Stark Gene: aars2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arrhythmia_SuperPanel v3.28 |
Bryony Thompson Panel status changed from promoted to public Changed child panels to: Short QT syndrome; Atrial Fibrillation; Cardiac conduction disease; Arrhythmogenic Cardiomyopathy; Long QT Syndrome; Catecholaminergic Polymorphic Ventricular Tachycardia; Brugada syndrome; Ventricular Fibrillation |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v1.0 | Bryony Thompson promoted panel to version 1.0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.38 | Bryony Thompson Panel status changed from internal to public | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.36 | GNB2 | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.36 | GNB2 |
Bryony Thompson gene: GNB2 was added gene: GNB2 was added to Cardiac conduction disease. Sources: Literature Mode of inheritance for gene: GNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GNB2 were set to 28219978 Phenotypes for gene: GNB2 were set to Sick sinus syndrome 4, MIM# 619464 Review for gene: GNB2 was set to RED Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.35 | GJA5 | Bryony Thompson Marked gene: GJA5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.35 | GJA5 | Bryony Thompson Gene: gja5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.35 | GJA5 | Bryony Thompson Classified gene: GJA5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.35 | GJA5 | Bryony Thompson Gene: gja5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.34 | GJA5 |
Bryony Thompson gene: GJA5 was added gene: GJA5 was added to Cardiac conduction disease. Sources: NHS GMS Mode of inheritance for gene: GJA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GJA5 were set to 9501069; 10086977; 22247482; 36352534 Phenotypes for gene: GJA5 were set to heart conduction disease MONDO:0000992 Review for gene: GJA5 was set to AMBER Added comment: PMID: 9501069, 10086977 - null mouse model with cardiac conduction abnormalities characteristic of first-degree atrioventricular block with associated bundle branch block PMID: 22247482 - Q58L (absent from gnomAD v4) identified in a proband with progressive familial heart block, segregated to affected sibling and was likely present in mother that died of sudden cardiac death (the variant was absent from the probands father and maternal grandparents, suggesting the variant is de novo in the probands mother but no DNA was available for testing). In vitro functional assays showed the variant (Cx40-Q58L) impairs gap junction formation at cell-cell interfaces. PMID: 36352534 - a VUS p.(Arg316His) was identified in a case with idiopathic atrioventricular conduction disease. 49 hets in gnomAD v4. Sources: NHS GMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | UBE2B |
Jasmine Chew changed review comment from: i) PMID: 23378580 (2013)- Identified nine splicing, four missense and two nonsense alterations in unrelated oligospermic patients, majority are heterozygous, only 3 were homozygous. Their findings suggested that two distinct molecular mechanisms, mRNA editing and splicing processing, were disrupted in oligozoospermia. ii) PMID: 26223869 (2015): reported four known and novel heterozygous variants in idiopathic azoospermia (IA) patient in the Chinese pop, and one of the missense variant was demonstrated to inhibit the transcriptional regulation activity of SP1 transcription factor, suggesting that it confers a high risk for IA. iii) PMID: 12784252 (2003)- Ube2b(-/-) mice were shown to present male infertility and their sperm head shape anomalies suggested that Ube2b may be involved in the replacement of nuclear proteins during spermatid chromatin condensation. Sources: Literature; to: i) PMID: 23378580 (2013)- Identified nine splicing, four missense and two nonsense alterations in unrelated oligospermic patients, majority are heterozygous, only 3 were homozygous. Their findings suggested that two distinct molecular mechanisms, mRNA editing and splicing processing, were disrupted in oligozoospermia. ii) PMID: 26223869 (2015): Reported four known and novel heterozygous variants in idiopathic azoospermia (IA) patients in the Chinese population, and one of the missense variant was demonstrated to inhibit the transcriptional regulation activity of SP1 transcription factor, suggesting that it confers a high risk for IA. iii) PMID: 12784252 (2003)- Ube2b(-/-) mice were shown to present male infertility and their sperm head shape anomalies suggested that Ube2b may be involved in the replacement of nuclear proteins during spermatid chromatin condensation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | UBE2B | Jasmine Chew edited their review of gene: UBE2B: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | UBE2B |
Jasmine Chew changed review comment from: i) PMID: 23378580 (2013)- identified nine splicing, four missense and two nonsense alterations in unrelated oligospermic patients, majority are heterozygous, only 3 were homozygous. ii) PMID: 26223869 (2015): reported four known and novel heterozygous variants in idiopathic azoospermia (IA) patient in the Chinese pop, and one of the missense variant was demonstrated to inhibit the transcriptional regulation activity of SP1 transcription factor, suggesting that it confers a high risk for IA. iii) PMID: 12784252 (2003)- Ube2b(-/-) mice were shown to present male infertility and their sperm head shape anomalies suggested that Ube2b may be involved in the replacement of nuclear proteins during spermatid chromatin condensation. Sources: Literature; to: i) PMID: 23378580 (2013)- Identified nine splicing, four missense and two nonsense alterations in unrelated oligospermic patients, majority are heterozygous, only 3 were homozygous. Their findings suggested that two distinct molecular mechanisms, mRNA editing and splicing processing, were disrupted in oligozoospermia. ii) PMID: 26223869 (2015): reported four known and novel heterozygous variants in idiopathic azoospermia (IA) patient in the Chinese pop, and one of the missense variant was demonstrated to inhibit the transcriptional regulation activity of SP1 transcription factor, suggesting that it confers a high risk for IA. iii) PMID: 12784252 (2003)- Ube2b(-/-) mice were shown to present male infertility and their sperm head shape anomalies suggested that Ube2b may be involved in the replacement of nuclear proteins during spermatid chromatin condensation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | UBE2B |
Jasmine Chew gene: UBE2B was added gene: UBE2B was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: UBE2B was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: UBE2B were set to 23378580; 26223869; 12784252 Phenotypes for gene: UBE2B were set to Male infertility, MONDO:0005372 Added comment: i) PMID: 23378580 (2013)- identified nine splicing, four missense and two nonsense alterations in unrelated oligospermic patients, majority are heterozygous, only 3 were homozygous. ii) PMID: 26223869 (2015): reported four known and novel heterozygous variants in idiopathic azoospermia (IA) patient in the Chinese pop, and one of the missense variant was demonstrated to inhibit the transcriptional regulation activity of SP1 transcription factor, suggesting that it confers a high risk for IA. iii) PMID: 12784252 (2003)- Ube2b(-/-) mice were shown to present male infertility and their sperm head shape anomalies suggested that Ube2b may be involved in the replacement of nuclear proteins during spermatid chromatin condensation. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | DNAH8 |
Jasmine Chew gene: DNAH8 was added gene: DNAH8 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAH8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH8 were set to 32619401; 32681648; 36308074; 33704367 Phenotypes for gene: DNAH8 were set to Spermatogenic failure 46, MIM# 619095 Review for gene: DNAH8 was set to GREEN Added comment: Literature in OMIM- PMID: 32619401;32681648- multiple cases with multiple morphologic abnormalities of the sperm flagella (MMAF) carrying biallelic variants New papers: i) PMID: 36308074- A novel homozygous frameshift variant in DNAH8 causes MMAF in a consanguineous Pakistani family. Reverse transcription-polymerase chain reaction (RT-PCR) confirmed DNAH8 mRNA decay in these patients with the DNAH8 variant. Hematoxylin-eosin staining and transmission electron microscopy revealed highly divergent morphology and ultrastructure of sperm flagella in these patients. Immunofluorescence assay also showed the absence of DNAH8 and a reduction in its associated protein DNAH17 in the patients' spermatozoa. ii) PMID: 33704367- Two unrelated infertile Chinese patients with MMAF carrying different compound heterozygous variants. Immunofluorescence assay showed that DNAH8 protein expression was significantly decreased in the sperm tail of the patients, and electron microscopy exhibited an abnormal flagellum ultrastructure, while clinical pregnancy could be achieved by intracytoplasmic sperm injection. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | DNAH1 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID: 24360805, 27798045, 27573432, 28552195, 28577616, 29449551- multiple unrelated cases with multiple morphological abnormalities of the sperm flagella (MMAF) Sources: Literature; to: Literature in OMIM- PMID: 24360805, 27798045, 27573432, 28552195, 28577616, 29449551- multiple unrelated cases with multiple morphological abnormalities of the sperm flagella (MMAF) carrying biallelic variants Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | DNAH1 |
Jasmine Chew gene: DNAH1 was added gene: DNAH1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DNAH1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DNAH1 were set to 24360805; 27798045; 27573432; 28552195; 28577616; 29449551 Phenotypes for gene: DNAH1 were set to Spermatogenic failure 18 , MIM# 617576 Review for gene: DNAH1 was set to GREEN Added comment: Literature in OMIM- PMID: 24360805, 27798045, 27573432, 28552195, 28577616, 29449551- multiple unrelated cases with multiple morphological abnormalities of the sperm flagella (MMAF) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | DHH |
Jasmine Chew gene: DHH was added gene: DHH was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DHH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DHH were set to 25927242; 28589169; 28708305; 29471294; 40176231 Phenotypes for gene: DHH were set to 46XY gonadal dysgenesis with minifascicular neuropathy, MIM# 607080 Review for gene: DHH was set to GREEN Added comment: Literature in OMIM- PubMed: 25927242; 28589169; 28708305; 29471294- biallelic variants in affected women with primary amenorrhea, also one woman from PMID:29471294 had 2 uneventful pregnancies. New paper: PMID: 40176231-novel homozygous missense variant (P. Ser185Pro) in an Indian female with primary amenorrhea and severe motor and sensory neuropathy with Charcot's joints. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | CPEB1 |
Jasmine Chew changed review comment from: i) PMID: 32354341 (2020)- heterozygous deletion of exons 8-12 in a Chinese patient with primary amenorrhea. ii) PMID: 33095795 (2020)- heterozygous 83.8-kb deletion (in the similar region reported previously) and a heterozygous missense variant (p.R87C) reported in two Brazilian female with POI (POI-4, POI-14). iii) PMID: 27003306 (2016)- identified three POI patients carrying overlapping microdeletions disrupting CPEB1, which is the only gene known to be involved in reproduction in the deleted regions. Also suggested given that CEPB1 is located in a chromosomal region containing LCRs, the involvement of this gene in POI can be hypothesized to be related to microdeletions in the 15q25.2 region rather than to CPEB1 variants. iv) PMID: 21256485 (2011)- POF-87 with novel heterozygous microdeletion including CPEB1 (1.67 Mb del including the entire CPEB1). Sources: Literature; to: i) PMID: 32354341 (2020)- heterozygous deletion of exons 8-12 in a Chinese patient with primary amenorrhea. ii) PMID: 33095795 (2020)- heterozygous 83.8-kb deletion (in the similar region reported previously) and a heterozygous missense variant (p.R87C) reported in two Brazilian female with POI (POI-4, POI-14). iii) PMID: 27003306 (2016)- identified three POI patients carrying overlapping microdeletions disrupting CPEB1, which is the only gene known to be involved in reproduction in the deleted regions. Also suggested given that CEPB1 is located in a chromosomal region containing LCRs, the involvement of this gene in POI can be hypothesized to be related to microdeletions in the 15q25.2 region rather than to CPEB1 variants. iv) PMID: 21256485 (2011)- POF-87 with novel heterozygous microdeletion including CPEB1 (1.67 Mb del including the entire CPEB1). Note: CPEB1 dosage sensitivity curation pending review Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | CPEB1 |
Jasmine Chew gene: CPEB1 was added gene: CPEB1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CPEB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CPEB1 were set to 21256485; 27003306; 33095795; 32354341 Phenotypes for gene: CPEB1 were set to Primary ovarian insufficiency, MONDO:0005387 Review for gene: CPEB1 was set to GREEN Added comment: i) PMID: 32354341 (2020)- heterozygous deletion of exons 8-12 in a Chinese patient with primary amenorrhea. ii) PMID: 33095795 (2020)- heterozygous 83.8-kb deletion (in the similar region reported previously) and a heterozygous missense variant (p.R87C) reported in two Brazilian female with POI (POI-4, POI-14). iii) PMID: 27003306 (2016)- identified three POI patients carrying overlapping microdeletions disrupting CPEB1, which is the only gene known to be involved in reproduction in the deleted regions. Also suggested given that CEPB1 is located in a chromosomal region containing LCRs, the involvement of this gene in POI can be hypothesized to be related to microdeletions in the 15q25.2 region rather than to CPEB1 variants. iv) PMID: 21256485 (2011)- POF-87 with novel heterozygous microdeletion including CPEB1 (1.67 Mb del including the entire CPEB1). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | CFTR |
Jasmine Chew gene: CFTR was added gene: CFTR was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CFTR was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CFTR were set to 30214069; 40169970; 39592508; 39356031 Phenotypes for gene: CFTR were set to Congenital bilateral absence of vas deferens, MIM# 277180 Review for gene: CFTR was set to GREEN Added comment: OMIM- Found in more than 25% of men with obstructive azoospermia, involving a complete or partial defect of the Wolffian duct derivatives; PMID: 30214069 New case reports- PMID: 40169970; 39592508; 39356031 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AMHR2 |
Jasmine Chew gene: AMHR2 was added gene: AMHR2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: AMHR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AMHR2 were set to 7493017; 8872466; 19457927; 35052499; 33025551; 34480531 Phenotypes for gene: AMHR2 were set to Persistent Mullerian duct syndrome, type I, MIM #261550 Review for gene: AMHR2 was set to GREEN Added comment: Literature in OMIM- PMID: 7493017; 8872466;19457927 New papers: i) PMID: 35052499- compound heterozygous variants in case 2 and case 3 with azoospermia/oligospermia. ii) PMID: 33025551- seven different variants identified in 11 cases from six unrelated Turkish families with PMDS (didn't mention if they were infertile). iii) PMID: 34480531- compound heterozygous variants of c.1387C>T (p.R463C) and c.1219C>T (p.R407X) in exons 9 and 10, respectively, in two brothers who had a history of bilateral cryptorchidism with orchidopexy as well as infertility due to azoospermia. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AMH |
Jasmine Chew changed review comment from: Literature in OMIM- PMID: 2023927;1483695;11760020 New papers: i) PMID: 39889328 - novel homozygous missense p.Pro550Leu in a Tuscinian man with primary infertilitydue to Persistent Müllerian duct syndrome and biopsy revealed no spermatozoa ii) PMID: 35052499- homozygous 4-bp deletion; c.321_324del:p.Q109Lfs*29 in exon 1 in case 1 with non-obstructive azoospermia, leading to the loss of function of AMH. ; to: Literature in OMIM- PMID: 2023927;1483695;11760020 New papers: i) PMID: 39889328 - novel homozygous missense p.Pro550Leu in a Tuscinian man with primary infertility due to Persistent Müllerian duct syndrome and biopsy revealed no spermatozoa. ii) PMID: 35052499- homozygous 4-bp deletion; c.321_324del:p.Q109Lfs*29 in exon 1 in case 1 with non-obstructive azoospermia, leading to the loss of function of AMH. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AMH |
Jasmine Chew changed review comment from: Literature in OMIM- PMID: 2023927;1483695;11760020 New papers: i) PMID: 39889328 - novel homozygous missense p.Pro550Leu in a Tuscinian man with primary infertilitydue to Persistent Müllerian duct syndrome and biopsy revealed no spermatozoa ii) PMID: 35052499- case 1 with non-obstructive azoospermia carrying homozygous 4-bp deletion; c.321_324del:p.Q109Lfs*29 in exon 1 of AMH, leading to the loss of function of AMH. Sources: Literature; to: Literature in OMIM- PMID: 2023927;1483695;11760020 New papers: i) PMID: 39889328 - novel homozygous missense p.Pro550Leu in a Tuscinian man with primary infertilitydue to Persistent Müllerian duct syndrome and biopsy revealed no spermatozoa ii) PMID: 35052499- homozygous 4-bp deletion; c.321_324del:p.Q109Lfs*29 in exon 1 in case 1 with non-obstructive azoospermia, leading to the loss of function of AMH. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AMH |
Jasmine Chew gene: AMH was added gene: AMH was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: AMH was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AMH were set to 2023927; 1483695; 11760020; 39889328; 35052499 Phenotypes for gene: AMH were set to Persistent Mullerian duct syndrome, type I, MIM# 261550 Review for gene: AMH was set to GREEN Added comment: Literature in OMIM- PMID: 2023927;1483695;11760020 New papers: i) PMID: 39889328 - novel homozygous missense p.Pro550Leu in a Tuscinian man with primary infertilitydue to Persistent Müllerian duct syndrome and biopsy revealed no spermatozoa ii) PMID: 35052499- case 1 with non-obstructive azoospermia carrying homozygous 4-bp deletion; c.321_324del:p.Q109Lfs*29 in exon 1 of AMH, leading to the loss of function of AMH. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AARS2 | Jasmine Chew edited their review of gene: AARS2: Changed phenotypes: Progressive leukoencephalopathy with ovarian failure, MIM# 615889 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | AARS2 |
Jasmine Chew gene: AARS2 was added gene: AARS2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AARS2 were set to 24808023; 32775515; 31280959; 29749055 Phenotypes for gene: AARS2 were set to Leukoencephalopathy, progressive, with ovarian failure, MIM# 615889 Review for gene: AARS2 was set to GREEN Added comment: Literature in OMIM- PMID:24808023- compound heterozygous missense variants in 5 women with premature ovarian failure among 6 with progressive leukoencephalopathy, and studies of the yeast homologs of 2 variants (F50C and R521X) showed that they resulted in a complete or partial loss of protein function. New papers- case reports of biallelic variants in patients with POIPOF - PMID:32775515; 31280959; 29749055 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NUP107 | Karina Sandoval reviewed gene: NUP107: Rating: GREEN; Mode of pathogenicity: None; Publications: 28280135, 28117080, 30179222, 25558065, 26411495; Phenotypes: Galloway-Mowat syndrome 7, MIM#618348, Nephrotic syndrome, type 11, MIM#616730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NR0B1 | Karina Sandoval reviewed gene: NR0B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 19508677, 26030781; Phenotypes: Adrenal hypoplasia, congenital, MIM#300200; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | NDUFV2 | Karina Sandoval reviewed gene: NDUFV2: Rating: GREEN; Mode of pathogenicity: None; Publications: 33811136, 34405929, 12754703, 26008862, 30770271, 19167255; Phenotypes: Mitochondrial complex I deficiency, nuclear type 7, MIM#618229, MONDO:0044970; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | MAPKBP1 | Karina Sandoval reviewed gene: MAPKBP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28089251, 33623699, 32505465, 32055034; Phenotypes: Nephronophthisis 20, MIM# 617271, MONDO:0014997; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.125 | ATP11A | Bryony Thompson Marked gene: ATP11A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.125 | ATP11A | Bryony Thompson Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.125 | ATP11A | Bryony Thompson Classified gene: ATP11A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.125 | ATP11A | Bryony Thompson Gene: atp11a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.320 | ATP11A | Bryony Thompson Publications for gene: ATP11A were set to PMID: 34403372 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.319 | ATP11A | Bryony Thompson Classified gene: ATP11A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.319 | ATP11A | Bryony Thompson Gene: atp11a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.134 | TRPM4 | Bryony Thompson Publications for gene: TRPM4 were set to 30528822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.133 | TRPM4 | Bryony Thompson Classified gene: TRPM4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.133 | TRPM4 | Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.132 | TRPM4 | Bryony Thompson reviewed gene: TRPM4: Rating: AMBER; Mode of pathogenicity: Other; Publications: 30528822, 36341417, 35796031; Phenotypes: erythrokeratodermia variabilis MONDO:0017851; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.33 | TRPM4 | Bryony Thompson Marked gene: TRPM4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.33 | TRPM4 | Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.33 | TRPM4 | Bryony Thompson Classified gene: TRPM4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.33 | TRPM4 | Bryony Thompson Gene: trpm4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.32 | TRPM4 |
Bryony Thompson gene: TRPM4 was added gene: TRPM4 was added to Cardiac conduction disease. Sources: NHS GMS Mode of inheritance for gene: TRPM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TRPM4 were set to 19726882; 26820365; 21887725; 32681584; 20562447; 25531103; 27207958; 29568272; 29748318; 36352534; 35205305 Phenotypes for gene: TRPM4 were set to progressive familial heart block type IB MONDO:0011474 Mode of pathogenicity for gene: TRPM4 was set to Other Review for gene: TRPM4 was set to AMBER Added comment: A lot of the originally reported variants are more common in gnomAD than is expected for a dominant condition. However, there are at least 2 families that have decent segregation evidence and that suggest gain of function is the mechanism of disease. Loss of function variants are common in gnomAD. Publications that contribute to gene-disease association: PMID: 19726882 - linkage analysis in a large South African Afrikaner family with progressive familial heart block identified linkage to chromosomal locus 19q13.3. p.E7K was found to segregate with PFHB in the family. The variant was found to lead to a gain of function. The variant is rare in gnomAD v4 - 2 hets. PMID: 26820365 - identified 13 “rare” TRPM4 variants in 95 unrelated patients with progressive cardiac conduction disease (PCCD). Some of the variants are a bit too common in gnomAD to be associated with dominant disease. One of the variants (p.Ile376Thr - 3 hets in gnomAD v4) segregated with PCCD in a large French 4-generation pedigree. TRPM4-p.I376T results in an increased current density in patch-clamp assays & augmented TRPM4 channel expression at the cell surface. PMID: 21887725 - 8 “rare” TRPM4 variants identified in 160 cases with cardiac conduction disturbances. 3 of the variants had some supporting segregation evidence (Y790H - 3 segs, P970S - 1 seg, K914R - 1 seg) PMID: 32681584 - in vitro functional assays on K914R which demonstrate a gain of function Publications with uncertainty: PMID: 20562447 - 3 families with dominant isolated cardiac conduction blocks were used for linkage analysis and a genomic interval on the long arm of chromosome 19 in an interval of ~300 genes. Screened 12 genes. TRPM4 p.Ala432Thr (L1 family), p.Arg164Trp (F1 family), p.Gly844Asp (F2 family). Ala432Thr and Gly844Asp are too common in gnomAD for a Mendelian AD disease (see below). Incomplete penetrance for p.Arg164Trp in family F1. All 3 variants increased current density in patch-clamp assays compared to WT (p<0.05). PMID: 25531103 - null mouse model has cardiac hypertrophy and electrophysiological alterations PMID: 27207958 - “rare” missense variants identified in children with atrioventricular block. Asp198Gly (2 hets in gnomAD v4), Ala432Thr/Gly582Ser present in 2 families (A432T - 558 alleles, 5 homs; G582S - 604 alleles, 7 homs in gnomAD v4) and also carried variants in SCN5 & NKX2.5, Thr677Ile (1 het in gnomAD v4), Val921Ile (101 alleles, 1 hom in gnomAD v4). Ala432Thr/Gly582Ser demonstrated loss of function in patch clamp assay - A432T alone was LoF, while G582S alone was GoF. D198G, T677I, and V921I didn’t alter function in the assays PMID: 29568272 - p.A101T (3299 alleles, 51 homs), p.Q854R (1610 alleles, 5 homs), p.S1044C (7 hets), p.A101T/P1204L (5013 alleles, 11 homs). In patch-clamp assays, all variants reduced current except Q854R which increased the current (GoF) PMID: 29748318 - synonymous variant c.858G>A shown to lead to exon 7 skipping, expected to cause loss of function identified in 2 siblings with cardiac conduction defects. It was inherited from apparently unaffected mother PMID: 36352534, 35205305 - both report TRPM4 c.2351G>A, p.Gly844Asp in association with conduction disease. However, the variant is highly prevalent in gnomAD v4 (2200 alleles, 1 homozygote) Sources: NHS GMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.31 | TBX5 | Bryony Thompson Marked gene: TBX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.31 | TBX5 | Bryony Thompson Gene: tbx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.31 | TBX5 | Bryony Thompson Classified gene: TBX5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.31 | TBX5 | Bryony Thompson Gene: tbx5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.30 | TBX5 |
Bryony Thompson gene: TBX5 was added gene: TBX5 was added to Cardiac conduction disease. Sources: NHS GMS Mode of inheritance for gene: TBX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: TBX5 were set to 20301290 Phenotypes for gene: TBX5 were set to Holt-Oram syndrome MONDO:0007732 Review for gene: TBX5 was set to GREEN gene: TBX5 was marked as current diagnostic Added comment: Conduction disease is a characteristic feature of the condition. Sources: NHS GMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.29 | SCN1B | Bryony Thompson Marked gene: SCN1B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.29 | SCN1B | Bryony Thompson Gene: scn1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.29 | SCN1B | Bryony Thompson Classified gene: SCN1B as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.29 | SCN1B | Bryony Thompson Gene: scn1b has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiac conduction disease v0.28 | SCN1B |
Bryony Thompson gene: SCN1B was added gene: SCN1B was added to Cardiac conduction disease. Sources: NHS GMS Mode of inheritance for gene: SCN1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SCN1B were set to 19808477; 18464934; 28878239; 29758173 Phenotypes for gene: SCN1B were set to Heart conduction disease MONDO:0000992 Review for gene: SCN1B was set to AMBER Added comment: This gene is disputed for Brugada syndrome. There is a single family reported with decent segregation evidence of a missense variant (p.Glu87Gln) with conduction disease, and another missense that has been reported in a case with AF, that has been reported as pathogenic for epilepsy. PMID: 19808477 - R85H (8 hets in gnomAD v4) identified in a case with atrial fibrillation. This variant has also been reported in patients with GEFS and is reported LP/P in ClinVar. D153N (277 hets in gnomAD v4) also identified in a case with AF, but the variant is classified as a VUS. PMID: 18464934 - Glu87Gln (3 hets in gnomAD v4) identified in a Turkish family with 2 siblings with conduction abnormalities, inherited from mother with no cardiac phenotype (later determined to have clinical atrioventricular nodal reentry tachycardia in PMID: 29758173). c.536G>A Trp179Ter in beta1B transcript (NM_001037.5:c.448+88G>A - 44 hets gnomAD v4) identified in a family with conduction disease (3 affected cases & 1 unaffected individual). c.537G>A p.Trp179Ter (NM_001037.5(SCN1B):c.448+89G>A - 1 het in gnomAD v4) identified in fam 3 - 1 affected case & 1 unaffected individual. Haploinsufficiency is the suggested mechanism of disease supported by electrophysiologic data. PMID: 28878239 - in vitro functional assays suggesting Glu87Gln reduces sodium channel function. PMID: 29758173 - study suggesting p.Trp179Ter is not associated with disease, but has updated information for the Turkish family with p.Glu87Gln strengthening the segregation of the variant with conduction disease Sources: NHS GMS |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | ATP11A |
Sangavi Sivagnanasundram changed review comment from: PMID: 39432785 (upgraded to GREEN on leukodystrophy panel) 3 unrelated probands with variable neurological features presenting in childhood however only two presented with leukodystrophy like symptoms Patient 1 (canadian) and 3 (USA) showed bilateral hypomyelination on brain MRI PMID: 40185629 - refractory focal epilepsy (AMBER for epilepsy) chinese probands - childhood cases De novo missense variants were identified in the two unrelated probands of chinese descent Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys; to: PMID: 39432785 (upgraded to GREEN on leukodystrophy panel) 3 unrelated probands with variable neurological features presenting in childhood however only two presented with leukodystrophy like symptoms Patient 1 (canadian) and 3 (USA) showed bilateral hypomyelination on brain MRI PMID: 40185629 - Two chinese individuals reported with refractory focal epilepsy (AMBER for epilepsy) De novo missense variants were identified in the two unrelated probands of chinese descent Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v1.124 | ATP11A |
Sangavi Sivagnanasundram gene: ATP11A was added gene: ATP11A was added to Genetic Epilepsy. Sources: Other Mode of inheritance for gene: ATP11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ATP11A were set to 40185629 Phenotypes for gene: ATP11A were set to Focal Epilepsy MONDO:0005384 Review for gene: ATP11A was set to AMBER Added comment: PMID: 40185629 - Two chinese individuals reported with refractory focal epilepsy De novo missense variants were identified in the two unrelated probands of chinese descent Case 1 - female patient experiencing epileptic seizures from the age of 4 - Lys812Ile Case 2 - male patient experienceing epileptic seizures from the age of 7 - Trp1036Cys Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | ATP11A | Sangavi Sivagnanasundram reviewed gene: ATP11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39432785, 40185629; Phenotypes: leukodystrophy, hypomyelinating, 24, MONDO:0859242, Focal epilepsy MONDO:0005384; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Leukodystrophy v0.318 | ATP11A | Sangavi Sivagnanasundram reviewed gene: ATP11A: Rating: GREEN; Mode of pathogenicity: None; Publications: 39432785; Phenotypes: leukodystrophy, hypomyelinating, 24, MONDO:0859242; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.17 | AP5B1 | Bryony Thompson Marked gene: AP5B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.17 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.17 | AP5B1 | Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.17 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.16 | AP5B1 |
Bryony Thompson gene: AP5B1 was added gene: AP5B1 was added to Lysosomal Storage Disorder. Sources: Literature Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5B1 were set to 40081374 Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5B1 was set to AMBER Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. The AP-5 complex containing AP5Z1, AP5M1, and AP5B1, is integral to lysosome function. AP-5 deficiency results in the accumulation of aberrant endolysosomes, which is a lysosome storage disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.51 | AP5B1 | Bryony Thompson Marked gene: AP5B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.51 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.51 | AP5B1 | Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.51 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | AP5B1 | Bryony Thompson Marked gene: AP5B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | AP5B1 | Bryony Thompson Classified gene: AP5B1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2443 | AP5B1 | Bryony Thompson Gene: ap5b1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.50 | AP5B1 |
Bryony Thompson gene: AP5B1 was added gene: AP5B1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5B1 were set to 40081374 Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5B1 was set to AMBER Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2442 | AP5B1 |
Bryony Thompson gene: AP5B1 was added gene: AP5B1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: AP5B1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5B1 were set to 40081374 Phenotypes for gene: AP5B1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5B1 was set to AMBER Added comment: Currently only 2 unrelated cases with macular dystrophy (1 hom & 1 chet). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2441 | AP5M1 | Bryony Thompson Marked gene: AP5M1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2441 | AP5M1 | Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.15 | AP5M1 | Bryony Thompson Classified gene: AP5M1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.15 | AP5M1 | Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.14 | AP5M1 |
Bryony Thompson gene: AP5M1 was added gene: AP5M1 was added to Lysosomal Storage Disorder. Sources: Literature Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5M1 were set to 40081374 Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5M1 was set to GREEN Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. The AP-5 complex containing AP5Z1, AP5M1, and AP5B1, is integral to lysosome function. AP-5 deficiency results in the accumulation of aberrant endolysosomes, which is a lysosome storage disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.13 | AP5Z1 | Bryony Thompson Marked gene: AP5Z1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.13 | AP5Z1 | Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lysosomal Storage Disorder v1.13 | AP5Z1 | Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081374, 29381698, 26085577; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.49 | AP5M1 | Bryony Thompson Marked gene: AP5M1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.49 | AP5M1 | Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.49 | AP5M1 | Bryony Thompson Classified gene: AP5M1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.49 | AP5M1 | Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.48 | AP5M1 |
Bryony Thompson gene: AP5M1 was added gene: AP5M1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5M1 were set to 40081374 Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5M1 was set to GREEN Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2441 | AP5M1 | Bryony Thompson Classified gene: AP5M1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2441 | AP5M1 | Bryony Thompson Gene: ap5m1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2440 | AP5M1 |
Bryony Thompson gene: AP5M1 was added gene: AP5M1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: AP5M1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5M1 were set to 40081374 Phenotypes for gene: AP5M1 were set to Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related Review for gene: AP5M1 was set to GREEN Added comment: 3 unrelated cases with macular dystrophy and homozygous variants (2x nonsense & a missense). The study also presents sufficient evidence for an association of another AP-5 complex gene (AP5Z1) with macular dystrophy. AP-5 complex proteins (AP5Z1, AP5M1, and AP5B1) display punctate localization in human RPE explants. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2439 | AP5Z1 | Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 40081374, 33543803; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647, MONDO:0013342, Hereditary macular dystrophy MONDO:0020242; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.47 | AP5Z1 | Bryony Thompson Marked gene: AP5Z1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.47 | AP5Z1 | Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.47 | AP5Z1 | Bryony Thompson Classified gene: AP5Z1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.47 | AP5Z1 | Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Macular Dystrophy/Stargardt Disease v0.46 | AP5Z1 |
Bryony Thompson gene: AP5Z1 was added gene: AP5Z1 was added to Macular Dystrophy/Stargardt Disease. Sources: Literature Mode of inheritance for gene: AP5Z1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AP5Z1 were set to 40081374 Phenotypes for gene: AP5Z1 were set to Hereditary macular dystrophy MONDO:0020242 Review for gene: AP5Z1 was set to GREEN gene: AP5Z1 was marked as current diagnostic Added comment: 14 families reported with biallelic variants in AP5Z1 with mainly adult-onset macular dystrophy, isolated or with extraocular features (including Parkinsonism, mild ID, HSP, peripheral neuropathy, hearing loss). The authors' suggest that macular dystrophy could be a presenting feature before HSP (or other extraocular features). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.90 | AP5Z1 | Bryony Thompson Classified gene: AP5Z1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.90 | AP5Z1 | Bryony Thompson Gene: ap5z1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hereditary Spastic Paraplegia v1.89 | AP5Z1 | Bryony Thompson reviewed gene: AP5Z1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39059408, 26085577, 33543803; Phenotypes: Spastic paraplegia 48, autosomal recessive, MIM# 613647; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.439 | KCTD10 | Bryony Thompson Classified gene: KCTD10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.439 | KCTD10 | Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.438 | KCTD10 | Bryony Thompson Classified gene: KCTD10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.438 | KCTD10 | Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.437 | KCTD10 | Bryony Thompson Marked gene: KCTD10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.437 | KCTD10 | Bryony Thompson Gene: kctd10 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2439 | KCTD10 | Bryony Thompson Marked gene: KCTD10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2439 | KCTD10 | Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.437 | KCTD10 |
Bryony Thompson gene: KCTD10 was added gene: KCTD10 was added to Congenital Heart Defect. Sources: Literature Mode of inheritance for gene: KCTD10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCTD10 were set to 24705121; 24430697; 38489388; 40121532 Phenotypes for gene: KCTD10 were set to multiple congenital anomalies/dysmorphic syndrome MONDO:0019042, KCTD10-related Review for gene: KCTD10 was set to GREEN Added comment: Two unrelated probands with multiple congenital anomalies, both with abnormalities of the cardiovascular system and confirmed de novo novel missense variants (p.R248Q and p.N169S). There were also additional individuals (<5) in the GeneDx in-house database who didn’t consent to case-level publication with confirmed de novo missesne variants in KCTD10 and overlapping phenotypes (100% with abnormalities of the cardiovascular system). Other congenital anomalies of different organs systems were present in 33-67% of the individuals. Further elucidation of the phenotypes associated with this gene are required. Additionally, null mouse and zebrafish models suggest Kctd10 is critical for cardiovascular development and is involved in the regulation of brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2439 | KCTD10 | Bryony Thompson Classified gene: KCTD10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2439 | KCTD10 | Bryony Thompson Gene: kctd10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2438 | KCTD10 |
Bryony Thompson gene: KCTD10 was added gene: KCTD10 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: KCTD10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KCTD10 were set to 24705121; 24430697; 38489388; 40121532 Phenotypes for gene: KCTD10 were set to multiple congenital anomalies/dysmorphic syndrome MONDO:0019042, KCTD10-related Review for gene: KCTD10 was set to GREEN Added comment: Two unrelated probands with multiple congenital anomalies, both with abnormalities of the cardiovascular system and confirmed de novo novel missense variants (p.R248Q and p.N169S). There were also additional individuals (<5) in the GeneDx in-house database who didn’t consent to case-level publication with confirmed de novo missesne variants in KCTD10 and overlapping phenotypes (100% with abnormalities of the cardiovascular system). Other congenital anomalies of different organs systems were present in 33-67% of the individuals. Further elucidation of the phenotypes associated with this gene are required. Additionally, null mouse and zebrafish models suggest Kctd10 is critical for cardiovascular development and is involved in the regulation of brain development. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2437 | ATP6V1B1 | Sarah Leigh reviewed gene: ATP6V1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 39837581, 9916796, 12566520, 18798332; Phenotypes: Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM#267300; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | COL11A2 | Melanie Marty edited their review of gene: COL11A2: Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | COL11A2 |
Melanie Marty changed review comment from: The gene-disease association with otospondylomegaepiphyseal dysplasia is well established (DEFINITIVE) by ClinGen, and deafness is part of the phenotype, both mono-allelic and bi-allelic variants are reported. Otospondylomegaepiphyseal dysplasia AD (OSMED, MIM#184840) is also known as non-ocular Stickler syndrome or Type III Stickler syndrome. There are also a number of reports of mono-allelic and bi-allelic variants associated with isolated deafness (PMIDs: 10581026;25633957;16033917), and rated as MODERATE by ClinGen for AR and DEFINITIVE for AD. Bi-allelic variants are associated with severe pre lingual deafness. Fibrochondrogenesis 2 a severe skeletal dysplasia is associated with AD and AR.; to: The gene-disease association with otospondylomegaepiphyseal dysplasia is well established (DEFINITIVE) by ClinGen, and deafness is part of the phenotype, both mono-allelic and bi-allelic variants are reported. Otospondylomegaepiphyseal dysplasia AD (OSMED, MIM#184840) is also known as non-ocular Stickler syndrome or Type III Stickler syndrome. There are also a number of reports of mono-allelic and bi-allelic variants associated with isolated deafness (PMIDs: 10581026;25633957;16033917), and rated as MODERATE by ClinGen for AR and DEFINITIVE for AD. Bi-allelic variants are associated with severe pre lingual deafness. Fibrochondrogenesis 2 a severe skeletal dysplasia is associated with AD and AR. Only including the AR phenotypes for this screening panel. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | COL11A2 | Melanie Marty reviewed gene: COL11A2: Rating: GREEN; Mode of pathogenicity: None; Publications: 10581026, 25633957, 16033917, 25240749, 22796475, 20112039; Phenotypes: Deafness, autosomal recessive 53 MIM#609706, Fibrochondrogenesis 2 MIM#614524, Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2437 | CDKL2 | Zornitza Stark Marked gene: CDKL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2437 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2437 | CDKL2 | Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2437 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2436 | CDKL2 | Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Marked gene: CDKL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Classified gene: CDKL2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.98 | CDKL2 | Zornitza Stark Gene: cdkl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL2 | Zornitza Stark reviewed gene: CDKL2: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL2-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | STAG3 |
Jasmine Chew gene: STAG3 was added gene: STAG3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: STAG3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: STAG3 were set to 24597867; 26059840; 28393351; 30006057; 32634216; 31125047; 31682730 Phenotypes for gene: STAG3 were set to Premature ovarian failure 8, MIM# 615723; Spermatogenic failure 61, MIM# 619672 Added comment: Literature in OMIM (PMID:24597867; 26059840; 28393351;30006057;32634216; 31125047; 31682730)- biallelic missense and LOF variants reported in conjunction with primary ovarian failure and spermatogenic failure New papers reporting biallelic LOF variants for POI- PMID: 34497033; 35503298 New papers reporting biallelic LOF variants for NOA- PMID: 33980954 New papers reporting biallelic LOF variants for both POI and NOA in familial cases- PMID: 39932630; 35176428 Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | ZP2 | Jasmine Chew edited their review of gene: ZP2: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | MSH4 |
Jasmine Chew gene: MSH4 was added gene: MSH4 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MSH4 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MSH4 were set to 28541421; 33448284; 34755185; 33437391; 33448284; 35090489; 34755185; 38175272; 37620942 Phenotypes for gene: MSH4 were set to Premature ovarian failure 20, MIM# 619938; Spermatogenic failure 2, MIM# 108420 Review for gene: MSH4 was set to GREEN Added comment: Literature in OMIM (PMID:28541421;33448284; 34755185;33437391;33448284; 35090489; 34755185)- biallelic LOF and missense variants reported in multiple familial cases with premature ovarian failure and spermatogenic failure/azoospermia New papers: i) PMID: 38175272- novel homozygous nonsense variant ( p.Q40*) in an Iranian family with four affected members consisting of two NOA men with maturation arrest and two women with POI. This variant occurs at the beginning of MSH4 and leads to the formation of a very short chain with 39 residues or complete loss of protein, which it is likely the main reason for the emergence of POI and NOA. Testicular sperm retrieval and ovarian stimulation cycles have not been successful in any of patients. ii) PMID: 37620942- compound heterozygous variants (p.Thr792Ala and p.Lys741Argfs*2) in a woman with diminished ovarian reserve (DOR), presented with poor oocyte quantity and quality, resulting in unsuccessful in vitro fertilization cycles. Bioinformatics and in vitro functional analysis showed that the p.Thr792Ala variant altered the local conformation of the MutS_V domain without decreasing MSH4 protein expression, while the p.Lys741Argfs*2 variant led to a reduction in MSH4 protein expression without impacting splicing. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Marked gene: CDKL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Classified gene: CDKL1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.97 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 | Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2436 | CDKL1 | Zornitza Stark Marked gene: CDKL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2436 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2436 | CDKL1 | Zornitza Stark Classified gene: CDKL1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2436 | CDKL1 | Zornitza Stark Gene: cdkl1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2435 | CDKL1 | Zornitza Stark reviewed gene: CDKL1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder, MONDO:0700092, CDKL1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TRIT1 | Zornitza Stark Marked gene: TRIT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TRIT1 | Zornitza Stark Gene: trit1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1868 | TRIT1 | Zornitza Stark Phenotypes for gene: TRIT1 were changed from Combined oxidative phosphorylation deficiency 35, 617873 (3), Autosomal recessive to Combined oxidative phosphorylation deficiency 35 MIM#617873 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1867 | TRIT1 | Zornitza Stark Publications for gene: TRIT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1866 | NEB | Zornitza Stark Publications for gene: NEB were set to 27228465 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.7 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.7 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.7 | OSGEP | Zornitza Stark Phenotypes for gene: OSGEP were changed from Galloway-Mowat syndrome 3, 617729 (3), Autosomal recessive to Galloway-Mowat syndrome 3, MIM# 617729 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.6 | OSGEP | Zornitza Stark Publications for gene: OSGEP were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1865 | OSTM1 | Zornitza Stark Marked gene: OSTM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1865 | OSTM1 | Zornitza Stark Gene: ostm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1865 | OSTM1 | Zornitza Stark Phenotypes for gene: OSTM1 were changed from Osteopetrosis, autosomal recessive 5, 259720 (3) to Osteopetrosis, autosomal recessive 5, MIM#259720 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1864 | OSTM1 | Zornitza Stark Publications for gene: OSTM1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1863 | OSTM1 | Zornitza Stark reviewed gene: OSTM1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Osteopetrosis, autosomal recessive 5, MIM#259720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1863 | PCDH15 | Zornitza Stark Marked gene: PCDH15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1863 | PCDH15 | Zornitza Stark Gene: pcdh15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1863 | PCDH15 | Zornitza Stark Phenotypes for gene: PCDH15 were changed from Usher syndrome, type 1F, 602083 (3) to Usher syndrome, type 1F, MIM# 602083 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1862 | PCDH15 | Zornitza Stark Publications for gene: PCDH15 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1861 | SLC39A8 | Zornitza Stark Marked gene: SLC39A8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1861 | SLC39A8 | Zornitza Stark Gene: slc39a8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1861 | SLC39A8 | Zornitza Stark Phenotypes for gene: SLC39A8 were changed from Congenital disorder of glycosylation, type IIn, 616721 (3), Autosomal recessive to Congenital disorder of glycosylation, type IIn MIM#616721 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1860 | SLC39A8 | Zornitza Stark Publications for gene: SLC39A8 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1859 | SRD5A3 | Zornitza Stark Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1859 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1859 | SRD5A3 | Zornitza Stark Phenotypes for gene: SRD5A3 were changed from Congenital disorder of glycosylation, type Iq, 612379 (3) to Congenital disorder of glycosylation, type Iq MIM#612379; Kahrizi syndrome#612713; SRD5A3-congenital disorder of glycosylation (MONDO:0012885) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1858 | SRD5A3 | Zornitza Stark Publications for gene: SRD5A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1857 | TBC1D23 | Zornitza Stark Marked gene: TBC1D23 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1857 | TBC1D23 | Zornitza Stark Gene: tbc1d23 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1857 | TBC1D23 | Zornitza Stark Phenotypes for gene: TBC1D23 were changed from Pontocerebellar hypoplasia, type 11, 617695 (3), Autosomal recessive to Pontocerebellar hypoplasia, type 11, MIM#617695 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1856 | TBC1D23 | Zornitza Stark Publications for gene: TBC1D23 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1855 | LRSAM1 | Zornitza Stark Tag for review tag was added to gene: LRSAM1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1855 | TCIRG1 | Zornitza Stark Marked gene: TCIRG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1855 | TCIRG1 | Zornitza Stark Gene: tcirg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1855 | TCIRG1 | Zornitza Stark Phenotypes for gene: TCIRG1 were changed from Osteopetrosis, autosomal recessive 1, 259700 (3) to Osteopetrosis, autosomal recessive 1 MIM#259700 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1854 | TCIRG1 | Zornitza Stark Publications for gene: TCIRG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1853 | PEX7 | Zornitza Stark Marked gene: PEX7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1853 | PEX7 | Zornitza Stark Gene: pex7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1853 | PEX7 | Zornitza Stark Phenotypes for gene: PEX7 were changed from Chondrodysplasia punctata, rhizomelic, type 1, 215100 (3) to Peroxisome biogenesis disorder 9B, MIM# 614879; Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1852 | PEX7 | Zornitza Stark Publications for gene: PEX7 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1851 | PGAP1 | Zornitza Stark Marked gene: PGAP1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1851 | PGAP1 | Zornitza Stark Gene: pgap1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1851 | PGAP1 | Zornitza Stark Phenotypes for gene: PGAP1 were changed from Mental retardation, autosomal recessive 42, 615802 (3), Autosomal recessive to Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1850 | PGAP1 | Zornitza Stark Publications for gene: PGAP1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1849 | POC1A | Zornitza Stark Marked gene: POC1A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1849 | POC1A | Zornitza Stark Gene: poc1a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1849 | POC1A | Zornitza Stark Phenotypes for gene: POC1A were changed from Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, 614813 (3) to Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1848 | POC1A | Zornitza Stark Publications for gene: POC1A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | FSHB | Jasmine Chew edited their review of gene: FSHB: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | FSHB |
Jasmine Chew gene: FSHB was added gene: FSHB was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FSHB was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FSHB were set to 8220432; 8220432; 9624193; 9806482; 12161499 Phenotypes for gene: FSHB were set to Hypogonadotropic hypogonadism 24 without anosmia, MIM# 229070 Added comment: Literature in OMIM (PMID:8220432;8220432;9624193;9806482;12161499)- multiple unrelated infertile women and males with isolated FSH deficiency carrying biallelic LOF variants Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1847 | PPA2 | Zornitza Stark Marked gene: PPA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1847 | PPA2 | Zornitza Stark Gene: ppa2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1847 | PPA2 | Zornitza Stark Phenotypes for gene: PPA2 were changed from Sudden cardiac failure, infantile, 617222 (3), Autosomal recessive to Sudden cardiac failure, infantile, MIM#617222; Sudden cardiac failure, alcohol-induced, MIM#617223 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1846 | PPA2 | Zornitza Stark Publications for gene: PPA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1845 | VPS33B | Zornitza Stark Marked gene: VPS33B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1845 | VPS33B | Zornitza Stark Gene: vps33b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1845 | VPS33B | Zornitza Stark Phenotypes for gene: VPS33B were changed from Arthrogryposis, renal dysfunction, and cholestasis 1, 208085 (3) to Arthrogryposis, renal dysfunction, and cholestasis 1 MIM#208085; Cholestasis, progressive familial intrahepatic, 12 MIM#620010; Keratoderma-ichthyosis-deafness syndrome, autosomal recessive MIM#620009 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1844 | VPS33B | Zornitza Stark Publications for gene: VPS33B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1843 | PRDM12 | Zornitza Stark Marked gene: PRDM12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1843 | PRDM12 | Zornitza Stark Gene: prdm12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1843 | PRDM12 | Zornitza Stark Phenotypes for gene: PRDM12 were changed from Neuropathy, hereditary sensory and autonomic, type VIII, 616488 (3), Autosomal recessive to Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1842 | PRDM12 | Zornitza Stark Publications for gene: PRDM12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1841 | PRX | Zornitza Stark Marked gene: PRX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1841 | PRX | Zornitza Stark Gene: prx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1841 | PRX | Zornitza Stark Phenotypes for gene: PRX were changed from Dejerine-Sottas disease, 145900 (3) to Charcot-Marie-Tooth disease, type 4F, MIM# 614895; Dejerine-Sottas disease, MIM# 145900 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1840 | PRX | Zornitza Stark Publications for gene: PRX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1839 | PUS1 | Zornitza Stark Marked gene: PUS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1839 | PUS1 | Zornitza Stark Gene: pus1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1839 | PUS1 | Zornitza Stark Phenotypes for gene: PUS1 were changed from Mitochondrial myopathy and sideroblastic anemia 1, 600462 (3) to Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1838 | PUS1 | Zornitza Stark Publications for gene: PUS1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1837 | QDPR | Zornitza Stark Marked gene: QDPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1837 | QDPR | Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1837 | QDPR | Zornitza Stark Phenotypes for gene: QDPR were changed from Hyperphenylalaninemia, BH4-deficient, C, 261630 (3) to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1836 | QDPR | Zornitza Stark Publications for gene: QDPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1835 | RAB27A | Zornitza Stark Marked gene: RAB27A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1835 | RAB27A | Zornitza Stark Gene: rab27a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1835 | RAB27A | Zornitza Stark Phenotypes for gene: RAB27A were changed from Griscelli syndrome, type 2, 607624 (3) to Griscelli syndrome, type 2, MIM# 607624 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1834 | RAB27A | Zornitza Stark Publications for gene: RAB27A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1833 | RAD50 | Zornitza Stark Marked gene: RAD50 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1833 | RAD50 | Zornitza Stark Gene: rad50 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1833 | RAD50 | Zornitza Stark Phenotypes for gene: RAD50 were changed from Nijmegen breakage syndrome-like disorder, 613078 (3) to Nijmegen breakage syndrome-like disorder, MIM# 613078 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1832 | RAD50 | Zornitza Stark Publications for gene: RAD50 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1831 | RPGRIP1L | Zornitza Stark Marked gene: RPGRIP1L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1831 | RPGRIP1L | Zornitza Stark Gene: rpgrip1l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1831 | RPGRIP1L | Zornitza Stark Phenotypes for gene: RPGRIP1L were changed from Meckel syndrome 5, 611561 (3) to Joubert syndrome 7, MIM# 611560; Meckel syndrome 5, MIM# 611561; COACH syndrome 3, MIM# 619113; Ciliopathy, RPGRIP1L-related, MONDO:0005308 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1830 | RPGRIP1L | Zornitza Stark Publications for gene: RPGRIP1L were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | FSHR |
Jasmine Chew gene: FSHR was added gene: FSHR was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FSHR was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: FSHR were set to 7553856; 9769327; 11889179; 20087398; 12930927; 12930928; 17721928; 36704038 Phenotypes for gene: FSHR were set to Ovarian dysgenesis 1, MIM# 233300; Ovarian hyperstimulation syndrome, MIM# 608115 Added comment: Literature in OMIM- i) biallelic variants for ovarian dysgenesis, supported by functional evidence- PMID:7553856; 9769327;11889179;20087398 ii) monoallelic variants for ovarian hyperstimulation syndrome- PMID:12930927;12930928;17721928 New paper: i) PMID: 36704038- Novel compound heterozygous variants (Ala462Pro and p.Ala621Val) in a woman with primary ovarian insufficiency with resistant ovary syndrome. In vitro experiments revealed that the p.Ala462Pro variant resulted in barely detectable levels of intracellular signaling both in cAMP-dependent CRE-reporter activity and ERK activation and displayed a severely reduced plasma membrane receptor expression. In contrast, the p.Ala621Val variant resulted in partial loss of receptor activation without disruption of cell surface expression. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1829 | SLC1A4 | Zornitza Stark Marked gene: SLC1A4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1829 | SLC1A4 | Zornitza Stark Gene: slc1a4 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1829 | SLC1A4 | Zornitza Stark Publications for gene: SLC1A4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1828 | ABCB11 | Zornitza Stark Marked gene: ABCB11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1828 | ABCB11 | Zornitza Stark Gene: abcb11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1828 | ABCB11 | Zornitza Stark Phenotypes for gene: ABCB11 were changed from Cholestasis, progressive familial intrahepatic 2, 601847 (3) to Cholestasis, progressive familial intrahepatic 2, MIM# 601847 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1827 | ABCB11 | Zornitza Stark Publications for gene: ABCB11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | FITM2 | Zornitza Stark Tag for review tag was added to gene: FITM2. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | NLRP5 | Zornitza Stark Marked gene: NLRP5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | NLRP5 | Zornitza Stark Classified gene: NLRP5 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.29 | NLRP5 | Zornitza Stark Gene: nlrp5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.28 | HFM1 | Zornitza Stark Marked gene: HFM1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.28 | HFM1 | Zornitza Stark Gene: hfm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.28 | HFM1 | Zornitza Stark Classified gene: HFM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.28 | HFM1 | Zornitza Stark Gene: hfm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.27 | GDF9 | Zornitza Stark Marked gene: GDF9 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.27 | GDF9 | Zornitza Stark Gene: gdf9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.27 | GDF9 | Zornitza Stark Classified gene: GDF9 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.27 | GDF9 | Zornitza Stark Gene: gdf9 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.26 | KHDC3L | Zornitza Stark Marked gene: KHDC3L as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.26 | KHDC3L | Zornitza Stark Gene: khdc3l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.26 | KHDC3L | Zornitza Stark Classified gene: KHDC3L as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.26 | KHDC3L | Zornitza Stark Gene: khdc3l has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | GDF9 |
Jasmine Chew gene: GDF9 was added gene: GDF9 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: GDF9 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: GDF9 were set to 29044499; 33036707; 38643161 Phenotypes for gene: GDF9 were set to Premature ovarian failure 14, MIM# 618014 Review for gene: GDF9 was set to GREEN Added comment: Literature in OMIM- PMID:29044499;33036707 - biallelic variants reported in women with premature ovarian failure, supported by functional evidence New paper: i) PMID: 38643161 (2024)- compound heterozygous variants (Q321X/S428T) in two infertile women with defect in follicle enlargement In vitro experiments confirmed that these variants caused reduction of GDF9 secretion, and/or alleviation in BMP15 binding. Moreover, Q308X/S415T mouse model was constructed, which recapitulated the phenotypes in probands with abnormal estrogen secretion and defected follicle enlargement. n addition, RNA sequencing of granulosa cells revealed the transcriptomic profiles related to defective follicle enlargement in theQ308X/S415T group. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | HFM1 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID:24597873- compound heterozygous variants in a familial case and an unrelated individual with primary ovarian failure New papers (single family with monoallelic variant and expansion of phenotypes in females) i) PMID: 31279343- Novel heterozygous missense variant in HFM1 (c.3470G > A) in the proband and her mother both affected by POI. Minigene splicing assay of the WT and MT constructs revealed that an alternative splicing process were produced with the c.3470G > A variant in mRNA level. ii) PMID: 35881270- novel compound heterozygous variants,c.1978-2A > C and c.2680 + 3_2680 + 4delAT, in two sisters with diminished ovarian reserve and recurrent pregnancy loss (RPL) in natural pregnancy and in vitro fertilization-embryo transfer (IVF-ET). Minigene assay showed that both variants could produce alternative transcripts compared to wild-type counterparts, which might result in protein dysfunction. These results demonstrated that RPL caused by the HFM1 gene might be inherited in AR mode, iii) PMID: 36864181- novel homozygous splicing variant in HFM1 (NM_001017975.6: c.1730-1G > T) in two siblings - female with poor ovarian response and recurrent implantation failure and male with NOA. Minigene assay demonstrated that splicing variants caused abnormal alternative splicing of HFM1. For the sister, she experienced embryo arrest 9 weeks after pregnancy after undergoing 5 cycles of ART. iv) PMID: 39929154- reported compound heterozygous variants c.1978-2A>C and c.2681-3T>A in a case of POI with unique genital characteristics; also their lit review showed that previous studies have linked HFM1 gene variants to clinical manifestations such as POI, diminished ovarian reserve, recurrent pregnancy loss, and poor outcomes in in vitro fertilization-embryo transfer. Sources: Literature; to: Literature in OMIM- PMID:24597873- compound heterozygous variants in a familial case and an unrelated individual with primary ovarian failure New papers (single family with monoallelic variant and expansion of phenotypes in females) i) PMID: 31279343- Novel heterozygous missense variant in HFM1 (c.3470G > A) in the proband and her mother both affected by POI. Minigene splicing assay of the WT and MT constructs revealed that an alternative splicing process were produced with the c.3470G > A variant in mRNA level. ii) PMID: 35881270- novel compound heterozygous variants,c.1978-2A > C and c.2680 + 3_2680 + 4delAT, in two sisters with diminished ovarian reserve and recurrent pregnancy loss (RPL) in natural pregnancy and in vitro fertilization-embryo transfer (IVF-ET). Minigene assay showed that both variants could produce alternative transcripts compared to wild-type counterparts, which might result in protein dysfunction. These results demonstrated that RPL caused by the HFM1 gene might be inherited in AR mode, iii) PMID: 36864181- novel homozygous splicing variant in HFM1 (NM_001017975.6: c.1730-1G > T) in two siblings - female with poor ovarian response and recurrent implantation failure and male with NOA. Minigene assay demonstrated that splicing variants caused abnormal alternative splicing of HFM1. For the sister, she experienced embryo arrest 9 weeks after pregnancy after undergoing 5 cycles of ART. iv) PMID: 39929154- reported compound heterozygous variants c.1978-2A>C and c.2681-3T>A in a case of POI with unique genital characteristics; also their lit review showed that previous studies have linked HFM1 gene variants to clinical manifestations such as POI, diminished ovarian reserve, recurrent pregnancy loss, and poor outcomes in in vitro fertilization-embryo transfer. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | HFM1 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID:24597873- compound heterozygous variants in a familial case and an unrelated individual with primary ovarian failure New papers (single family with monoallelic variant and expansion of phenotypes) i) PMID: 31279343- Novel heterozygous missense variant in HFM1 (c.3470G > A) in the proband and her mother both affected by POI. Minigene splicing assay of the WT and MT constructs revealed that an alternative splicing process were produced with the c.3470G > A variant in mRNA level. ii) PMID: 35881270- novel compound heterozygous variants,c.1978-2A > C and c.2680 + 3_2680 + 4delAT, in two sisters with diminished ovarian reserve and recurrent pregnancy loss (RPL) in natural pregnancy and in vitro fertilization-embryo transfer (IVF-ET). Minigene assay showed that both variants could produce alternative transcripts compared to wild-type counterparts, which might result in protein dysfunction. These results demonstrated that RPL caused by the HFM1 gene might be inherited in AR mode, iii) PMID: 36864181 (2023)- novel homozygous splicing variant in HFM1 (NM_001017975.6: c.1730-1G > T) in two siblings - female with poor ovarian response and recurrent implantation failure and male with NOA. Minigene assay demonstrated that splicing variants caused abnormal alternative splicing of HFM1. For the sister, she experienced embryo arrest 9 weeks after pregnancy after undergoing 5 cycles of ART. iv) PMID: 39929154 (2025)- reported compound heterozygous variants c.1978-2A>C and c.2681-3T>A in a case of POI with unique genital characteristics; also their lit review showed that previous studies have linked HFM1 gene variants to clinical manifestations such as POI, diminished ovarian reserve, recurrent pregnancy loss, and poor outcomes in in vitro fertilization-embryo transfer. Sources: Literature; to: Literature in OMIM- PMID:24597873- compound heterozygous variants in a familial case and an unrelated individual with primary ovarian failure New papers (single family with monoallelic variant and expansion of phenotypes in females) i) PMID: 31279343- Novel heterozygous missense variant in HFM1 (c.3470G > A) in the proband and her mother both affected by POI. Minigene splicing assay of the WT and MT constructs revealed that an alternative splicing process were produced with the c.3470G > A variant in mRNA level. ii) PMID: 35881270- novel compound heterozygous variants,c.1978-2A > C and c.2680 + 3_2680 + 4delAT, in two sisters with diminished ovarian reserve and recurrent pregnancy loss (RPL) in natural pregnancy and in vitro fertilization-embryo transfer (IVF-ET). Minigene assay showed that both variants could produce alternative transcripts compared to wild-type counterparts, which might result in protein dysfunction. These results demonstrated that RPL caused by the HFM1 gene might be inherited in AR mode, iii) PMID: 36864181- novel homozygous splicing variant in HFM1 (NM_001017975.6: c.1730-1G > T) in two siblings - female with poor ovarian response and recurrent implantation failure and male with NOA. Minigene assay demonstrated that splicing variants caused abnormal alternative splicing of HFM1. For the sister, she experienced embryo arrest 9 weeks after pregnancy after undergoing 5 cycles of ART. iv) PMID: 39929154- reported compound heterozygous variants c.1978-2A>C and c.2681-3T>A in a case of POI with unique genital characteristics; also their lit review showed that previous studies have linked HFM1 gene variants to clinical manifestations such as POI, diminished ovarian reserve, recurrent pregnancy loss, and poor outcomes in in vitro fertilization-embryo transfer. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | HFM1 |
Jasmine Chew gene: HFM1 was added gene: HFM1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: HFM1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: HFM1 were set to 24597873; 31279343; 35881270; 36864181; 39929154 Phenotypes for gene: HFM1 were set to Premature ovarian failure 9, MIM# 615724 Review for gene: HFM1 was set to GREEN Added comment: Literature in OMIM- PMID:24597873- compound heterozygous variants in a familial case and an unrelated individual with primary ovarian failure New papers (single family with monoallelic variant and expansion of phenotypes) i) PMID: 31279343- Novel heterozygous missense variant in HFM1 (c.3470G > A) in the proband and her mother both affected by POI. Minigene splicing assay of the WT and MT constructs revealed that an alternative splicing process were produced with the c.3470G > A variant in mRNA level. ii) PMID: 35881270- novel compound heterozygous variants,c.1978-2A > C and c.2680 + 3_2680 + 4delAT, in two sisters with diminished ovarian reserve and recurrent pregnancy loss (RPL) in natural pregnancy and in vitro fertilization-embryo transfer (IVF-ET). Minigene assay showed that both variants could produce alternative transcripts compared to wild-type counterparts, which might result in protein dysfunction. These results demonstrated that RPL caused by the HFM1 gene might be inherited in AR mode, iii) PMID: 36864181 (2023)- novel homozygous splicing variant in HFM1 (NM_001017975.6: c.1730-1G > T) in two siblings - female with poor ovarian response and recurrent implantation failure and male with NOA. Minigene assay demonstrated that splicing variants caused abnormal alternative splicing of HFM1. For the sister, she experienced embryo arrest 9 weeks after pregnancy after undergoing 5 cycles of ART. iv) PMID: 39929154 (2025)- reported compound heterozygous variants c.1978-2A>C and c.2681-3T>A in a case of POI with unique genital characteristics; also their lit review showed that previous studies have linked HFM1 gene variants to clinical manifestations such as POI, diminished ovarian reserve, recurrent pregnancy loss, and poor outcomes in in vitro fertilization-embryo transfer. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | MCM8 | Zornitza Stark Marked gene: MCM8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | MCM8 | Zornitza Stark Gene: mcm8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | MCM8 | Zornitza Stark Classified gene: MCM8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.25 | MCM8 | Zornitza Stark Gene: mcm8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.24 | GGN | Zornitza Stark Marked gene: GGN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.24 | GGN | Zornitza Stark Gene: ggn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.24 | GGN | Zornitza Stark Mode of pathogenicity for gene: GGN was changed from Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments to None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.23 | GGN | Zornitza Stark Classified gene: GGN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.23 | GGN | Zornitza Stark Gene: ggn has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.22 | FKBP6 | Zornitza Stark Marked gene: FKBP6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.22 | FKBP6 | Zornitza Stark Gene: fkbp6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.22 | FKBP6 | Zornitza Stark Classified gene: FKBP6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.22 | FKBP6 | Zornitza Stark Gene: fkbp6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.21 | EIF4ENIF1 | Zornitza Stark Marked gene: EIF4ENIF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.21 | EIF4ENIF1 | Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2435 | EIF4ENIF1 | Zornitza Stark Publications for gene: EIF4ENIF1 were set to 31810472; 23902945; 33095795 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2434 | EIF4ENIF1 | Zornitza Stark Classified gene: EIF4ENIF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2434 | EIF4ENIF1 | Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2433 | EIF4ENIF1 | Zornitza Stark reviewed gene: EIF4ENIF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23902945, 39827467, 36030004, 38604507, 31810472, 33095795; Phenotypes: Primary ovarian insufficiency, MONDO:0005387, EIF4ENIF1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.344 | EIF4ENIF1 | Zornitza Stark Publications for gene: EIF4ENIF1 were set to 31810472; 23902945; 33095795 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.343 | EIF4ENIF1 | Zornitza Stark Classified gene: EIF4ENIF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.343 | EIF4ENIF1 | Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.342 | EIF4ENIF1 | Zornitza Stark reviewed gene: EIF4ENIF1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23902945, 39827467, 36030004, 38604507, 31810472, 33095795; Phenotypes: Primary ovarian insufficiency, MONDO:0005387, EIF4ENIF1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.21 | EIF4ENIF1 | Zornitza Stark Classified gene: EIF4ENIF1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.21 | EIF4ENIF1 | Zornitza Stark Gene: eif4enif1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.20 | DPY19L2 | Zornitza Stark Marked gene: DPY19L2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.20 | DPY19L2 | Zornitza Stark Gene: dpy19l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.20 | DPY19L2 | Zornitza Stark Classified gene: DPY19L2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.20 | DPY19L2 | Zornitza Stark Gene: dpy19l2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.19 | MCM8 | Jasmine Chew edited their review of gene: MCM8: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.19 | BMP15 | Zornitza Stark Marked gene: BMP15 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.19 | BMP15 | Zornitza Stark Gene: bmp15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.19 | BMP15 | Zornitza Stark Classified gene: BMP15 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.19 | BMP15 | Zornitza Stark Gene: bmp15 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.18 | MCM8 |
Jasmine Chew gene: MCM8 was added gene: MCM8 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: MCM8 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MCM8 were set to 25437880; 25873734; 40064807; 32048466 Phenotypes for gene: MCM8 were set to Premature ovarian failure 10, MIM# 612885; Azoospermia, MONDO:0100459 Added comment: Literature in OMIM- PMID:25437880;25873734- homozygous variants reported in affected females with premature ovarian failure, supported by functional evidence New papers: i) PMID: 40064807- A novel homozygous frameshift variant (p. Gly333Glufs*50) in two siblings diagnosed with primary gonadal dysgenesis from a consanguineous family. The testes tissue sections in the male showed a Sertoli cell-only syndrome (SCOS). Functional analysis in vitro suggested that the mutation results in a truncated protein of MCM8 in HEK293T cells, and immunohistochemistry in vivo showed decreased expression of MCM8 protein. This study expands the mutational spectrum of MCM8 involved in male NOA and female POI. ii) PMID: 32048466- A novel homozygous frameshift mutation in the MCM8 gene in two affected sisters with POI. Reverse transcription polymerase chain reaction revealed that the frameshift mutation led to a remarkably reduced level of MCM8 transcript products, and chromosomal instability study showed that the ability of mutant MCM8 to repair DNA breaks was impaired. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.18 | AURKC | Zornitza Stark Marked gene: AURKC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.18 | AURKC | Zornitza Stark Gene: aurkc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.18 | AURKC | Zornitza Stark Classified gene: AURKC as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.18 | AURKC | Zornitza Stark Gene: aurkc has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | NOBOX |
Jasmine Chew changed review comment from: Literature in OMIM- PMIM:17701902;21837770;25514101- heterozygous missense and LOF variants reported in affected women with primary ovarian insufficiency, supported by functional evidence New papers (expansion of phenotypes and novel biallelic variants reported in POI patients)- i. PMID: 39871066- A heterozygous missense variant (p.His617Tyr) in two European women with distinct distinct oocyte, zygote, and embryo maturation arrest (OZEMA) phenotype. The same variant has been observed in other two woman experiencing embryonic developmental arrest from the database of Juno Genetics. Given that all affected women have a normal to high ovarian reserve, a typical POI phenotype can be excluded in these cases. ii. PMID: 34480423- novel compound heterozygous truncating variants (p.Arg276Ter and p.Gly474AlafsTer76) in a Belgian patient presenting POI iii. PMID: 29067606- novel homozygous c.1489delT variant in two sisters with POI Sources: Literature; to: Literature in OMIM- PMIM:17701902;21837770;25514101- heterozygous missense and LOF variants reported in affected women with primary ovarian insufficiency, supported by functional evidence New papers (expansion of phenotypes and novel biallelic variants reported in POI patients)- i. PMID: 39871066- A heterozygous missense variant (p.His617Tyr) in two European women with distinct distinct oocyte, zygote, and embryo maturation arrest (OZEMA) phenotype. The same variant has been observed in other two woman experiencing embryonic developmental arrest from the database of Juno Genetics. Given that all affected women have a normal to high ovarian reserve, a typical POI phenotype can be excluded in these cases. ii. PMID: 34480423- Novel compound heterozygous truncating variants (p.Arg276Ter and p.Gly474AlafsTer76) in a Belgian patient presenting POI. iii. PMID: 29067606- a novel homozygous c.1489delT variant in two sisters with POI Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | NOBOX |
Jasmine Chew gene: NOBOX was added gene: NOBOX was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: NOBOX was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: NOBOX were set to 17701902; 21837770; 25514101; 39871066; 34480423; 29067606 Phenotypes for gene: NOBOX were set to Premature ovarian failure 5, MIM# 611548 Review for gene: NOBOX was set to GREEN Added comment: Literature in OMIM- PMIM:17701902;21837770;25514101- heterozygous missense and LOF variants reported in affected women with primary ovarian insufficiency, supported by functional evidence New papers (expansion of phenotypes and novel biallelic variants reported in POI patients)- i. PMID: 39871066- A heterozygous missense variant (p.His617Tyr) in two European women with distinct distinct oocyte, zygote, and embryo maturation arrest (OZEMA) phenotype. The same variant has been observed in other two woman experiencing embryonic developmental arrest from the database of Juno Genetics. Given that all affected women have a normal to high ovarian reserve, a typical POI phenotype can be excluded in these cases. ii. PMID: 34480423- novel compound heterozygous truncating variants (p.Arg276Ter and p.Gly474AlafsTer76) in a Belgian patient presenting POI iii. PMID: 29067606- novel homozygous c.1489delT variant in two sisters with POI Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | PATL2 |
Jasmine Chew changed review comment from: Literature in OMIM- PMID:28965844;28965849; 35091966- biallelic variants in affected women with infertility due to oocyte maturation arrest New papers- i) PMID: 32048119- two novel homozygous missense variants (p.Pro510Thr and p.Ser459Tyr) in three patients from two consanguineous families with female infertility due to oocyte maturation arrest. Western immunoblotting analysis showed that the expression levels of the two novel mutant PATL2 proteins decreased significantly. ii) PMID: 30765866- four novel homozygous missense variants (p.V260M, p.Q300*, p.T425P, and p.D293Y), a novel frameshift variant (p.N239Tfs*9), and a reported splicing mutation (p.R75Vfs*21) in PATL2 in seven affected individuals from five unrelated families, showing a multiplicity of phenotypes in oocyte maturation arrest, fertilization failure, or embryonic developmental arrest. iii) PMID: 39476306- novel compound heterozygous splicing variant (c.516-1G > T and c.877-1G > A) in a woman with oocyte degeneration and fertilization failure. Minigene splicing assays revealed that the c.516-1G > T resulted in a deletion of 8 bases in mRNA that causes a frameshift (p.P173Q fs*13) and the c.877-1G > A led to the skipping of exons 10 and 11 and retention of introns 8-9 in PATL2 mRNA. iv) PMID: 38536595- 15 novel biallelic variants in 18 families with impaired oocyte maturation, fertilization problems, embryonic arrest, or implantation failure Sources: Literature; to: Literature in OMIM- PMID:28965844;28965849; 35091966- biallelic variants in affected women with infertility due to oocyte maturation arrest New papers- i) PMID: 32048119- two novel homozygous missense variants (p.Pro510Thr and p.Ser459Tyr) in three patients from two consanguineous families with female infertility due to oocyte maturation arrest. Western immunoblotting analysis showed that the expression levels of the two novel mutant PATL2 proteins decreased significantly. ii) PMID: 30765866- four novel homozygous missense variants (p.V260M, p.Q300*, p.T425P, and p.D293Y), a novel frameshift variant (p.N239Tfs*9), and a reported splicing mutation (p.R75Vfs*21) in PATL2 in seven affected individuals from five unrelated families, showing a multiplicity of phenotypes in oocyte maturation arrest, fertilization failure, or embryonic developmental arrest. iii) PMID: 39476306- novel compound heterozygous splicing variant (c.516-1G > T and c.877-1G > A) in a woman with oocyte degeneration and fertilization failure. Minigene splicing assays revealed that the c.516-1G > T resulted in a deletion of 8 bases in mRNA that causes a frameshift (p.P173Q fs*13) and the c.877-1G > A led to the skipping of exons 10 and 11 and retention of introns 8-9 in PATL2 mRNA. iv) PMID: 38536595- 15 novel biallelic variants in 18 families with infertile women with IVF/ICSI failure due to impaired oocyte maturation, fertilization problems, embryonic arrest, or implantation failure. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | FITM2 | Melanie Marty edited their review of gene: FITM2: Changed publications: 28067622, 30214770, 30288795, 35754111 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | PATL2 |
Jasmine Chew gene: PATL2 was added gene: PATL2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PATL2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PATL2 were set to 28965844; 28965849; 35091966; 32048119; 30765866; 39476306; 38536595 Phenotypes for gene: PATL2 were set to Oocyte maturation defect 4, MIM# 617743 Review for gene: PATL2 was set to GREEN Added comment: Literature in OMIM- PMID:28965844;28965849; 35091966- biallelic variants in affected women with infertility due to oocyte maturation arrest New papers- i) PMID: 32048119- two novel homozygous missense variants (p.Pro510Thr and p.Ser459Tyr) in three patients from two consanguineous families with female infertility due to oocyte maturation arrest. Western immunoblotting analysis showed that the expression levels of the two novel mutant PATL2 proteins decreased significantly. ii) PMID: 30765866- four novel homozygous missense variants (p.V260M, p.Q300*, p.T425P, and p.D293Y), a novel frameshift variant (p.N239Tfs*9), and a reported splicing mutation (p.R75Vfs*21) in PATL2 in seven affected individuals from five unrelated families, showing a multiplicity of phenotypes in oocyte maturation arrest, fertilization failure, or embryonic developmental arrest. iii) PMID: 39476306- novel compound heterozygous splicing variant (c.516-1G > T and c.877-1G > A) in a woman with oocyte degeneration and fertilization failure. Minigene splicing assays revealed that the c.516-1G > T resulted in a deletion of 8 bases in mRNA that causes a frameshift (p.P173Q fs*13) and the c.877-1G > A led to the skipping of exons 10 and 11 and retention of introns 8-9 in PATL2 mRNA. iv) PMID: 38536595- 15 novel biallelic variants in 18 families with impaired oocyte maturation, fertilization problems, embryonic arrest, or implantation failure Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | FITM2 | Melanie Marty reviewed gene: FITM2: Rating: GREEN; Mode of pathogenicity: None; Publications: 28067622, 30214770, 30288795, 28067622, 35754111; Phenotypes: Siddiqi syndrome, MIM#618635; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | ABCB11 | Melanie Marty reviewed gene: ABCB11: Rating: GREEN; Mode of pathogenicity: None; Publications: 16871584, 23141890, 9806540, 15300568, 11172067; Phenotypes: Cholestasis, progressive familial intrahepatic 2, MIM# 601847, Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | SLC1A4 | Melanie Marty reviewed gene: SLC1A4: Rating: GREEN; Mode of pathogenicity: None; Publications: 25930971, 26138499, 26041762, 27193218, 29989513; Phenotypes: Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | SETX | Melanie Marty reviewed gene: SETX: Rating: GREEN; Mode of pathogenicity: None; Publications: 23129421; Phenotypes: Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 (MIM#606002); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | RPGRIP1L | Melanie Marty reviewed gene: RPGRIP1L: Rating: GREEN; Mode of pathogenicity: None; Publications: 17558409, 17558407, 17960139, 26071364, 19574260, 29991045; Phenotypes: Joubert syndrome 7, MIM# 611560, Meckel syndrome 5, MIM# 611561, COACH syndrome 3, MIM# 619113, Ciliopathy, RPGRIP1L-related, MONDO:0005308; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | POF1B |
Jasmine Chew changed review comment from: Literature in OMIM- PMID:16773570- familial case with POF carrying homozygous R329Q, supported by functional evidence. New papers: i) PMID: 25676666- reciprocal translocation between chromosomes X and 3 and an additional heterozygous missense variant p.Arg329Gln in a POI case, which explains the phenotype. Functional analysis of the POF1B variant p.Arg329Gln showed diminished binding of the mutant protein to non-muscle actin, and the authors hypothesized a possible role for POF1B in pairing of meiotic chromosomes or as an anti-apoptotic factor. ii) PMID: 34423420- novel homozygous missense variant p.K311T in a Chinese patient with POF, adjacent to the known p.R329Q variant, suggesting that would damage the capacity of POF1B to bind non-muscle actin filaments. iii) PMID: 34707299 - homozygous missense variant p.(Arg329Gln) in a female with POI (identical to PMID:16773570). Sources: Literature; to: Literature in OMIM- PMID:16773570- familial case with POF carrying homozygous missense variant R329Q, supported by functional evidence. New papers: i) PMID: 25676666- reciprocal translocation between chromosomes X and 3 and an additional heterozygous missense variant p.Arg329Gln in a POI case, which explains the phenotype. Functional analysis of the POF1B variant p.Arg329Gln showed diminished binding of the mutant protein to non-muscle actin, and the authors hypothesized a possible role for POF1B in pairing of meiotic chromosomes or as an anti-apoptotic factor. ii) PMID: 34423420- novel homozygous missense variant p.K311T in a Chinese patient with POF, adjacent to the known p.R329Q variant, suggesting that would damage the capacity of POF1B to bind non-muscle actin filaments. iii) PMID: 34707299 - homozygous missense variant p.(Arg329Gln) in a female with POI (identical to PMID:16773570). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | POF1B |
Jasmine Chew changed review comment from: Literature in OMIM- PMID:16773570- familial case with POF carrying homozygous R329Q, supported by functional evidence. New papers: i) PMID: 25676666- reciprocal translocation between chromosomes X and 3 and an additional heterozygous missense variant p.Arg329Gln in a POI case, which explains the phenotype. Functional analysis of the POF1B variant p.Arg329Gln showed diminished binding of the mutant protein to non-muscle actin, and the authors hypothesized a possible role for POF1B in pairing of meiotic chromosomes or as an anti-apoptotic factor. ii) PMID: 34423420- novel homozygous missense variant p.K311T in a Chinese patient with POF, adjacent to the known p.R329Q variant, suggesting that would damage the capacity of POF1B to bind non-muscle actin filaments. iii) PMID: 34707299 - homozygous missense variant p.(Arg329Gln) in a female with POI (identical to PMID:16773570). Sources: Literature; to: Literature in OMIM- PMID:16773570- familial case with POF carrying homozygous R329Q, supported by functional evidence. New papers: i) PMID: 25676666- reciprocal translocation between chromosomes X and 3 and an additional heterozygous missense variant p.Arg329Gln in a POI case, which explains the phenotype. Functional analysis of the POF1B variant p.Arg329Gln showed diminished binding of the mutant protein to non-muscle actin, and the authors hypothesized a possible role for POF1B in pairing of meiotic chromosomes or as an anti-apoptotic factor. ii) PMID: 34423420- novel homozygous missense variant p.K311T in a Chinese patient with POF, adjacent to the known p.R329Q variant, suggesting that would damage the capacity of POF1B to bind non-muscle actin filaments. iii) PMID: 34707299 - homozygous missense variant p.(Arg329Gln) in a female with POI (identical to PMID:16773570). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | POF1B |
Jasmine Chew gene: POF1B was added gene: POF1B was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: POF1B was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: POF1B were set to 16773570; 34707299; 25676666; 34423420 Phenotypes for gene: POF1B were set to Premature ovarian failure 2B, MIM# 300604 Review for gene: POF1B was set to GREEN Added comment: Literature in OMIM- PMID:16773570- familial case with POF carrying homozygous R329Q, supported by functional evidence. New papers: i) PMID: 25676666- reciprocal translocation between chromosomes X and 3 and an additional heterozygous missense variant p.Arg329Gln in a POI case, which explains the phenotype. Functional analysis of the POF1B variant p.Arg329Gln showed diminished binding of the mutant protein to non-muscle actin, and the authors hypothesized a possible role for POF1B in pairing of meiotic chromosomes or as an anti-apoptotic factor. ii) PMID: 34423420- novel homozygous missense variant p.K311T in a Chinese patient with POF, adjacent to the known p.R329Q variant, suggesting that would damage the capacity of POF1B to bind non-muscle actin filaments. iii) PMID: 34707299 - homozygous missense variant p.(Arg329Gln) in a female with POI (identical to PMID:16773570). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | RAD50 | Melanie Marty reviewed gene: RAD50: Rating: GREEN; Mode of pathogenicity: None; Publications: 19409520, 32212377, 33378670; Phenotypes: Nijmegen breakage syndrome-like disorder, MIM# 613078; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | PRDM9 |
Jasmine Chew gene: PRDM9 was added gene: PRDM9 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PRDM9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: PRDM9 were set to 34257419 Phenotypes for gene: PRDM9 were set to Primary ovarian insufficiency, MONDO:0005387 Review for gene: PRDM9 was set to GREEN Added comment: i) PMID: 34257419 (2021): 3 heterozygous variants in 4 unrelated premature ovarian insufficiency (POI) patients (P1,2- p.Arg77*, P3- p.Lys226Met, P4- p.Ile213Ser); All mutant proven to affect the H3K4 methyltransferase activity of the protein and more apoptotic oocytes were observed in Prdm9+/- mice ovaries indicating the heterozygous knockout oocytes were more susceptible to exogenous stress. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | PSMC3IP |
Jasmine Chew gene: PSMC3IP was added gene: PSMC3IP was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PSMC3IP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PSMC3IP were set to 21963259; 35352317; 34878148; 30406445; 29240891 Phenotypes for gene: PSMC3IP were set to Ovarian dysgenesis 3, MIM# 614324 Review for gene: PSMC3IP was set to GREEN Added comment: Literature in OMIM- PMID:21963259 New papers (new variants reported)- PMID:35352317; 34878148; 30406445; 29240891 (Supported by functional evidence in 25820426) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | RAB27A | Melanie Marty reviewed gene: RAB27A: Rating: GREEN; Mode of pathogenicity: None; Publications: 32374962, 32107531; Phenotypes: Griscelli syndrome, type 2, MIM# 607624; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | QDPR | Melanie Marty reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PUS1 | Melanie Marty reviewed gene: PUS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 25227147, 17056637, 15108122, 32287105, 31641589, 28832011; Phenotypes: Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PRX | Melanie Marty reviewed gene: PRX: Rating: GREEN; Mode of pathogenicity: None; Publications: 11133365, 11157804, 15197604, 21079185, 22847150, 10839370, 32460404, 31523542, 31426691; Phenotypes: Charcot-Marie-Tooth disease, type 4F, MIM# 614895, Dejerine-Sottas disease, MIM# 145900; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | SOHLH1 |
Jasmine Chew gene: SOHLH1 was added gene: SOHLH1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SOHLH1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SOHLH1 were set to 25774885; 20506135; 28718531; 38448741; 34448846 Phenotypes for gene: SOHLH1 were set to Ovarian dysgenesis 5, MIM #617690; Spermatogenic failure 32, MIM #618115 Review for gene: SOHLH1 was set to GREEN Added comment: Literature in OMIM- PMID:25774885; 20506135; 28718531 New papers for ovarian dysgenesis: i) PMID: 38448741- novel homozygous missense variant (Ser92Leu) in three affected females from an inbred Mexican family with familial ovarian dysgenesis. Histological examination showed ovarian cortex marked by fibrosis and an almost complete absence of follicle, which was consistent with the findings in the gonads of Sohlh1-deficient mice (PMID: 16690745). New papers for spermatogenic failure (new recessive-inheritance pattern of SOHLH1-associated male infertility): i) PMID: 34448846- homozygous c.346-1G > A variant in a severe oligozoospermia (SOZ) patient, characterized with severely decreased sperm count. The homozygous variant leads to the sharp decrease in various germ cells and spermatogenesis dysfunction, which is similar to the phenotype of SOHLH1 knockout male mice (PMID: 30614095). Suggested that previously reported heterozygous c.346-1G > A variant is associated with teratozoospermia but not a direct cause for NOA and the homozygous c.346-1G > A variant impairs spermatogenesis and further leads to the reduced sperm count, eventually causing male infertility. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PRDM12 | Melanie Marty reviewed gene: PRDM12: Rating: GREEN; Mode of pathogenicity: None; Publications: 26005867, 33789102, 33010785, 32828702; Phenotypes: Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | BMP15 |
Jasmine Chew gene: BMP15 was added gene: BMP15 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: BMP15 was set to Other Publications for gene: BMP15 were set to 15136966; 16508750; 16464940; 19263482; 39850788; 35861920 Phenotypes for gene: BMP15 were set to Ovarian dysgenesis 2, MIM# 300510; Premature ovarian failure 4, MIM# 300510 Review for gene: BMP15 was set to GREEN Added comment: Literature in OMIM (PMID: 15136966;16508750;16464940;19263482)- multiple affected females carrying monoallelic variants with POI+/- ovarian dysgenesis. New papers reporting on biallelic variants in affected females: i) PMID: 39850788- novel homozygous variant (p.C320Y) in 2 Palestinian sisters born to consanguineous parents with ovarian dysgenesis and primary amenorrhea; in-vitro assay also showed decreased in BMP signaling in cells expressing the homozygous BMP15 mutant when compared to the WT control. ii) PMID: 35861920- novel compound heterozygous variant (p. R264Q and p. P359L) in two siblings with POI. Both missense variants reduced the level of the BMP15 protein and impaired the function of BMP15 in promoting granulosa cell proliferation in vitro. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | EIF4ENIF1 | Jasmine Chew edited their review of gene: EIF4ENIF1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | EIF4ENIF1 |
Jasmine Chew gene: EIF4ENIF1 was added gene: EIF4ENIF1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: EIF4ENIF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: EIF4ENIF1 were set to 23902945; 39827467; 36030004; 38604507; 31810472; 33095795 Phenotypes for gene: EIF4ENIF1 were set to Primary ovarian insufficiency, MONDO:0005387, EIF4ENIF1-related Added comment: i) PMID: 23902945- heterozygous stop gained p. Ser429X variant in 6 POI-affected women segregated in a large family; mRNA in white blood cells from 3 affected women demonstrated nonsense mutant transcript at a decreased proportion compared with that in gDNA, suggesting haploinsufficiency or dominant negative effect. A stop-gain mouse model was created for the heterozygous variant by PMID: 39827467 (2025), which replicated POI phenotype in women (i.e., decreased reproductive lifespan and early oocyte loss). ii) PMID: 36030004 - two variants, p.R4del and (p.G954A in two sporadic Han Chinese POI patients. Western blot analysis further demonstrated that both of the two variants exhibited reduced mRNA and protein expression levels compared with the wild-type in vitro iii) PMID: 38604507 - novel missense variant (p.R208H) in a patient with POI and in vitro transfection study showed that overexpression R208H significantly (P < 0.0001) lowered the overall translation efficiency, whereas exhibiting a reduced translation inhibitory effect on high-TE genes (TE > 2 in GFP control group). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | VPS33B | Michelle Torres reviewed gene: VPS33B: Rating: GREEN; Mode of pathogenicity: None; Publications: 31479177, 30561130, 28017832; Phenotypes: Arthrogryposis, renal dysfunction, and cholestasis 1 MIM#208085, Cholestasis, progressive familial intrahepatic, 12 MIM#620010, Keratoderma-ichthyosis-deafness syndrome, autosomal recessive MIM#620009; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | SYCP3 | Jasmine Chew edited their review of gene: SYCP3: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | KHDC3L | Jasmine Chew edited their review of gene: KHDC3L: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PPA2 | Melanie Marty reviewed gene: PPA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523598, 34400813; Phenotypes: Sudden cardiac failure, infantile, MIM#617222, Sudden cardiac failure, alcohol-induced, MIM#617223; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | ZP1 |
Jasmine Chew gene: ZP1 was added gene: ZP1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ZP1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZP1 were set to 24670168; 30810869; 36385415; 39380244; 36529558 Phenotypes for gene: ZP1 were set to Oocyte/zygote/embryo maturation arrest 1, MIM# 615774 Review for gene: ZP1 was set to GREEN Added comment: Literature in OMIM (PMID: 24670168;30810869)- familial cases with homozygous missense/frameshift variant in affected women with primary infertility due to oocyte maturation defect; supported by functional evidence. New papers: i) PMID: 36385415- homozygous nonsense variant p.Gln210Ter in a case with primary infertility (C19) ii) PMID: 39380244;36529558- homozygous missense variants in the same AA position (p.Arg366Trp and p.Arg366Gln) in unrelated females with with empty follicle syndrome; supported by functional evidence Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | POC1A | Melanie Marty reviewed gene: POC1A: Rating: GREEN; Mode of pathogenicity: None; Publications: 22840364, 22840363, 26374189, 26162852, 26791357; Phenotypes: Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | ZP2 |
Jasmine Chew gene: ZP2 was added gene: ZP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ZP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ZP2 were set to 29895852; 30810869; 39443359; 33604805 Phenotypes for gene: ZP2 were set to Oocyte/zygote/embryo maturation arrest 6, MIM# 618353 Added comment: Literature in OMIM (PMID: 29895852; 30810869)- familial cases with homozygous variants (splice and missense) reported in affected women with defective/absent oocyte zona pellucida, supported by functional evidence New papers- i) PMID: 39443359- novel compound heterozygous variant (c.1924C > T and c.1695-2A > G) in a Chinese Han family with primary female infertility due to oocyte degeneration caused by absent/thin ZP; both variants (c.1924C > T and c.1695-2A > G) resulted in truncated ZP2 proteins (p.R642X and p.C566Hfs*2) that lost the transmembrane domain, which prevented the secretion of the mutant ZP2 proteins and produced a structurally abnormal ZP. ii) PMID: 33604805- novel homozygous frameshift variant (p.Q412Rfs*17) in two infertile sisters in a family with a thin zona pellucida (ZP) phenotype, supported by functional evidence. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PGAP1 | Melanie Marty reviewed gene: PGAP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24482476, 24784135, 25823418, 25804403, 26050939; Phenotypes: Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | PEX7 | Melanie Marty reviewed gene: PEX7: Rating: GREEN; Mode of pathogenicity: None; Publications: 11781871, 12522768, 12325024; Phenotypes: Peroxisome biogenesis disorder 9B, MIM# 614879, Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | TCIRG1 | Michelle Torres reviewed gene: TCIRG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 34624559, 34210262, 30084437, 28816234; Phenotypes: Osteopetrosis, autosomal recessive 1 MIM#259700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | LRSAM1 |
Melanie Marty changed review comment from: Only a single family reported with recessive inheritance. Over 30 families reported with dominant disease. Age of onset typically between the second and fifth decades of life. Marking as red for carrier screening due to age of onset and limited evidence for recessive disease.; to: Only a single family reported with recessive inheritance. Over 30 families reported with dominant disease. Age of onset typically between the second and fifth decades of life. Peak age of onset in second decade (range childhood to 76 years) (OMIM). Marking as red for carrier screening due to age of onset and limited evidence for recessive disease. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | LRSAM1 |
Melanie Marty changed review comment from: Only a single family reported with recessive inheritance. Over 30 families reported with dominant disease. Age of onset typically between the second and fifth decades of life.; to: Only a single family reported with recessive inheritance. Over 30 families reported with dominant disease. Age of onset typically between the second and fifth decades of life. Marking as red for carrier screening due to age of onset and limited evidence for recessive disease. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | LRSAM1 | Melanie Marty edited their review of gene: LRSAM1: Changed publications: 38330802, 33568173 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | TBC1D23 | Michelle Torres reviewed gene: TBC1D23: Rating: GREEN; Mode of pathogenicity: None; Publications: 28823707, 28823706; Phenotypes: Pontocerebellar hypoplasia, type 11 MIM#617695; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | TACC3 | Jasmine Chew edited their review of gene: TACC3: Changed phenotypes: Female infertility due to oocyte meiotic arrest, MONDO:0044626 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | TACC3 |
Jasmine Chew changed review comment from: PMID: 36395215- compound heterozygous variants (Patient 1- p.Ser177Thr/p.Pro395Arg, Patient 2- p.Lys225_Cys236del/p.Gly631Val) in two unrelated females presented with oocyte maturation arrest and undetectable spindles on both polarization and fluorescence microscopy. Their oocytes lacked huoMTOCs and had poorly organized microtubules, similar to the phenotype of TACC3 depletion in vitro, which suggests a loss-of-function mechanism causing oocyte maturation arrest and infertility. Note: couldn't access MONDO # as website down (phenotypes to be updated); to: PMID: 36395215- compound heterozygous variants (Patient 1- p.Ser177Thr/p.Pro395Arg, Patient 2- p.Lys225_Cys236del/p.Gly631Val) in two unrelated females presented with oocyte maturation arrest and undetectable spindles on both polarization and fluorescence microscopy. Their oocytes lacked huoMTOCs and had poorly organized microtubules, similar to the phenotype of TACC3 depletion in vitro, which suggests a loss-of-function mechanism causing oocyte maturation arrest and infertility. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | SRD5A3 | Michelle Torres reviewed gene: SRD5A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 32424323, 20301507; Phenotypes: Congenital disorder of glycosylation, type Iq MIM#612379, Kahrizi syndrome#612713, SRD5A3-congenital disorder of glycosylation (MONDO:0012885); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | ZP3 |
Jasmine Chew gene: ZP3 was added gene: ZP3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ZP3 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: ZP3 were set to 28886344; 30810869; 39932488; 37908588 Phenotypes for gene: ZP3 were set to Oocyte/zygote/embryo maturation arrest 3, MIM# 617712 Review for gene: ZP3 was set to GREEN Added comment: Literature in OMIM (PMID: 28886344;30810869)- familial cases with heterozygous missense variants supported by functional evidence (dominant-negative effect). New papers- i) PMID: 39932488- 4 heterozygous missense variants (2 novel, 2 known) with primary infertility, characterized by zona pellucida abnormalities or abnormal oocyte morphology. Also quoted that "To date, no studies have reported successful pregnancies in patients with ZP3 variants, suggesting that ZP3 plays an indispensable role in zona pellucida assembly and that ZP3 deficiency currently has no effective solution." ii) PMID: 37908588- novel homozygous missense variant in a female with empty follicle syndrome (EFS), who failed to retrieve any oocytes after three rounds of ovarian stimulation despite the presence of large follicles. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | SLC39A8 | Michelle Torres reviewed gene: SLC39A8: Rating: GREEN; Mode of pathogenicity: None; Publications: 37023243, 26637978, 26637979, 29453449; Phenotypes: Congenital disorder of glycosylation, type IIn MIM#616721; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | TUBB8 |
Jasmine Chew gene: TUBB8 was added gene: TUBB8 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TUBB8 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: TUBB8 were set to 26789871; 27273344; 33970371; 39834092 Phenotypes for gene: TUBB8 were set to Oocyte/zygote/embryo maturation arrest 2, MIM# 616780 Review for gene: TUBB8 was set to GREEN Added comment: Literature from OMIM (PMID: 26789871;27273344)- multiple familial cases and supporting functional evidence (monoallelic- dominant-negative effect; biallelic- functionally null, disrupt spindle assembly and cause abnormalities in oocyte maturation, fertilization, and embryonic development) More recent supporting evidence- i) PMID: 39834092- functional evidence elucidating how TUBB8 missense variants cause oocyte maturation arrest ii) PMID: 33970371- 29 variants in TUBB8 from 32 independent families with female infertility, of which 20 were novel, expanding the variant spectrum of TUBB8 (i.e., extremely involved in complete cleavage failure and embryonic arrest) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | AURKC |
Jasmine Chew gene: AURKC was added gene: AURKC was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: AURKC was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: AURKC were set to 17435757; 19147683; 21733974 Phenotypes for gene: AURKC were set to Spermatogenic failure 5, MIM #243060 Review for gene: AURKC was set to GREEN Added comment: i) PMID: 17435757- homozygous 1bp del (c.144delC; 603495.0001) in 10 infertile men (4 were unrelated French citizens of African descent) with a large-headed sperm phenotype, which resulted in premature termination of translation, yielding a truncated protein that lacks the kinase domain ii) PMID: 19147683 - homozygous c.144delC found in 31 patients and compound heterozygous for c.144delC and a missense variant (C229Y) in 30 patients with large-headed spermatozoa iii) PMID: 21733974- compound heterozygous for the c.144delC variant and a splice variant ((c.436-2A-G; predicted to cause skipping of exon 5) in 2 infertile brothers of Tunisian descent with macrozoospermia and a younger sister who had yet tried to achieve pregnancy Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2433 | CDC20 | Zornitza Stark Marked gene: CDC20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2433 | CDC20 | Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2433 | CDC20 | Zornitza Stark Classified gene: CDC20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2433 | CDC20 | Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2432 | CDC20 |
Zornitza Stark gene: CDC20 was added gene: CDC20 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CDC20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDC20 were set to 32666501; 33683667; 33898437; 34218387 Phenotypes for gene: CDC20 were set to Oocyte/zygote/embryo maturation arrest 14, MIM# 620276 Review for gene: CDC20 was set to GREEN Added comment: i) PMID: 32666501- Biallelic (homozygous/compound heterozygous) variants in 5 unrelated Chinese women with infertility due to oocyte maturation arrest. Knocked down mouse oocytes showed an metaphase I (MI) arrest phenotype that could be rescued by injection of wildtype human CDC20 cRNA; all of the variants significantly reduced the ability of CDC20 to rescue the phenotype. ii) PMID: 33683667- a compound heterozygous (missense and nonsense) variant in a Chinese woman with infertility due to oocyte maturation abnormalities and early embryonic arrest. iii) PMID: 33898437- 4 patients from 3 Chinese families with homozygous or compound heterozygous variants with infertility due to oocyte maturation arrest, fertilization failure, and early embryonic arrest. Functional analysis in mouse oocytes with knockdown of Cdc20 showed that the homozygous and compound heterozygous variants significantly reduced the ability of CDC20 to rescue the lack of PB1 extrusion (MI arrest). iv) PMID: 34218387- homozygous missense variant in a Chinese woman with infertility due to oocyte maturation arrest at MI and fertilization failure of MII oocytes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | CDC20 | Zornitza Stark Marked gene: CDC20 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | CDC20 | Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | CDC20 | Zornitza Stark Classified gene: CDC20 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.17 | CDC20 | Zornitza Stark Gene: cdc20 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2431 | CCNB3 | Zornitza Stark Marked gene: CCNB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2431 | CCNB3 | Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2431 | CCNB3 | Zornitza Stark Classified gene: CCNB3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2431 | CCNB3 | Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2430 | CCNB3 |
Zornitza Stark gene: CCNB3 was added gene: CCNB3 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: CCNB3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCNB3 were set to 35722368; 32938693; 34021051; 30770433; 34850816 Phenotypes for gene: CCNB3 were set to Recurrent pregnancy loss, susceptibility to, MONDO:0000144, CCNB3-related Review for gene: CCNB3 was set to GREEN Added comment: i) PMID: 35722368- homozygous missense variant (p.P119Q) in the female of unexplained recurrent pregnancy loss (RPL) couple (couple 29) ii) PMID: 32938693- homozygous missense variant (p.V1251D) in two sisters with RPL and two of their POCs were characterised and found to be triploid digynic due to the failure of meiosis II. iii) PMID: 34021051- novel homozygous frameshift variant (p.Val1321Glyfs*4, due to splicing causing exon skipping) in a patient with 16 RPL and one of her miscarriages is triploid digynic resulted from the failure of meiosis I. Supporting mouse evidence: iv) PMID: 30770433- Ccnb3 knockout also causes female infertility due to the failure of metaphase to anaphase transition in meiosis I and the extrusion of the first polar body. The infertility in these mice appeared to be due to embryonic lethality before embryonic day 7.5 and some of their oocytes fertilised by intracytoplasmic sperm injection led to triploid embryos. v) PMID: 34850816- Ccnb3-deficient mouse model is similar to a human infertility condition—recurrent pregnancy loss (RPL). Their findings demonstrate that the triploidy of embryos derived from Ccnb3-deficient oocytes is the primary cause of embryo death (i.e., such embryos can be rescued with euploid nuclei, whereas cytoplasmic Ccnb3 transcript is dispensable for zygotic genome activation and embryo development). Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.16 | CCNB3 | Zornitza Stark Marked gene: CCNB3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.16 | CCNB3 | Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.16 | CCNB3 | Zornitza Stark Phenotypes for gene: CCNB3 were changed from to Recurrent pregnancy loss, susceptibility to, MONDO:0000144, CCNB3-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.15 | CCNB3 | Zornitza Stark reviewed gene: CCNB3: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Recurrent pregnancy loss, susceptibility to, MONDO:0000144, CCNB3-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.15 | CCNB3 | Zornitza Stark Classified gene: CCNB3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.15 | CCNB3 | Zornitza Stark Gene: ccnb3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.14 | DMRT1 | Zornitza Stark Marked gene: DMRT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.14 | DMRT1 | Zornitza Stark Gene: dmrt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.14 | DMRT1 | Zornitza Stark Phenotypes for gene: DMRT1 were changed from to Azoospermia, MONDO:0100459, DMRT1-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.13 | DMRT1 | Zornitza Stark Classified gene: DMRT1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.13 | DMRT1 | Zornitza Stark Gene: dmrt1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | DMRT1 | Zornitza Stark commented on gene: DMRT1: Rare variants enriched in azoospermia cohorts. However, variants are missense, pathogenicity more difficult to determine in the absence of segregation or other data. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | DMRT1 | Zornitza Stark reviewed gene: DMRT1: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Azoospermia, MONDO:0100459, DMRT1-related; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | WDR35 | Zornitza Stark Marked gene: WDR35 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | WDR35 | Zornitza Stark Gene: wdr35 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1826 | WDR35 | Zornitza Stark Phenotypes for gene: WDR35 were changed from Short-rib thoracic dysplasia 7 with or without polydactyly, 614091 (3) to Cranioectodermal dysplasia 2 MIM#613610; Short-rib thoracic dysplasia 7 with or without polydactyly MIM#614091 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1825 | WDR35 | Zornitza Stark Publications for gene: WDR35 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1824 | WISP3 | Zornitza Stark Marked gene: WISP3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1824 | WISP3 | Zornitza Stark Gene: wisp3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1824 | WISP3 | Zornitza Stark Phenotypes for gene: WISP3 were changed from Arthropathy, progressive pseudorheumatoid, of childhood, 208230 (3) to Progressive pseudorheumatoid dysplasia MIM#208230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1823 | WISP3 | Zornitza Stark Publications for gene: WISP3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | WISP3 | Zornitza Stark Tag new gene name tag was added to gene: WISP3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | PCDH15 | Melanie Marty reviewed gene: PCDH15: Rating: GREEN; Mode of pathogenicity: None; Publications: 11398101, 11487575, 11138007, 12782354, 16260500, 14570705, 25930172, 28281779; Phenotypes: Usher syndrome, type 1F, MIM# 602083, Deafness, autosomal recessive 23, MIM# 609533; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | PCCA | Melanie Marty edited their review of gene: PCCA: Changed rating: GREEN; Changed mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | PCCA | Melanie Marty reviewed gene: PCCA: Rating: ; Mode of pathogenicity: None; Publications: 17966092, 10101253, 9887338; Phenotypes: Propionicacidemia, MIM#606054; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | OSTM1 | Melanie Marty reviewed gene: OSTM1: Rating: ; Mode of pathogenicity: None; Publications: 12627228, 15108279, 16813530, 23772242, 32048120; Phenotypes: Osteopetrosis, autosomal recessive 5, MIM#259720; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 500+ v1.5 | OSGEP | Melanie Marty reviewed gene: OSGEP: Rating: GREEN; Mode of pathogenicity: None; Publications: 28805828, 28272532; Phenotypes: Galloway-Mowat syndrome 3, MIM# 617729; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | NEB | Melanie Marty reviewed gene: NEB: Rating: GREEN; Mode of pathogenicity: None; Publications: 10051637, 22367672, 26578207, 33376055; Phenotypes: Nemaline myopathy 2, autosomal recessive 256030, Arthrogryposis multiplex congenita 6, MIM# 619334; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TRIT1 | Michelle Torres reviewed gene: TRIT1: Rating: GREEN; Mode of pathogenicity: None; Publications: 36047296, 32088416, 24901367, 28185376, 30977854; Phenotypes: Combined oxidative phosphorylation deficiency 35 MIM#617873; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | WISP3 | Michelle Torres reviewed gene: WISP3: Rating: GREEN; Mode of pathogenicity: None; Publications: 26610319; Phenotypes: Progressive pseudorheumatoid dysplasia MIM#208230; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | WDR35 | Michelle Torres reviewed gene: WDR35: Rating: GREEN; Mode of pathogenicity: None; Publications: 33421337, 29134781, 28870638, 26691894, 24027799, 21473986; Phenotypes: Cranioectodermal dysplasia 2 MIM#613610, Short-rib thoracic dysplasia 7 with or without polydactyly MIM#614091; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | DMRT1 |
Jasmine Chew gene: DMRT1 was added gene: DMRT1 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DMRT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DMRT1 were set to 26139570; 38511217; 39777458 Review for gene: DMRT1 was set to GREEN Added comment: Literature in OMIM- PMID: 26139570 New papers: i) PMID: 38511217- heterozygous missense variant (K68N) in a Japanese man (case 13) with non-obstructive azoospermia (NOA) ii)PMID: 39777458- heterozygous missense variant (p.Pro74Leu) in two infertile Croatian brothers with NOA in the highly conserved position within the DNA binding DM domain of the protein, and EMSA assay showed reduced DNA binding of DMRT1P74L and molecular dynamic simulations showed differences in structural and dynamical properties between the wild type protein and DMRT1P74L. Also identified additional nine infertile men with idiopathic NOA or severe oligozoospermia as carriers of missense variants (see Table 2) located in critical functional domains of DMRT1. Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | DPY19L2 |
Jasmine Chew gene: DPY19L2 was added gene: DPY19L2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: DPY19L2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DPY19L2 were set to 15533374; 21397064; 21397064; 26516168; 30333325; 39045326 Phenotypes for gene: DPY19L2 were set to Spermatogenic failure 9, MIM# 613958 Review for gene: DPY19L2 was set to GREEN Added comment: Literature from OMIM- PMID:15533374, 21397064, 21397064 New papers: i) PMID: 26516168- In a cohort of Tunisian globozoospermic patients, 11 had homozygous DPY19L2 deletion, 2 had homozygous missense variant p.R298, and a patient with a novel homozygous splice site variant. ii) PMID: 30333325- In a cohort of Chinese globozoospermic patients, 5 had DPY19L2 deletions and the other four patients carried novel DPY19L2 point variants. iii) PMID: 39045326- homozygous variants (Arg 574Ter and Pro241Leu) in two patients with globozoospermia Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | FKBP6 |
Jasmine Chew gene: FKBP6 was added gene: FKBP6 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: FKBP6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FKBP6 were set to 36150389 Phenotypes for gene: FKBP6 were set to Spermatogenic failure 77, MIM# 620103 Review for gene: FKBP6 was set to GREEN Added comment: i) PMID: 36150389- compound heterozygous/ homozygous LOF variants in 6 unrelated infertile men (Dutch/German/Brazilian/Kyrgyz) with spermatogenic failure. Analysis of testicular histology was consistent with onset of germ cell loss in late meiosis and early spermiogenesis. Lack of FKBP6 expression in the testis was confirmed by RT-qPCR and immunofluorescence staining. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | GGN |
Jasmine Chew changed review comment from: i) PubMed: 31985809 (2020)- homozygous 1bp deletion causing a frameshift predicted to result in a premature termination codon (Gly424AlafsTer65) in 2 Turkish brothers with infertility due to globozoospermia. ii) PubMed: 33108537 (2021)- homozygous 22bp deletion in an infertile man with globozoospermia causing a frameshift predicted to result in a premature termination codon (Leu139ArgfsTer8). The 146-amino acid mutant protein would lack the GGNBP2 (612275) and OAZ3 (605138) interaction domain, and the GGNBP1 (609495) interaction domain would be partially truncated. iii) PMID: 23451117 (2013)- Ggn null mouse line demonstrated that s complete loss of GGN resulted in embryonic lethality at the very earliest period of pre-implantation development, with no viable blastocysts observed. This finding was consistent with the observation that Ggn mRNA was also expressed in lower levels in the oocyte and pre-implantation embryos. Sources: Literature; to: i) PubMed: 31985809 (2020)- homozygous 1bp deletion causing a frameshift predicted to result in a premature termination codon (Gly424AlafsTer65) in 2 Turkish brothers with infertility due to globozoospermia. ii) PubMed: 33108537 (2021)- homozygous 22bp deletion in an infertile man with globozoospermia causing a frameshift predicted to result in a premature termination codon (Leu139ArgfsTer8). The 146-amino acid mutant protein would lack the GGNBP2 (612275) and OAZ3 (605138) interaction domain, and the GGNBP1 (609495) interaction domain would be partially truncated. iii) PMID: 23451117 (2013)- Ggn null mouse line demonstrated that s complete loss of GGN resulted in embryonic lethality at the very earliest period of pre-implantation development, with no viable blastocysts observed. This finding was consistent with the observation that Ggn mRNA was also expressed in lower levels in the oocyte and pre-implantation embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | GGN |
Jasmine Chew changed review comment from: i) PubMed: 31985809 (2020)- hom 1bp del causing a frameshift predicted to result in a premature termination codon (Gly424AlafsTer65) in 2 Turkish brothers with infertility due to globozoospermia. ii) PubMed: 33108537 (2021)- hom 22bp del in an infertile man with globozoospermia causing a frameshift predicted to result in a premature termination codon (Leu139ArgfsTer8). The 146-amino acid mutant protein would lack the GGNBP2 (612275) and OAZ3 (605138) interaction domain, and the GGNBP1 (609495) interaction domain would be partially truncated. iii) PMID: 23451117 (2013)- Ggn null mouse line demonstrated that s complete loss of GGN resulted in embryonic lethality at the very earliest period of pre-implantation development, with no viable blastocysts observed. This finding was consistent with the observation that Ggn mRNA was also expressed in lower levels in the oocyte and pre-implantation embryos. Sources: Literature; to: i) PubMed: 31985809 (2020)- homozygous 1bp deletion causing a frameshift predicted to result in a premature termination codon (Gly424AlafsTer65) in 2 Turkish brothers with infertility due to globozoospermia. ii) PubMed: 33108537 (2021)- homozygous 22bp deletion in an infertile man with globozoospermia causing a frameshift predicted to result in a premature termination codon (Leu139ArgfsTer8). The 146-amino acid mutant protein would lack the GGNBP2 (612275) and OAZ3 (605138) interaction domain, and the GGNBP1 (609495) interaction domain would be partially truncated. iii) PMID: 23451117 (2013)- Ggn null mouse line demonstrated that s complete loss of GGN resulted in embryonic lethality at the very earliest period of pre-implantation development, with no viable blastocysts observed. This finding was consistent with the observation that Ggn mRNA was also expressed in lower levels in the oocyte and pre-implantation embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | GGN |
Jasmine Chew gene: GGN was added gene: GGN was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: GGN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GGN were set to Spermatogenic failure 69, MIM# 619826 Mode of pathogenicity for gene: GGN was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: GGN was set to GREEN Added comment: i) PubMed: 31985809 (2020)- hom 1bp del causing a frameshift predicted to result in a premature termination codon (Gly424AlafsTer65) in 2 Turkish brothers with infertility due to globozoospermia. ii) PubMed: 33108537 (2021)- hom 22bp del in an infertile man with globozoospermia causing a frameshift predicted to result in a premature termination codon (Leu139ArgfsTer8). The 146-amino acid mutant protein would lack the GGNBP2 (612275) and OAZ3 (605138) interaction domain, and the GGNBP1 (609495) interaction domain would be partially truncated. iii) PMID: 23451117 (2013)- Ggn null mouse line demonstrated that s complete loss of GGN resulted in embryonic lethality at the very earliest period of pre-implantation development, with no viable blastocysts observed. This finding was consistent with the observation that Ggn mRNA was also expressed in lower levels in the oocyte and pre-implantation embryos. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | NLRP5 |
Jasmine Chew gene: NLRP5 was added gene: NLRP5 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: NLRP5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: NLRP5 were set to 30877238; 32222962; 35091966; 35946397; 33583041 Phenotypes for gene: NLRP5 were set to Oocyte/zygote/embryo maturation arrest 19, MIM# 620333 Review for gene: NLRP5 was set to GREEN Added comment: Literature in OMIM- PMID: 30877238, 32222962, 35091966, 35946397 New evidence: i) PMID: 33583041- homozygous missense variant (p.Asp365Asn) in an Iranian woman with 2 years of infertility, IUI-twin (HM + fetus), and two complete hydatidiform mole Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | PDHA2 |
Jasmine Chew changed review comment from: i) PMID: 29581481- a homozygous missense variant (M227V) in 3 infertile brothers from a consanguineous Algerian family with male infertility (owing to azoospermia, sperm immotility or necrospermia) ii) PubMed: 35172124- previously reported homozygous missense variant (M227V) in 2 unrelated infertile Tunisian men with NOA Sources: Literature; to: i) PMID: 29581481- a homozygous missense variant (M227V) in 3 infertile brothers from a consanguineous Algerian family with male infertility (owing to azoospermia, sperm immotility or necrospermia) ii) PMID: 35172124- previously reported homozygous missense variant (M227V) in 2 unrelated infertile Tunisian men with NOA Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | PDHA2 |
Jasmine Chew gene: PDHA2 was added gene: PDHA2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PDHA2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDHA2 were set to 29581481; 35172124 Phenotypes for gene: PDHA2 were set to Spermatogenic failure 70, MIM# 619828 Review for gene: PDHA2 was set to GREEN Added comment: i) PMID: 29581481- a homozygous missense variant (M227V) in 3 infertile brothers from a consanguineous Algerian family with male infertility (owing to azoospermia, sperm immotility or necrospermia) ii) PubMed: 35172124- previously reported homozygous missense variant (M227V) in 2 unrelated infertile Tunisian men with NOA Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SYCP3 | Jasmine Chew reviewed gene: SYCP3: Rating: ; Mode of pathogenicity: None; Publications: 14643120, 19110213; Phenotypes: Spermatogenic failure 4, MIM# 270960, Recurrent pregnancy loss 4, MIM# 270960; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SYCP3 | Jasmine Chew Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SYCP3 | Jasmine Chew reviewed gene: SYCP3: Rating: ; Mode of pathogenicity: None; Publications: 14643120, 19110213; Phenotypes: Spermatogenic failure 4, MIM# 270960, Recurrent pregnancy loss 4, MIM# 270960; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | RXFP2 |
Jasmine Chew changed review comment from: i) PMID: 39222519 (2024)- a compound heterozygous variant (intragenic deletion of exon 1-5 and missense variant p.Glu77Lys) in a family with two male members affected by impaired fertility due to spermatogenic maturation arrest and a history of bilateral cryptorchidism. The Glu77Lys mutant showed no cAMP activity and hence failed to signal in response to INSL3, confirming a loss-of-function mechanism. ii) PMID: 37208861 (2023)- Homozygous LOF (p.Phe469Serfs*8) and missense (p.Asn339Asp) variants in two unrelated infertile man with impaired spermatogenesis. The missense variant primarily impacts cell surface expression of the protein which directly correlates with reduced INSL3 activation (following protein expression studies). iii) PMID: 38430325 - a homozygous non-canonical splicing variant (NM_130806: c.1376-12A > G) in a case with cryptorchidism and NOA, which was confirmed to cause aberrant splicing of exons 15 and 16, leading to an abnormal transcript initiation and a frameshift using minigene assay. Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature; to: i) PMID: 39222519- a compound heterozygous variant (intragenic deletion of exon 1-5 and missense variant p.Glu77Lys) in a family with two male members affected by impaired fertility due to spermatogenic maturation arrest and a history of bilateral cryptorchidism. The Glu77Lys mutant showed no cAMP activity and hence failed to signal in response to INSL3, confirming a loss-of-function mechanism. ii) PMID: 37208861- Homozygous LOF (p.Phe469Serfs*8) and missense (p.Asn339Asp) variants in two unrelated infertile man with impaired spermatogenesis. The missense variant primarily impacts cell surface expression of the protein which directly correlates with reduced INSL3 activation (following protein expression studies). iii) PMID: 38430325 - a homozygous non-canonical splicing variant (NM_130806: c.1376-12A > G) in a case with cryptorchidism and NOA, which was confirmed to cause aberrant splicing of exons 15 and 16, leading to an abnormal transcript initiation and a frameshift using minigene assay. Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | RXFP2 |
Jasmine Chew gene: RXFP2 was added gene: RXFP2 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: RXFP2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: RXFP2 were set to 39222519; 37208861; 38430325 Review for gene: RXFP2 was set to GREEN Added comment: i) PMID: 39222519 (2024)- a compound heterozygous variant (intragenic deletion of exon 1-5 and missense variant p.Glu77Lys) in a family with two male members affected by impaired fertility due to spermatogenic maturation arrest and a history of bilateral cryptorchidism. The Glu77Lys mutant showed no cAMP activity and hence failed to signal in response to INSL3, confirming a loss-of-function mechanism. ii) PMID: 37208861 (2023)- Homozygous LOF (p.Phe469Serfs*8) and missense (p.Asn339Asp) variants in two unrelated infertile man with impaired spermatogenesis. The missense variant primarily impacts cell surface expression of the protein which directly correlates with reduced INSL3 activation (following protein expression studies). iii) PMID: 38430325 - a homozygous non-canonical splicing variant (NM_130806: c.1376-12A > G) in a case with cryptorchidism and NOA, which was confirmed to cause aberrant splicing of exons 15 and 16, leading to an abnormal transcript initiation and a frameshift using minigene assay. Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SLC26A8 |
Jasmine Chew changed review comment from: i) PMID: 23582645- 3 heterozygous missense variants in 3 unrelated infertile men, and studies in transfected CHO-K1 cells revealed reduced interactions with CFTR and complete failure of the all three mutant to activate CFTR-dependent anion transport. Immunoblot analysis also showed that the mutant protein was significantly less abundant than wildtype and the decreased abundance of the mutant protein results from instability and proteasomal degradation. ii) PMID: 34923715- Compound heterozygous variants in two unrelated infertile Chinese men with severe asthenozoospermia. The sperm motility of these homozygous probands was severely reduced, compared to the moderately reduced motility of sperm from the previously reported heterozygous probands (confirmed by immunoblot), consistent with SLC26A8 being the cause of their infertility phenotype, iii) PMID: 35181959- 3 heterozygous variants ( 2-bp deletion, V731I, 1-bp deletion) in 3 unrelated infertile men with asthenoteratozoospermia, and although transfection study showed a significantly reduction of SLC26A8 expression to nearly absence in transfected HEK293 cells, immunostaining of patient sperm showed no difference in SLC26A8 expression compared to control sperm and western blot analysis of spermatozoa lysates confirmed the similar expression of SLC26A8 between patient and control sperm. Also mentioned that previous studies (PMID: 22121115 and PMID: 17517695) had shown that Slc26a8 +/- mice were fertile, whereas Slc26a8-null mice were infertile, the authors suggested that heterozygous SLC26A8 variants might not be the direct cause of the asthenoteratozoospermic phenotype observed in infertile men, and that SLC26A8-associated male infertility is likely an autosomal recessive disorder. Sources: Literature; to: i) PMID: 23582645- 3 heterozygous missense variants in 3 unrelated infertile men, and studies in transfected CHO-K1 cells revealed reduced interactions with CFTR and complete failure of the all three mutant to activate CFTR-dependent anion transport. ii) PMID: 34923715- Compound heterozygous variants in two unrelated infertile Chinese men with severe asthenozoospermia. The sperm motility of these homozygous probands was severely reduced, compared to the moderately reduced motility of sperm from the previously reported heterozygous probands (confirmed by immunoblot), consistent with SLC26A8 being the cause of their infertility phenotype, iii) PMID: 35181959- 3 heterozygous variants ( 2-bp deletion, V731I, 1-bp deletion) in 3 unrelated infertile men with asthenoteratozoospermia. Although transfection study showed a significantly reduction of SLC26A8 expression to nearly absence in transfected HEK293 cells, immunostaining of patient sperm showed no difference in SLC26A8 expression compared to control sperm and western blot analysis of spermatozoa lysates confirmed the similar expression of SLC26A8 between patient and control sperm. Also mentioned that previous studies (PMID: 22121115 and PMID: 17517695) had shown that Slc26a8 +/- mice were fertile, whereas Slc26a8-null mice were infertile, the authors suggested that heterozygous SLC26A8 variants might not be the direct cause of the asthenoteratozoospermic phenotype observed in infertile men, and that SLC26A8-associated male infertility is likely an autosomal recessive disorder. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SLC26A8 |
Jasmine Chew gene: SLC26A8 was added gene: SLC26A8 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SLC26A8 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SLC26A8 were set to 23582645; 34923715; 35181959 Phenotypes for gene: SLC26A8 were set to Spermatogenic failure 3, MIM# 606766 Review for gene: SLC26A8 was set to GREEN Added comment: i) PMID: 23582645- 3 heterozygous missense variants in 3 unrelated infertile men, and studies in transfected CHO-K1 cells revealed reduced interactions with CFTR and complete failure of the all three mutant to activate CFTR-dependent anion transport. Immunoblot analysis also showed that the mutant protein was significantly less abundant than wildtype and the decreased abundance of the mutant protein results from instability and proteasomal degradation. ii) PMID: 34923715- Compound heterozygous variants in two unrelated infertile Chinese men with severe asthenozoospermia. The sperm motility of these homozygous probands was severely reduced, compared to the moderately reduced motility of sperm from the previously reported heterozygous probands (confirmed by immunoblot), consistent with SLC26A8 being the cause of their infertility phenotype, iii) PMID: 35181959- 3 heterozygous variants ( 2-bp deletion, V731I, 1-bp deletion) in 3 unrelated infertile men with asthenoteratozoospermia, and although transfection study showed a significantly reduction of SLC26A8 expression to nearly absence in transfected HEK293 cells, immunostaining of patient sperm showed no difference in SLC26A8 expression compared to control sperm and western blot analysis of spermatozoa lysates confirmed the similar expression of SLC26A8 between patient and control sperm. Also mentioned that previous studies (PMID: 22121115 and PMID: 17517695) had shown that Slc26a8 +/- mice were fertile, whereas Slc26a8-null mice were infertile, the authors suggested that heterozygous SLC26A8 variants might not be the direct cause of the asthenoteratozoospermic phenotype observed in infertile men, and that SLC26A8-associated male infertility is likely an autosomal recessive disorder. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SYCP3 | Jasmine Chew Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | SYCP3 |
Jasmine Chew gene: SYCP3 was added gene: SYCP3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: SYCP3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: SYCP3 were set to 14643120; 19110213 Phenotypes for gene: SYCP3 were set to Spermatogenic failure 4, Recurrent pregnancy loss 4, MIM# 270960 Review for gene: SYCP3 was set to GREEN Added comment: Spermatogenic failure 4, MIM# 270960 i) PMID: 14643120- identified a heterozygous 1-bp deletion (643delA) in 2 unrelated patients with azoospermia with with maturation arrest , resulting in a premature stop codon and truncation of the C-terminal, coiled-coil-forming region of the protein. The mutant protein showed greatly reduced interaction with the wildtype protein in vitro and interfered with SYCP3 fiber formation in cultured cells. The results suggested that SYCP3 has an essential meiotic function in human spermatogenesis that is compromised by the mutant protein by dominant-negative interference. Pregnancy loss, recurrent, 4, MIM# 270960 i) PMID: 19110213- identified a heterozygous deletion and a point variant (-16delACTT in intron 7 and 657T-C transition at the last nucleotide of exon 8) in 2 of the women with recurrent pregnancy loss that were not found in 150 fertile women. Both mutant proteins were shown to inhibit normal fiber formation of SYCP3 when coexpressed in a heterologous system. This suggested that the heterozygous variants are likely to form aberrant lateral elements in the synaptonemal complex in a dominant-negative manner, possibly leading to abnormal chromosomal behavior in meiosis I during oogenesis that might lead to recurrent miscarriage. Also noted that the SYCP3-related phenotype in humans, in which affected males are infertile whereas affected females have recurrent pregnancy loss, is similar to that seen in Sycp3-deficient mice (Yuan et al., 2000; Yuan et al., 2002). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | KHDC3L |
Jasmine Chew gene: KHDC3L was added gene: KHDC3L was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: KHDC3L was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: KHDC3L were set to 21885028; 19246479; 23232697; 31847873; 31609975; 29606347 Phenotypes for gene: KHDC3L were set to Recurrent hydatidiform mole 2, MIM# 614293 Added comment: Biallelic variants have been reported for several unrelated families with recurrent complete hydatidiform mole (CHM) pregnancy- predominantly biparental and RPL- PMID: 21885028, 19246479, 23232697. New evidence- i) PMID 31847873: homozygous LOF variant in a woman with multiple consanguineous marriages in her extended family and history of 2 biparental complete hydatidiform mole (BiCHM) and methylation study on her oocytes revealed a genome-wide deficit of DNA methylation compared with normal human oocytes. ii) PMID: 31609975- two deletions of KHDC3L (p.E150_V160del and p.E150_V172del) in female RPL patients, both of which harbor a common loss of Thr156 and are impaired in PARP1 activation and homologous recombination (HR) repair. Also provided functional evidence that KHDC3L dysfunction causes PARP1 inhibition and HR-mediated DNA repair deficiency, which is synthetically lethal. iii) PMID: 29606347- a novel homozygous frameshift p.Q15Rfs*25 variant in a female patient (II-1) from family 4 with a history of 2 spontaneous abortions and x2 partial hydatidiform moles, and her embryos formed after ICSI are fertilized normally but arrest at the morula stage. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | PADI6 |
Jasmine Chew gene: PADI6 was added gene: PADI6 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: PADI6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PADI6 were set to 29693651; 33583041; 33221824; 27730629; 27545678 Phenotypes for gene: PADI6 were set to Oocyte/zygote/embryo maturation arrest 16, #MIM 617234 Review for gene: PADI6 was set to GREEN Added comment: i) PMID: 29693651- a compound het variant (N598S and R682Q) in a female with a total of six pregnancy losses from natural spontaneous conceptions, two of them were initially diagnosed as miscarriages and four as molar pregnancy. ii) PMID: 33583041- a novel homozygous missense variant (p.Ile599Asn) in a woman with a total of seven pregnancy losses from spontaneous conceptions, four HMs including two with fetuses and three miscarriages. iii) PMID: 33221824- a compound het variant (p.Thr372Ala and p.Trp690*) in a German woman with and miscarriages and also occurrence of multilocus imprinting disturbance (MLID) in two children each carrying a heterozygous variant.. iv) PMID: 27730629- a homozygous nonsense variant (p.Arg457*) in a Saudi woman with primary infertility and early development arrest during embryonic cleavage stages after in vitro fertilization. v) PMID: 27545678- homozygous nonsense variant (p.Gln381∗) in one familial case (consisting of three sisters) and compound heterozygous variants in 2 other unrelated patients with primary infertility and early development arrest during embryonic cleavage stages after in vitro fertilization. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | CCNB3 |
Jasmine Chew changed review comment from: i) PMID: 35722368- homozygous missense variant (p.P119Q) in the female of unexplained recurrent pregnancy loss (RPL) couple (couple 29) ii) PMID: 32938693- homozygous missense variant (p.V1251D) in two sisters with RPL and two of their POCs were characterised and found to be triploid digynic due to the failure of meiosis II. iii) PMID: 34021051- novel homozygous frameshift variant (p.Val1321Glyfs*4, due to splicing causing exon skipping) in a patient with 16 RPL and one of her miscarriages is triploid digynic resulted from the failure of meiosis I. Supporting mouse evidence: iv) PMID: 30770433- Ccnb3 knockout also causes female infertility due to the failure of metaphase to anaphase transition in meiosis I and the extrusion of the first polar body. The infertility in these mice appeared to be due to embryonic lethality before embryonic day 7.5 and some of their oocytes fertilised by intracytoplasmic sperm injection led to triploid embryos. v) PMID: 34850816- Ccnb3-deficient mouse model is similar to a human infertility condition—recurrent pregnancy loss (RPL). Their findings demonstrate that the triploidy of embryos derived from Ccnb3-deficient oocytes is the primary cause of embryo death (i.e., such embryos can be rescued with euploid nuclei, whereas cytoplasmic Ccnb3 transcript is dispensable for zygotic genome activation and embryo development). Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature Sources: Literature; to: i) PMID: 35722368- homozygous missense variant (p.P119Q) in the female of unexplained recurrent pregnancy loss (RPL) couple (couple 29) ii) PMID: 32938693- homozygous missense variant (p.V1251D) in two sisters with RPL and two of their POCs were characterised and found to be triploid digynic due to the failure of meiosis II. iii) PMID: 34021051- novel homozygous frameshift variant (p.Val1321Glyfs*4, due to splicing causing exon skipping) in a patient with 16 RPL and one of her miscarriages is triploid digynic resulted from the failure of meiosis I. Supporting mouse evidence: iv) PMID: 30770433- Ccnb3 knockout also causes female infertility due to the failure of metaphase to anaphase transition in meiosis I and the extrusion of the first polar body. The infertility in these mice appeared to be due to embryonic lethality before embryonic day 7.5 and some of their oocytes fertilised by intracytoplasmic sperm injection led to triploid embryos. v) PMID: 34850816- Ccnb3-deficient mouse model is similar to a human infertility condition—recurrent pregnancy loss (RPL). Their findings demonstrate that the triploidy of embryos derived from Ccnb3-deficient oocytes is the primary cause of embryo death (i.e., such embryos can be rescued with euploid nuclei, whereas cytoplasmic Ccnb3 transcript is dispensable for zygotic genome activation and embryo development). Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | CCNB3 | Jasmine Chew edited their review of gene: CCNB3: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | CCNB3 |
Jasmine Chew gene: CCNB3 was added gene: CCNB3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CCNB3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CCNB3 were set to 35722368; 32938693; 34021051; 30770433; 34850816 Added comment: i) PMID: 35722368- homozygous missense variant (p.P119Q) in the female of unexplained recurrent pregnancy loss (RPL) couple (couple 29) ii) PMID: 32938693- homozygous missense variant (p.V1251D) in two sisters with RPL and two of their POCs were characterised and found to be triploid digynic due to the failure of meiosis II. iii) PMID: 34021051- novel homozygous frameshift variant (p.Val1321Glyfs*4, due to splicing causing exon skipping) in a patient with 16 RPL and one of her miscarriages is triploid digynic resulted from the failure of meiosis I. Supporting mouse evidence: iv) PMID: 30770433- Ccnb3 knockout also causes female infertility due to the failure of metaphase to anaphase transition in meiosis I and the extrusion of the first polar body. The infertility in these mice appeared to be due to embryonic lethality before embryonic day 7.5 and some of their oocytes fertilised by intracytoplasmic sperm injection led to triploid embryos. v) PMID: 34850816- Ccnb3-deficient mouse model is similar to a human infertility condition—recurrent pregnancy loss (RPL). Their findings demonstrate that the triploidy of embryos derived from Ccnb3-deficient oocytes is the primary cause of embryo death (i.e., such embryos can be rescued with euploid nuclei, whereas cytoplasmic Ccnb3 transcript is dispensable for zygotic genome activation and embryo development). Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | CDC20 |
Jasmine Chew gene: CDC20 was added gene: CDC20 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: CDC20 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CDC20 were set to 32666501; 33683667; 33898437; 34218387 Phenotypes for gene: CDC20 were set to Oocyte/zygote/embryo maturation arrest 14, MIM# 620276 Review for gene: CDC20 was set to GREEN Added comment: i) PMID: 32666501- Biallelic (homozygous/compound heterozygous) variants in 5 unrelated Chinese women with infertility due to oocyte maturation arrest. Knocked down mouse oocytes showed an metaphase I (MI) arrest phenotype that could be rescued by injection of wildtype human CDC20 cRNA; all of the variants significantly reduced the ability of CDC20 to rescue the phenotype. ii) PMID: 33683667- a compound heterozygous (missense and nonsense) variant in a Chinese woman with infertility due to oocyte maturation abnormalities and early embryonic arrest. iii) PMID: 33898437- 4 patients from 3 Chinese families with homozygous or compound heterozygous variants with infertility due to oocyte maturation arrest, fertilization failure, and early embryonic arrest. Functional analysis in mouse oocytes with knockdown of Cdc20 showed that the homozygous and compound heterozygous variants significantly reduced the ability of CDC20 to rescue the lack of PB1 extrusion (MI arrest). iv) PMID: 34218387- homozygous missense variant in a Chinese woman with infertility due to oocyte maturation arrest at MI and fertilization failure of MII oocytes. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | NDP | Melanie Marty reviewed gene: NDP: Rating: GREEN; Mode of pathogenicity: None; Publications: 23444378, 8268931, 17325173, 27217716, 29181528, 31827910; Phenotypes: Norrie disease, MIM# 310600; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | NCF2 | Melanie Marty reviewed gene: NCF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 27178966, 7795241, 10498624; Phenotypes: Chronic granulomatous disease 2, autosomal recessive, MIM# 233710; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | MYD88 | Melanie Marty reviewed gene: MYD88: Rating: GREEN; Mode of pathogenicity: None; Publications: 18669862, 20538326, 31301515; Phenotypes: Immunodeficiency 68, MIM# 612260; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | MSTO1 | Melanie Marty reviewed gene: MSTO1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28554942, 28544275, 31604776, 31463572, 31130378, 30684668, 29339779; Phenotypes: Myopathy, mitochondrial, and ataxia, MIM# 617675; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | MICU1 | Melanie Marty reviewed gene: MICU1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24336167, 29721912, 32395406; Phenotypes: Myopathy with extrapyramidal signs, MIM# 615673; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | TACC3 |
Jasmine Chew changed review comment from: PMID: 36395215- compound heterozygous variants (Patient 1- p.Ser177Thr/p.Pro395Arg, Patient 2- p.Lys225_Cys236del/p.Gly631Val) in two unrelated females presented with oocyte maturation arrest and undetectable spindles on both polarization and fluorescence microscopy. Their oocytes lacked huoMTOCs and had poorly organized microtubules, similar to the phenotype of TACC3 depletion in vitro, which suggests a loss-of-function mechanism causing oocyte maturation arrest and infertility. Sources: Literature; to: PMID: 36395215- compound heterozygous variants (Patient 1- p.Ser177Thr/p.Pro395Arg, Patient 2- p.Lys225_Cys236del/p.Gly631Val) in two unrelated females presented with oocyte maturation arrest and undetectable spindles on both polarization and fluorescence microscopy. Their oocytes lacked huoMTOCs and had poorly organized microtubules, similar to the phenotype of TACC3 depletion in vitro, which suggests a loss-of-function mechanism causing oocyte maturation arrest and infertility. Note: couldn't access MONDO # as website down (phenotypes to be updated) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | TACC3 |
Jasmine Chew gene: TACC3 was added gene: TACC3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: TACC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TACC3 were set to 36395215 Review for gene: TACC3 was set to GREEN Added comment: PMID: 36395215- compound heterozygous variants (Patient 1- p.Ser177Thr/p.Pro395Arg, Patient 2- p.Lys225_Cys236del/p.Gly631Val) in two unrelated females presented with oocyte maturation arrest and undetectable spindles on both polarization and fluorescence microscopy. Their oocytes lacked huoMTOCs and had poorly organized microtubules, similar to the phenotype of TACC3 depletion in vitro, which suggests a loss-of-function mechanism causing oocyte maturation arrest and infertility. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | ELL3 |
Jasmine Chew gene: ELL3 was added gene: ELL3 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: ELL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: ELL3 were set to 39820605 Review for gene: ELL3 was set to GREEN Added comment: PMID:39820605- 8 different heterozygous variants (5 missense, 3 splicing) in 8 unrelated couples who experienced consecutive early miscarriages due to embryonic aneuploidy. For the three splice variants, mini-gene splicing assays revealed that all led to abnormal splicing, and consequently premature termination of translation or exon skipping, consistent with LOF effect. Findings from functional analysis on human oocytes and knockout mouse oocytes overall supporting that ELL3 depletion increases the incidence of meiotic spindle abnormality and oocyte aneuploidy. Note: couldn't access MONDO # as website down (phenotypes to be updated) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | VIPAS39 | Michelle Torres reviewed gene: VIPAS39: Rating: GREEN; Mode of pathogenicity: None; Publications: 20190753, 35151346; Phenotypes: Arthrogryposis, renal dysfunction, and cholestasis 2 MIM#613404; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TRMT10A | Michelle Torres reviewed gene: TRMT10A: Rating: GREEN; Mode of pathogenicity: None; Publications: 24204302, 25053765, 33448213, 33067246, 26535115, 26526202, 26297882; Phenotypes: Microcephaly, short stature, and impaired glucose metabolism 1 MIM#616033; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TRAPPC12 | Michelle Torres reviewed gene: TRAPPC12: Rating: GREEN; Mode of pathogenicity: None; Publications: 32369837, 28777934; Phenotypes: Encephalopathy, progressive, early-onset, with brain atrophy and spasticity MIM#617669; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | SCNN1B | Crystle Lee reviewed gene: SCNN1B: Rating: GREEN; Mode of pathogenicity: None; Publications: 26807262; Phenotypes: Pseudohypoaldosteronism, type IB2, autosomal recessive, MIM#620125; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TRAPPC11 | Michelle Torres reviewed gene: TRAPPC11: Rating: GREEN; Mode of pathogenicity: None; Publications: 23830518, 26322222, 29855340, 30105108, 38564972; Phenotypes: Muscular dystrophy, limb-girdle, autosomal recessive 18 MIM#615356; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | SLC30A10 | Crystle Lee reviewed gene: SLC30A10: Rating: GREEN; Mode of pathogenicity: None; Publications: 38283630, 34877518, 22341971; Phenotypes: Hypermanganesemia with dystonia 1, MIM#613280; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | SLC7A7 | Crystle Lee reviewed gene: SLC7A7: Rating: GREEN; Mode of pathogenicity: None; Publications: 17764084; Phenotypes: Lysinuric protein intolerance, MIM#222700; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | STIM1 | Crystle Lee reviewed gene: STIM1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31448844, 20876309, 25935105; Phenotypes: Immunodeficiency 10, MIM#612783; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | LRSAM1 | Melanie Marty reviewed gene: LRSAM1: Rating: RED; Mode of pathogenicity: None; Publications: PMID: 38330802, 33568173; Phenotypes: Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TPP1 | Michelle Torres reviewed gene: TPP1: Rating: GREEN; Mode of pathogenicity: None; Publications: 31283065; Phenotypes: Ceroid lipofuscinosis, neuronal, 2 MIM#204500, Spinocerebellar ataxia, autosomal recessive 7 MIM#609270; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TOE1 | Michelle Torres reviewed gene: TOE1: Rating: GREEN; Mode of pathogenicity: None; Publications: 28092684, 36738896; Phenotypes: Pontocerebellar hypoplasia, type 7 MIM#614969; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | LONP1 | Melanie Marty reviewed gene: LONP1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31636596; Phenotypes: CODAS syndrome, MIM#600373; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | TBC1D20 | Michelle Torres reviewed gene: TBC1D20: Rating: GREEN; Mode of pathogenicity: None; Publications: 24239381, 32740904, 32162791; Phenotypes: Warburg micro syndrome 4 MIM#615663; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | WNT6 |
Jasmine Chew gene: WNT6 was added gene: WNT6 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: WNT6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: WNT6 were set to 36385415; 25750203 Phenotypes for gene: WNT6 were set to recurrent pregnancy loss susceptibility, MONDO:0000144 Review for gene: WNT6 was set to GREEN Added comment: i) PMID: 36385415- heterozygous missense variant (p.Arg70Gly) in a female with recurrent pregnancy loss (C21) ii) PMID: 25750203- four novel heterozygous (checked Sanger traces) variants (i.e, one missense P.Leu148Arg, one synonymous c. 522C>T, one variant in intron 1 c. 297+40G>A, and one variant in the 3′UTR c. 1127G>A ) in 4 women with unexplained recurrent miscarriages (RM), but only the missense variant was shown to affect the functional region of WNT6 that might explain the unexplained RM Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | XYLT2 | Michelle Torres reviewed gene: XYLT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 34925453, 26027496, 26987875, 30891060, 28484880; Phenotypes: Spondyloocular syndrome MIM#605822; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | CLN3 | Lilian Rudd Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | CLN3 | Lilian Rudd Added comment: Comment when marking as ready: Consider exclusion (Amber) as we will miss a high proportion of cases due to the founder variant being a 1kb deletion | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | CLN3 | Lilian Rudd Gene: cln3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | CLN3 | Lilian Rudd Tag for review tag was added to gene: CLN3. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | XRCC4 | Michelle Torres reviewed gene: XRCC4: Rating: GREEN; Mode of pathogenicity: None; Publications: 24389050, 25728776, 25872942; Phenotypes: Short stature, microcephaly, and endocrine dysfunction MIM#616541; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | MLC1 | Kate Scarff reviewed gene: MLC1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11254442, 18757878, 20301707, 29661901; Phenotypes: Megalencephalic leukoencephalopathy with subcortical cysts 1, MIM #604004; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | USP26 |
Jasmine Chew gene: USP26 was added gene: USP26 was added to Infertility and Pregnancy Loss. Sources: Literature Mode of inheritance for gene: USP26 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: USP26 were set to 34202084; 27089915 Phenotypes for gene: USP26 were set to Spermatogenic failure, X-linked 6, MIM# 301101 Review for gene: USP26 was set to GREEN Added comment: i) PMID: 34202084- hemizygous missense variants in 2 unrelated affected Chinese men with infertility due to asthenoteratozoospermia (R825G in proband H002, and N799S in proband H042) and functional analysis showed markedly reduced USP26 mRNA and protein levels in patient sperm. ii) PMID: 27089915- a novel hemizygous missense variant R344W in two affected Chinese men with non-obstructive azoospermia, which has been shown functionally to have reduce binding affinity and deubiquitinating activity of USP26 to androgen receptors. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | USH1G | Michelle Torres reviewed gene: USH1G: Rating: GREEN; Mode of pathogenicity: None; Publications: 20301442; Phenotypes: Usher syndrome, type 1G MIM#606943; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | METTL23 | Kate Scarff reviewed gene: METTL23: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 24501276, 24626631, 39152716, 32878022, 32439618, 32067349; Phenotypes: Intellectual developmental disorder, autosomal recessive 44, MIM #615942; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | UBE3B | Michelle Torres reviewed gene: UBE3B: Rating: GREEN; Mode of pathogenicity: None; Publications: 23200864, 23200864, 34012380, 32949109, 27763745; Phenotypes: Kaufman oculocerebrofacial syndrome MIM#244450; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL1 |
Sarah Milton gene: CDKL1 was added gene: CDKL1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL1 were set to PMID: 40088891 Phenotypes for gene: CDKL1 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL1-related Mode of pathogenicity for gene: CDKL1 was set to Other Review for gene: CDKL1 was set to AMBER Added comment: CDKL1 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 2 individuals with a neurodevelopmental disorder with de novo variants in CDKL1 sourced from databases containing individuals with neurodevelopmental disorders, no additional phenotypic information was provided. Both variants were missense and present in the population (c.505C>T - 13 heterozygotes in gnomad 4, c.344T>C - 2 heterozygotes gnomad 4). Both missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands partially rescued a loss of function model however overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v1.96 | CDKL2 |
Sarah Milton gene: CDKL2 was added gene: CDKL2 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature Mode of inheritance for gene: CDKL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: CDKL2 were set to PMID: 40088891 Phenotypes for gene: CDKL2 were set to Neurodevelopmental disorder, MONDO:0700092, CDKL2-related Penetrance for gene: CDKL2 were set to Complete Mode of pathogenicity for gene: CDKL2 was set to Other Review for gene: CDKL2 was set to AMBER Added comment: CDKL2 encodes a cyclin dependent kinase of which there are CDKL1-5 in humans. (CDKL5 has been associated with a neurodevelopmental disorder previously.) Bereshneh et al describe 5 individuals with a neurodevelopmental disorder with de novo variants in CDKL2. 3 variants were missense, 1 was an in frame single amino acid deletion. 2 of the individuals described were monozygotic twins who were born at 30/40 and also had PVL on neuroimaging. Phenotype included GDD (5/5) - severity not described, speech impairment (5/5), motor impairment (4/5), epilepsy (3/5), ID (3/5), IUGR (3/5), poor growth postnatally (3/5), GI/feeding issues (3/5), tone abnormality (3/5) Missense variants were located in the kinase domain and dominant negative mechanism was postulated based on drosophilia studies. Functional studies in drosphilia showed variants seen in probands did not completely rescue a loss of function model, as well as this, overexpression of transcripts containing the variants resulted in a more severe phenotype suggesting dominant negative. Authors also noted the larger than expected number of LOF variants in gnomad for the disease to be caused by this mechanism. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | MEGF10 | Kate Scarff reviewed gene: MEGF10: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 22101682, 22371254, 39654599, 36349186, 35370044, 34828389; Phenotypes: Congenital myopathy 10A, severe variant, MIM #614399, Congenital myopathy 10B, mild variant, MIM #620249; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Prepair 1000+ v1.1822 | LRAT | Kate Scarff reviewed gene: LRAT: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 11381255, 18055821, 22570351, 29973277, 24625443, 31448181; Phenotypes: Retinal dystrophy, early-onset severe, Leber congenital amaurosis 14, Retinitis pigmentosa, juvenile, all under MIM #613341; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | TEX11 | Zornitza Stark Marked gene: TEX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | TEX11 | Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | TEX11 | Zornitza Stark Classified gene: TEX11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2429 | TEX11 | Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2428 | TEX11 |
Zornitza Stark gene: TEX11 was added gene: TEX11 was added to Mendeliome. Sources: Expert Review Mode of inheritance for gene: TEX11 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: TEX11 were set to 25970010; 29661171; 34621296; 37124723 Phenotypes for gene: TEX11 were set to Spermatogenic failure, X-linked 2, MIM# 309120 Review for gene: TEX11 was set to GREEN Added comment: i) PMID:25970010- hemizygous variants in 7 out of of 289 azoospermic men, including a 90kb exonic deletion (Ex10-12) in 2 European men, 2 missense variants in 2 European/German men, and 3 splice variants in two white and one Arabic men. ii) PMID: 29661171 (2018)- a novel hemizygous missense variant (W856C) in two brothers with azoospermia (absent in the mother- ?can it be gonadal mosaicism). Their testicular biopsy revealed meiotic arrest and no post-meiotic round spermatids and mature spermatozoa were observed. iii) PMID: 34621296 (2021)- seven novel hemizygous variants in three familial (one missense, two splice) and four NOA-affected sporadic (three frameshift, one nonsense) cases iv) PMID: 37124723 (2023)- three novel hemizygous variants ( p.R105*, p.K143Q, and p.G859R) in three unrelated NOA males and their histological analysis of testicular biopsy specimens revealed thicker basement membrane of the seminiferous tubules and poorly developed spermatocytes. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | TEX11 | Zornitza Stark Marked gene: TEX11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | TEX11 | Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.12 | TEX11 | Zornitza Stark Phenotypes for gene: TEX11 were changed from #MIM:309120 to Spermatogenic failure, X-linked 2, MIM# 309120 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.11 | TEX11 | Zornitza Stark Classified gene: TEX11 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.11 | TEX11 | Zornitza Stark Gene: tex11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.10 | TEX11 | Zornitza Stark reviewed gene: TEX11: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure, X-linked 2, MIM# 309120; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2427 | SPAG6 | Zornitza Stark Marked gene: SPAG6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2427 | SPAG6 | Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2427 | SPAG6 | Zornitza Stark Classified gene: SPAG6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2427 | SPAG6 | Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2426 | SPAG6 |
Zornitza Stark gene: SPAG6 was added gene: SPAG6 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SPAG6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SPAG6 were set to 35232447; 38073178; 32124190 Phenotypes for gene: SPAG6 were set to Spermatogenic failure, MONDO:0004983, SPAG6-related Review for gene: SPAG6 was set to GREEN Added comment: i) PMID: 35232447- two homozygous variants (F1 II-1: p. A103D; F2 II-1:p. K196Sfs*6) in two unrelated Han Chinese men with nonsyndromic asthenoteratozoospermia with severe multiple morphological abnormalities of the sperm flagella. Immunostaining and WB showed lower SPAG6 expression in spermatozoa of both affected males. The couple with the missense variant as able to conceive successfully after undergoing ICSI. ii) PMID: 38073178- a homozygous missense p.R310W in three brothers (two brothers with both asthenozoospermia and oligozoospermia, third brother with azoospermia) iii) PMID: 32124190- a novel compound heterozygous variant (c.143_145del: p.48_49del, c.585delA: p.Lys196Serfs*6) in an infertile PCD patient with severe with asthenoteratozoospermia, presented with morphological defects of sperm flagella and lower mRNA and protein expression in mutant sperm. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.10 | SPAG6 | Zornitza Stark Marked gene: SPAG6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.10 | SPAG6 | Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.10 | SPAG6 | Zornitza Stark Phenotypes for gene: SPAG6 were changed from MONDO:0004983 to Spermatogenic failure, MONDO:0004983, SPAG6-related | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.9 | SPAG6 | Zornitza Stark Classified gene: SPAG6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.9 | SPAG6 | Zornitza Stark Gene: spag6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.8 | SPAG6 | Zornitza Stark reviewed gene: SPAG6: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure, MONDO:0004983, SPAG6-related; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2425 | SEPT12 | Zornitza Stark Marked gene: SEPT12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2425 | SEPT12 | Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2425 | SEPT12 | Zornitza Stark Classified gene: SEPT12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2425 | SEPT12 | Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2424 | SEPT12 |
Zornitza Stark gene: SEPT12 was added gene: SEPT12 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: SEPT12 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: SEPT12 were set to 22479503; 22275165; 35547809 Phenotypes for gene: SEPT12 were set to Spermatogenic failure 10, MIM#614822 Review for gene: SEPT12 was set to GREEN Added comment: i) PMID: 22479503- A homozygous truncating variant (c.474 G>A) in 15 unrelated infertile men and 9 of them had teratozoospermia (88 to 99% of abnormal sperm);Transfection studies also showed that the mutant SEPT12 disrupted filament formation of wildtype SEPT12 in a dose-dependent manner. ii) PMID:22275165- Two heterozygous missense variants (T89M and D197N) in a man with asthenoteratozoospermia and another man with oligoasthenozoospermia. Functional analysis demonstrated that both mutations adversely affected filament formation of wildtype SEPT12 in a dose-dependent manner. iii) PMID: 35547809- A heterozygous missense variant (p.Cys24Ter) in the male partner of a patient couple, who had a previous fertilization failure (FF) after intracytoplasmic sperm injection (ICSI) and became pregnant after ICSI together with artificial oocyte activation (AOA). Their Septin12 knockout mice study also showed that Septin12 -/- male mice are infertile with reduced sperm counts and abnormal sperm morphology but male Septin12 +/− mice are fertile. This observation contradicted with the previous studies showed that male Septin12 +/− chimeric mice are infertile (Lin et al., 2009, PMID: 19359518). The main difference is that the Septin12 +/− chimeric mice were generated in Lin et al., 2009 (PMID: 19359518) was by blastocyst injection of Septin12 +/− embryonic stem cells (ESCs), while their Septin12 +/− founder mice were established by CRISPR/Cas9 mediated gene editing in the zygote. The quality of injected Septin12 +/− ESCs might affect the experimental result. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.8 | SEPT12 | Zornitza Stark Marked gene: SEPT12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.8 | SEPT12 | Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.8 | SEPT12 | Zornitza Stark Phenotypes for gene: SEPT12 were changed from #MIM:614822 to Spermatogenic failure 10, MIM#614822 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.7 | SEPT12 | Zornitza Stark Classified gene: SEPT12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.7 | SEPT12 | Zornitza Stark Gene: sept12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.6 | SEPT12 | Zornitza Stark reviewed gene: SEPT12: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Spermatogenic failure 10, MIM#614822; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2423 | PLCZ1 | Zornitza Stark Marked gene: PLCZ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2423 | PLCZ1 | Zornitza Stark Gene: plcz1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2423 | PLCZ1 | Zornitza Stark Classified gene: PLCZ1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2423 | PLCZ1 | Zornitza Stark Gene: plcz1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v1.2422 | PLCZ1 |
Zornitza Stark gene: PLCZ1 was added gene: PLCZ1 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: PLCZ1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PLCZ1 were set to 26721930; 31463947; 36593593; 37004249 Phenotypes for gene: PLCZ1 were set to Spermatogenic failure 17, MIM# 617214 Review for gene: PLCZ1 was set to GREEN Added comment: i) PMID:26721930- homozygous missense variant (I489F) in 2 Tunisian brothers with infertility due to oocyte activation failure. ii) PMID:31463947- 3 homozygous variants (C196X, S350P, L246F) in 4 Chinese men from 3 consanguineous families with SPGF17 and total fertilization failure of oocytes after intracytoplasmic sperm injection. iii) PMID: 36593593- compound heterozygosity for splice site and missense variants (c.1174+3A-C and N425S in case 2; c.136-1G-C and G453D in case 3) in 2 unrelated Chinese men with infertility due to acrosomal abnormalities and total fertilization failure. iv) PMID: 37004249- previously reported homozygous variant (C196X) in two unrelated men with infertility due to total fertilization failure Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.6 | PLCZ1 | Zornitza Stark Marked gene: PLCZ1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.6 | PLCZ1 | Zornitza Stark Gene: plcz1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Infertility and Recurrent Pregnancy Loss v0.6 | PLCZ1 | Zornitza Stark Phenotypes for gene: PLCZ1 were changed from #MIM:617214 to Spermatogenic failure 17, MIM# 617214 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||